ID: 1125828721

View in Genome Browser
Species Human (GRCh38)
Location 15:42696051-42696073
Sequence ATGAATGAACAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 558}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125828721_1125828726 12 Left 1125828721 15:42696051-42696073 CCCTGCTCCTTCTGTTCATTCAT 0: 1
1: 0
2: 4
3: 63
4: 558
Right 1125828726 15:42696086-42696108 TATTCTGTGGGTATTATTTTAGG 0: 1
1: 0
2: 4
3: 30
4: 421
1125828721_1125828724 -1 Left 1125828721 15:42696051-42696073 CCCTGCTCCTTCTGTTCATTCAT 0: 1
1: 0
2: 4
3: 63
4: 558
Right 1125828724 15:42696073-42696095 TTCAACAAATGTTTATTCTGTGG 0: 1
1: 0
2: 9
3: 76
4: 553
1125828721_1125828725 0 Left 1125828721 15:42696051-42696073 CCCTGCTCCTTCTGTTCATTCAT 0: 1
1: 0
2: 4
3: 63
4: 558
Right 1125828725 15:42696074-42696096 TCAACAAATGTTTATTCTGTGGG 0: 1
1: 0
2: 6
3: 37
4: 377
1125828721_1125828727 21 Left 1125828721 15:42696051-42696073 CCCTGCTCCTTCTGTTCATTCAT 0: 1
1: 0
2: 4
3: 63
4: 558
Right 1125828727 15:42696095-42696117 GGTATTATTTTAGGATACAGCGG 0: 1
1: 0
2: 2
3: 20
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125828721 Original CRISPR ATGAATGAACAGAAGGAGCA GGG (reversed) Intronic
900865633 1:5266865-5266887 GAGAATGAACAGAAAGCGCAGGG + Intergenic
901400240 1:9010751-9010773 ATGAATGACCAGAACAAGGAAGG - Intronic
902270976 1:15304830-15304852 TAGAATTAACAGAAGGATCAAGG - Intronic
902294920 1:15460577-15460599 ATGAAGGAACAGGAAGGGCATGG + Intronic
902321054 1:15666621-15666643 ATGAATGAATCAAAGTAGCAAGG - Exonic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
903273329 1:22205726-22205748 ATGAATGAACAAAAGGTGGAAGG - Intergenic
903543694 1:24110794-24110816 AAGAAAGAGCAGAATGAGCAGGG - Intronic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
906153885 1:43602967-43602989 ATGCATGCACAGACAGAGCAAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907040650 1:51256208-51256230 AGGGATGAACAGATGGAACACGG - Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907573765 1:55507397-55507419 AGGAATGAAGAGCAGGAGAAGGG - Intergenic
907613289 1:55894992-55895014 ATGAATGTACTTAATGAGCATGG + Intergenic
907670544 1:56471280-56471302 ATGAAAGAAAAGAAGGAGAGAGG + Intergenic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908916347 1:69130602-69130624 ATGAATGAACAGGCTGGGCACGG - Intergenic
909285039 1:73805528-73805550 ATGAAATTACAGAATGAGCATGG + Intergenic
910025311 1:82643314-82643336 ATTAATGACAAGAAGGAGGATGG - Intergenic
910140119 1:84018036-84018058 ATGAATGAACAATGGAAGCATGG + Intergenic
910537560 1:88316156-88316178 ATGATTGTACAGAGTGAGCAAGG + Intergenic
911554502 1:99327126-99327148 ATCAATGAGCACCAGGAGCATGG + Intergenic
911639603 1:100273597-100273619 AATAATGAATAGCAGGAGCATGG + Intronic
912454043 1:109786019-109786041 ATGACTGAACAGAGGGGACAAGG - Intergenic
912662377 1:111543791-111543813 ATGAATGAAATGTAGGAGTAGGG - Intronic
913085592 1:115433685-115433707 ATGAATGATGACAAGGAGCCTGG + Intergenic
913332696 1:117680465-117680487 ATGAATGAGCAGGAAGGGCAGGG - Intergenic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913722298 1:121609686-121609708 ATGATTGAACAGAAAGAGAGAGG - Intergenic
913742058 1:121856944-121856966 ATGATTGAACAGAAAGAGAGAGG - Intergenic
913758372 1:122102851-122102873 ATGATTGAACAGAAAGAGAGAGG - Intergenic
914248020 1:145900250-145900272 ATAAATAAAAAGAAAGAGCAAGG - Intronic
914720512 1:150285073-150285095 AGAAATGAAAAGAAGGAGAAGGG - Intronic
914764184 1:150623478-150623500 AGGAAGGAATAGGAGGAGCAGGG - Intronic
916307328 1:163352431-163352453 ATGAATGAACTGAAGGAAAATGG - Intronic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916602755 1:166308996-166309018 AAGAATGAGTAGCAGGAGCACGG - Intergenic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
918316433 1:183326479-183326501 ATGAATGAAGAGGAGGATCCAGG + Intronic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919619007 1:199843781-199843803 AGGAAAGAACAGAGGGAGGAAGG - Intergenic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
920449759 1:206051087-206051109 AAGAAGGAAGAGAAAGAGCAGGG - Intronic
920700596 1:208215561-208215583 AAGAATGAAGGGAAGGATCAGGG + Intronic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
921350710 1:214231501-214231523 ATTAATTAGGAGAAGGAGCAGGG - Intergenic
921382437 1:214538201-214538223 AAGAATGAATGGAAGGAGGAAGG + Intronic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
922030951 1:221797648-221797670 ATGAATGAAGACAGGGAGGATGG + Intergenic
924291745 1:242543458-242543480 ATTAATGAATAGGAGGTGCAGGG + Intergenic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1063547661 10:6998137-6998159 AAGAATGATTAGGAGGAGCATGG - Intergenic
1063806706 10:9653224-9653246 ATGAATTAACAAAAGGATCTTGG + Intergenic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1066063522 10:31745187-31745209 AGGCTTGAAGAGAAGGAGCAAGG - Intergenic
1066587482 10:36952226-36952248 AAAAATGAAATGAAGGAGCATGG - Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1068594820 10:58891290-58891312 GTGAATGAAGACAAGGAGAATGG + Intergenic
1069381264 10:67845014-67845036 ATAAATGAAAAGCAGGAGAAAGG + Intergenic
1069912718 10:71769678-71769700 ATGAGTGAACAGCAGAGGCAGGG + Intronic
1070102209 10:73399076-73399098 ATGAAGGAAGAGAGAGAGCATGG - Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070469412 10:76764018-76764040 ATGGAAGAAGGGAAGGAGCAAGG + Intergenic
1070647971 10:78214616-78214638 ATGAAACAAAAGAAGGTGCATGG - Intergenic
1070705473 10:78634650-78634672 TTGAATGGACACAAGGAGAAAGG - Intergenic
1070723631 10:78773444-78773466 ATAATTGATCAGAAAGAGCAGGG - Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1071240049 10:83695563-83695585 ATGAATGAATCCAAGGAGAAGGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071751536 10:88482953-88482975 AGGAAGGAAAAGAAGGAGAAAGG - Intronic
1072053203 10:91726999-91727021 ATGAATTGATAGAAGGAGCCTGG + Intergenic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1074399930 10:113133637-113133659 ATGACTGAACAGAGCAAGCAGGG - Intronic
1075094172 10:119460367-119460389 ATAAATAAATAGAATGAGCAGGG + Intergenic
1075315876 10:121453063-121453085 ATGAAGGCTCAGAAGAAGCAGGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1078896262 11:15599971-15599993 ATGAATGAAGAGAGAGAGCAAGG + Intergenic
1079141424 11:17812592-17812614 AGGATTGAACAGGAGGAGAATGG - Intronic
1079365647 11:19807156-19807178 ATGAATGAACAGAAAGGCCATGG - Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1081998811 11:47381035-47381057 ATGAATGAACACATCAAGCAGGG - Intergenic
1082770479 11:57203836-57203858 ATAAAAGAACAGGATGAGCATGG + Intergenic
1083039815 11:59674792-59674814 ATTAATGAAAAGAAACAGCAAGG - Intergenic
1083291914 11:61695245-61695267 ATGGTTGAACAGAAAGAGCGGGG - Intronic
1084921108 11:72470671-72470693 ATGAATGATCAGAGTAAGCAGGG + Intergenic
1085596245 11:77813077-77813099 GTTAATAAACAGAAGAAGCAGGG - Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086019973 11:82215924-82215946 ATGAATGATCAGAAGGCTGAGGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086453337 11:86938411-86938433 AAGAATGAGCAGAAGGGCCACGG + Intronic
1086837826 11:91647680-91647702 TTGAGTGATCAGAAGGAGCCAGG - Intergenic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1088986545 11:114914261-114914283 ATGACTGAGAAGAAGGAACAGGG - Intergenic
1089390744 11:118099911-118099933 AAGATTCAACTGAAGGAGCAGGG + Intronic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1090448778 11:126787877-126787899 ATGAATGCCAAGAAGAAGCAGGG - Intronic
1090594731 11:128309272-128309294 ATAAATCAAGAGCAGGAGCAAGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092010355 12:5105270-5105292 ATAAGTGAACTGAAGGAACAGGG + Intergenic
1092277798 12:7075351-7075373 AGGAAGGAACAGAAGGAGGGAGG - Intergenic
1092389708 12:8065221-8065243 CTGCATGAACTGAAGTAGCAGGG + Intronic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092732236 12:11545723-11545745 ATGAATGAAGAGAAGAAGGCAGG - Intergenic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093275000 12:17115024-17115046 AAGAATTAAAAGAAGGAGCTTGG + Intergenic
1093685771 12:22052365-22052387 ATGAATGAACGAAAGAAGGAAGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1095349607 12:41192674-41192696 ATGAATGAACAGTTGAAACAAGG + Intronic
1095676328 12:44923201-44923223 ATGAATGAAAAAAAGGTGCAGGG + Intergenic
1096584159 12:52608667-52608689 ATGAACAAACAGGAGTAGCAAGG + Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1098196860 12:68011511-68011533 ATGAATAGAAAGAAGGACCATGG + Intergenic
1098700525 12:73618862-73618884 ATGTATGAATGGAAGGAGAAAGG - Intergenic
1098799369 12:74934535-74934557 AAGAATGAACACAAGAAGGAAGG + Intergenic
1099354650 12:81618831-81618853 ATGAATGAATAGAAGTGCCATGG - Intronic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100506947 12:95230762-95230784 ATGAATGCAGAGCAGAAGCAAGG - Intronic
1100569443 12:95833289-95833311 AGCAATGAACAGAAGGAAAATGG - Intergenic
1100745149 12:97637422-97637444 AAGAATGAAAAGAAGAAGGAAGG - Intergenic
1100775037 12:97964550-97964572 AAGAATGAACAGGAGAAGCTTGG - Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1100868941 12:98890031-98890053 ATGAATGATCAGAAGAAGACAGG + Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1103698217 12:122834298-122834320 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
1104691959 12:130833168-130833190 ATGAATGAAGAGCAAGAGAAGGG + Intronic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106106904 13:26741242-26741264 ATCAATGAGTAGAAGGATCATGG + Intergenic
1107476035 13:40736196-40736218 ATGAATGAAATGAAGCAGGAAGG + Intronic
1107877707 13:44805274-44805296 ATGGAGGAAAAGAAGGAGCTAGG - Intergenic
1107973616 13:45668791-45668813 ATGAATGAAATGAAGCAACAAGG - Intergenic
1108220443 13:48228394-48228416 AGGGATGAATAGGAGGAGCAGGG - Intergenic
1108327416 13:49347856-49347878 AGGAAGGAAAAGAAGGAGGAAGG - Intronic
1108686009 13:52819065-52819087 AAGAAAGAAAAGAAGGAGAAGGG - Intergenic
1109406016 13:61901307-61901329 ATGAATGACAAAAAGGACCAAGG + Intergenic
1110457063 13:75700995-75701017 ATGAATGAACAAATAGAACATGG - Intronic
1110602469 13:77390597-77390619 ATGACTGGAAAGAAGGAGCTTGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1112089282 13:96065524-96065546 TTGAATGAACAGACTGAGTAAGG - Intergenic
1112720246 13:102236163-102236185 ATGAAAGAATAGACAGAGCAGGG - Intronic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1115098265 14:29666152-29666174 ATGAATGAACAAAGAGAGCGTGG + Exonic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115476537 14:33819852-33819874 ATGAAATAACAGGACGAGCATGG - Intergenic
1115634277 14:35276321-35276343 AAGAATGAGAAGAAGGAACAGGG + Intronic
1116218056 14:42045678-42045700 AAGAATAAGCAGCAGGAGCATGG - Intergenic
1116243358 14:42376787-42376809 AAGAATGGACAGAAAGACCAAGG - Intergenic
1116965614 14:51011647-51011669 AAAAATGAAAAGAAGGAACAAGG - Intronic
1117125738 14:52623170-52623192 ATGAATGTACAGATGTGGCAGGG - Intronic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117651224 14:57907848-57907870 ATAAATGTACAGAACGTGCAGGG + Intronic
1117797356 14:59408315-59408337 ATGATTGAACAGTAGAAGTATGG + Intergenic
1118329840 14:64806643-64806665 ATGAGTGCACAGAAGAATCAAGG - Intronic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1119123018 14:72097567-72097589 AAGAATGAAGAGGAGGAGAAGGG + Intronic
1119818923 14:77596824-77596846 TGGTATGAACAGAAAGAGCAAGG + Intronic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1120299633 14:82690539-82690561 AGGAAGGAATAGGAGGAGCAGGG - Intergenic
1120532558 14:85650267-85650289 ATGAATGAATTAAAGGAACATGG - Exonic
1121166888 14:91810380-91810402 ATGAAAGAAGAGAAGTAGGAAGG + Intronic
1121275954 14:92667787-92667809 CTGAATGACCATATGGAGCATGG - Intronic
1121786872 14:96668533-96668555 ATGAATGAACTGATGGGGGACGG - Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1122020486 14:98833913-98833935 ATGAGAGGACAGAAGGAGCTGGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122285808 14:100651791-100651813 AGGAATGAACAGCAGGAGACAGG - Intergenic
1122448919 14:101787913-101787935 ATGAATGAATAGCATGAGAAAGG - Intronic
1123434724 15:20246815-20246837 ATGAGTGCAGGGAAGGAGCAAGG + Intergenic
1123976835 15:25561609-25561631 AGGAAGGAACAAAAGGAGAAGGG + Intergenic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1125688036 15:41575256-41575278 CTGAATGAACAGGAGGGCCAGGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG + Intergenic
1126683066 15:51222725-51222747 ATGAATGAACGGAAGGAGATAGG + Intronic
1126798484 15:52279838-52279860 AATAATGAAAAGTAGGAGCAGGG + Intronic
1126862278 15:52897137-52897159 AGGAATGAAATGAAGGATCAAGG - Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127324630 15:57883327-57883349 ATGACTGCAAAGAAGGAGCATGG - Intergenic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1129721878 15:77882033-77882055 ATGAAGGAGCAGAGGGACCAGGG - Intergenic
1130041543 15:80409216-80409238 AGGAATGAATAGGTGGAGCATGG - Intronic
1130387294 15:83422912-83422934 ATGAAAGAACACAGGGATCATGG - Intergenic
1130617054 15:85420392-85420414 ATGAATGAACAGACTGGGCTAGG - Intronic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134325613 16:13204886-13204908 AAGAATGAACTGAAGGAACCAGG - Intronic
1137039989 16:35601712-35601734 ATGTATGGACAGAAAAAGCAAGG + Intergenic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1138529568 16:57627837-57627859 AGGAATGACCAGAAGGGGGATGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141031964 16:80596923-80596945 ACGAATGAACAGAAGAATGACGG + Intergenic
1141053225 16:80792259-80792281 ATGAAAGAACAGAAGAACCCTGG + Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141659349 16:85433569-85433591 ATGGATGAAGAGAAGGATCCTGG + Intergenic
1141709007 16:85687335-85687357 ATAACGGAACAGAGGGAGCACGG + Intronic
1142058476 16:88015189-88015211 AGGGATGGGCAGAAGGAGCACGG - Intronic
1143858160 17:9868126-9868148 ATGAATGAATGAAAGGAGAAAGG + Intronic
1144835132 17:18152830-18152852 ATGAATGGTGAGAAGGAGCCAGG - Intronic
1145679460 17:26569774-26569796 ATGATTGAACAGAAAGAGAGAGG - Intergenic
1145681039 17:26592446-26592468 ATGATTGAACAGAAAGAGAGAGG - Intergenic
1146645491 17:34574433-34574455 CTGAATGAAGTAAAGGAGCAAGG + Exonic
1146674501 17:34764047-34764069 ATGAATGAGTAAAAGCAGCAGGG + Intergenic
1146973184 17:37089249-37089271 ATAAAGGAAGAGAAGGAGAAGGG - Intronic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1148416932 17:47513996-47514018 ATGAATAAACTGAAACAGCAAGG + Intergenic
1149259320 17:54861705-54861727 ATGAATGAAATGAAGGAAAATGG - Intergenic
1149571477 17:57675321-57675343 GTGATGGAGCAGAAGGAGCATGG + Intronic
1149647876 17:58253550-58253572 TGGAATGAACAGAATTAGCAGGG - Intronic
1150030911 17:61734427-61734449 ATGAATGATCAGAAGCATCTGGG + Intronic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1151054670 17:71017683-71017705 GTGATTGGACAGAAAGAGCACGG + Intergenic
1151664629 17:75538497-75538519 ATGAATGAACAGAGGAGGCGAGG - Intronic
1151991708 17:77579276-77579298 AGGAGTGACCAGAAGAAGCATGG - Intergenic
1152277596 17:79367250-79367272 ATGAAAGAAGAAAAGGAGGAGGG - Intronic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1153134107 18:1893983-1894005 ATGAATGAAAAGAAGCAGGGCGG - Intergenic
1153211076 18:2765717-2765739 ATAAATGAAAAGAAGTGGCATGG - Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1153801920 18:8678718-8678740 ATGAAAGAACAGTGTGAGCAGGG - Intergenic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1155418944 18:25633025-25633047 AGGAGTGAAGAGAAGGTGCAGGG - Intergenic
1155587683 18:27386428-27386450 ATGAATGGAAAAAAGGAGGAAGG - Intergenic
1155833159 18:30543440-30543462 ATGCCTGAACAGTAGCAGCAAGG - Intergenic
1156397965 18:36716363-36716385 ATGAAAGAAAAGAAGGAGTCAGG + Intronic
1157024603 18:43828146-43828168 AGGGATGAAGAGATGGAGCACGG - Intergenic
1157724370 18:49952457-49952479 GTGAAAGGAGAGAAGGAGCACGG - Intronic
1158238542 18:55349546-55349568 AAGAATGAAAAAAAGGAGGAAGG + Intronic
1158389163 18:57029874-57029896 ATGAATGATTAGAAGCAGCAGGG - Exonic
1158789423 18:60759152-60759174 ATGAATGAACAAAAGAGGAAAGG - Intergenic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159473552 18:68888228-68888250 ATGAATGAGCACAAAGAGAAGGG + Intronic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159848396 18:73494955-73494977 AAGAATGTACAGAAGAAGCTAGG + Intergenic
1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG + Intergenic
1160549949 18:79688027-79688049 AGGAATGTAAAGAAGGAACAAGG - Intronic
1160712700 19:559882-559904 ATGAATGGACAGACACAGCATGG - Intergenic
1162062843 19:8107263-8107285 ATAAATGGACAGAAGGAGGGGGG + Intronic
1163402897 19:17105036-17105058 AGGGATGAACAGGGGGAGCATGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164212696 19:23114144-23114166 ATTTATGGACAGAAGAAGCAAGG - Intronic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165431646 19:35776332-35776354 ATGAATGAGCGGGAGCAGCATGG - Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168586359 19:57596740-57596762 AGGGATGAACAGGTGGAGCACGG + Intergenic
925121858 2:1424793-1424815 ATGACTTTACAGAAGGAGCACGG - Intronic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121887 2:1425183-1425205 ATGACTTTACAGAAGGAGCATGG - Intronic
925121896 2:1425338-1425360 ATGACTGCACAGAACGGGCATGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
925121909 2:1425494-1425516 ATGACTTTACAGAAGGAGTACGG - Intronic
925121938 2:1425962-1425984 ATGACTTTACAGAAGGAGCATGG - Intronic
925121958 2:1426274-1426296 ATGACTTTATAGAAGGAGCATGG - Intronic
925121974 2:1426508-1426530 ATGACTTTACAGAAGGAGCATGG - Intronic
925121979 2:1426586-1426608 ATGACTTTACAGAAGGAGCATGG - Intronic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925425243 2:3744039-3744061 GCGAATGGACAGAAGGAGAATGG + Intronic
926040847 2:9671856-9671878 AGGGATGAATAGACGGAGCAAGG - Intergenic
926221070 2:10935712-10935734 GTGAATGAACAGCAGGAGGCCGG - Intergenic
926839142 2:17059128-17059150 ATAAAGGAGCCGAAGGAGCAAGG - Intergenic
927365909 2:22296106-22296128 ATGAAGGGAGAGAAGGAGCAGGG - Intergenic
928260985 2:29766488-29766510 ATGAATGAACAGGAGGTGGTGGG - Intronic
929566649 2:42990752-42990774 ATGAATGAAAAGAAGTAAGAAGG + Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
932490900 2:72119633-72119655 GAGAATGAAGAGAAGGGGCATGG - Intergenic
932890533 2:75592586-75592608 AAGAAAGAACAGAAGGAGACTGG - Intergenic
933435032 2:82238346-82238368 ATGCATTAAAATAAGGAGCAGGG + Intergenic
934052915 2:88225285-88225307 ATGAATGAATGGAAGAAGGAGGG + Intergenic
935014101 2:99163616-99163638 ATCAATGAACAGACAGGGCATGG - Intronic
935129152 2:100248290-100248312 ACAGATGAACAGGAGGAGCATGG - Intergenic
936618898 2:114074859-114074881 ATGCAGGTACAGAAGGATCAGGG + Intergenic
936669890 2:114644948-114644970 ATGACTGAACAGCAGAAGGAGGG - Intronic
936930133 2:117779568-117779590 ATGAATGAACTGAAGCAAGAAGG + Intergenic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939451798 2:142384004-142384026 AAGAAGGAAAAGAAGGAGAAAGG - Intergenic
940033976 2:149293969-149293991 CTGAAGGATTAGAAGGAGCAGGG + Intergenic
940154544 2:150640418-150640440 ATGAATTAATAGTAGAAGCAGGG + Intergenic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940927071 2:159376071-159376093 AAGCATGAACAGAAGGTACACGG + Intronic
940939323 2:159539889-159539911 ATGAATCACCAGAAAGAGCCAGG - Intronic
941004897 2:160237983-160238005 ATGAATGAAGAGTGGAAGCAGGG + Intronic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941439650 2:165518473-165518495 ATGAAGGAACAGGAGGATCTTGG + Intronic
941869327 2:170367162-170367184 AAGAATGAACAAAAGGACCAGGG - Intronic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
942535022 2:176954298-176954320 AGAAATGAAGAGAAGGAGGAAGG + Intergenic
942687818 2:178552304-178552326 AAGAATGCCAAGAAGGAGCATGG - Exonic
943190571 2:184673101-184673123 ATGAAATAAAAGAAGGAGGAAGG + Intronic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943788639 2:191907406-191907428 ATGAGAGAAGAGAAGGAGCAAGG - Intergenic
944475070 2:200095292-200095314 ATAAATCAACAGCAGAAGCACGG + Intergenic
944728090 2:202492031-202492053 ATTACTGAACTGAAGAAGCAAGG + Intronic
945000685 2:205346845-205346867 ATGCATGAACTGAAGGATAATGG - Intronic
945600075 2:211850648-211850670 ATGTATGATTAGAAGGAGCAAGG + Intronic
945680121 2:212903712-212903734 ATGAATGCACAGTAGAGGCAGGG + Intergenic
946102052 2:217333915-217333937 AGGAATGAAGAGAAGAAGCAAGG + Intronic
946341104 2:219069467-219069489 ATGAATGACCCAAAGGAGCCAGG - Intergenic
948049583 2:234969459-234969481 ATGAATGGGCAGGAGGAACAAGG - Intronic
948767747 2:240232277-240232299 ATCTCTGAACAGAAGGTGCAGGG - Intergenic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1170462650 20:16591941-16591963 ATAAAGGAAGAGAAGGAGTATGG + Intergenic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1171413690 20:24963340-24963362 ATGGAAGAGCAGAGGGAGCATGG - Exonic
1172014870 20:31867341-31867363 TGGAAAGAACAGAATGAGCAAGG - Intronic
1172473111 20:35215594-35215616 ATGAATGAACAAAGGCACCAAGG + Intergenic
1172475467 20:35234200-35234222 GTGAATGAACAGAAGAGGCTAGG - Intronic
1172528286 20:35614224-35614246 ATGAATGTTAAGAAGGAGCAGGG - Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173240992 20:41297142-41297164 TTGAATCAACACAAGGAGAATGG + Intronic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174576394 20:51540896-51540918 CTTAATGAACAGAAAGACCACGG + Intronic
1174729153 20:52897664-52897686 ATGAATGAACAAAAGCTGAACGG + Intergenic
1174753948 20:53139929-53139951 ATGAGTGAACATAAAGAGGATGG - Intronic
1175086500 20:56463861-56463883 ATGAATGAACGAAAGGAAAAGGG - Intergenic
1175351821 20:58327541-58327563 ATGATTCAAGAGAAAGAGCAAGG + Intronic
1175380095 20:58556970-58556992 ATGAATGACAAGAAGGAGCCAGG + Intergenic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175920581 20:62448880-62448902 ATAAATGAATAGAGGGTGCAGGG - Intergenic
1176219261 20:63962295-63962317 AAGAATGAAGTGAAGGAGAAAGG - Exonic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1176677035 21:9788498-9788520 ATGATTCAGCAGCAGGAGCAGGG - Intergenic
1176967837 21:15231398-15231420 ATTAATGAATATAAGTAGCAAGG + Intergenic
1177783868 21:25648611-25648633 AAGAATTAAGAGAAGGCGCAAGG - Intronic
1177958003 21:27624903-27624925 ATAAATGTACACAAAGAGCAAGG - Intergenic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181091038 22:20472815-20472837 TGGAATGATGAGAAGGAGCAGGG + Intronic
1181908733 22:26220829-26220851 ATGAATTGAGAGAAGGAGAAAGG + Intronic
1181915874 22:26279444-26279466 AGGAAAGAAGAGAAGGAGGATGG - Intronic
1182072614 22:27474375-27474397 ATGAACGAACAGCAGGAGGGAGG + Intergenic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184344318 22:43903662-43903684 TTTAATGAACAGAAGGAGTCCGG - Intergenic
1184457645 22:44620721-44620743 ATGGATGAACAGGAGCAGAATGG + Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
949121263 3:387366-387388 AAGAAAGAACAAAAGGAGCCAGG - Intronic
949431868 3:3985442-3985464 ATCGATAAACTGAAGGAGCATGG - Intronic
950009604 3:9713446-9713468 ATGAATGGACAGCAGAAGAATGG + Intronic
950311202 3:11959504-11959526 ATTAAGGAAAAGAAGGAGAATGG - Intergenic
951066821 3:18276635-18276657 ATGAAAGAACAGTAGGATCCTGG - Intronic
951274215 3:20665448-20665470 AAGAAGGAACAGAAGAAGAATGG - Intergenic
951534185 3:23726531-23726553 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
952574302 3:34756131-34756153 AAGAATGAACATTAGGAGAATGG - Intergenic
954718200 3:52537580-52537602 ATGGATGAACAGAAGGACTAAGG - Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
957269324 3:78008961-78008983 ATACATGATGAGAAGGAGCAAGG + Intergenic
958488526 3:94743306-94743328 ATGAAAGAACAGTATCAGCAGGG + Intergenic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
959502170 3:107119059-107119081 TTGACCCAACAGAAGGAGCATGG - Intergenic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960824146 3:121765800-121765822 ATGAAAAACCAAAAGGAGCAGGG - Intergenic
960967117 3:123113015-123113037 ATTAATAAAGAGAAGGAGCGAGG - Intronic
962229418 3:133648467-133648489 ATGAGTGGAGAGAGGGAGCAGGG + Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963265858 3:143239353-143239375 AAGAATGAACGGAAGAAGGAAGG + Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963917831 3:150876138-150876160 ATGAGTGAACTTAAGGAGAAAGG - Intronic
963922255 3:150916872-150916894 ATGAATGTACTGAAGGAATAAGG - Intronic
964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG + Intronic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966063336 3:175786426-175786448 ATGAATGAAATGAAGGAGAAGGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969129202 4:4978968-4978990 ATAAATGAAGTGATGGAGCAAGG - Intergenic
969665480 4:8554850-8554872 ATGGATGCGCACAAGGAGCAGGG - Intergenic
969971395 4:11052050-11052072 AAGAATGAACAGAACGAGGTAGG - Intergenic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
970511818 4:16788696-16788718 ATGAATGAAGACAAGAAGGAAGG + Intronic
971448778 4:26780139-26780161 AGGAAAGAACAGAAAGAGAAGGG + Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972874621 4:43343445-43343467 ATGAAGGAAAGGAAGGAGGAAGG - Intergenic
974277348 4:59740253-59740275 AGGAAGGAAAAGAAGGAGGAAGG - Intergenic
974338655 4:60585608-60585630 ATGACTCAACAAAAGAAGCAGGG + Intergenic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
974831474 4:67194718-67194740 AGGAAGGAAGAGAAGGAGGAAGG + Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976344901 4:83989549-83989571 ATGTAGGAAAAGAAGGAGCCAGG - Intergenic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977642809 4:99376274-99376296 ATGAATGAATAGATAAAGCAGGG - Intergenic
977919984 4:102632301-102632323 ATGAATGAAGTGAAGGATGAGGG + Intronic
977970308 4:103205596-103205618 ATCAATGAAGAAAAGGAGAAAGG - Intergenic
978066779 4:104414461-104414483 ATATTTGAACAAAAGGAGCAAGG + Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978949053 4:114535115-114535137 ATCAAAGAACAGAAGCAACATGG - Intergenic
980188720 4:129495673-129495695 ACCAATGAACAGAGGGACCAGGG - Intergenic
980794456 4:137662885-137662907 GTGAATGAACATAAGGAGATTGG - Intergenic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
981598046 4:146449434-146449456 CTGAAGGAACAAGAGGAGCAGGG + Intronic
984469302 4:180146174-180146196 ATGATTTAATAGAAGGAACATGG + Intergenic
984612354 4:181855949-181855971 AGGAAGGAACAAAAGGAGGAAGG + Intergenic
985075383 4:186208944-186208966 ATAAAGGAACAGAAGGAAAAAGG - Exonic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985110609 4:186543233-186543255 ATGATTGCACAGTAAGAGCAAGG + Intronic
985263198 4:188134252-188134274 ATGAAAGCACAGAAGAAGTATGG - Intergenic
985398509 4:189570286-189570308 ATGATTCAGCAGCAGGAGCAGGG + Intergenic
986342001 5:6797266-6797288 ATGAAGGAATAGAAAGAGCAGGG - Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
986736147 5:10668805-10668827 ATGACTGAACAGAAGGAGCCTGG - Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988237748 5:28568240-28568262 ATAAATGAACCAAAGCAGCATGG + Intergenic
988282056 5:29162236-29162258 ATGAATGTCCAGAAGAAGCTAGG + Intergenic
988495681 5:31743682-31743704 ATGGATGAACTGAAGGATGAAGG - Intronic
988821898 5:34895555-34895577 AGAAACCAACAGAAGGAGCAGGG + Intronic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
989559575 5:42835918-42835940 ATAAAAGAGCAGCAGGAGCAAGG + Intronic
990080871 5:51911979-51912001 AGCAAAGGACAGAAGGAGCAAGG + Intergenic
991052128 5:62284539-62284561 GTGAATGACCCAAAGGAGCAAGG - Intergenic
991405419 5:66296462-66296484 AGGAATGAAGAGATGGAGCATGG - Intergenic
992087444 5:73290540-73290562 AAGAACCTACAGAAGGAGCAGGG - Intergenic
992265996 5:75018809-75018831 AGGAATGAACATTAGGAGTAAGG + Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
993581969 5:89674253-89674275 ATAAATGTAAAGAAGGAGCCAGG + Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994538367 5:101060487-101060509 ATGAATGAAATGAAGCAGGAAGG - Intergenic
995388908 5:111617605-111617627 ATGAAAGAACACAAAGAACATGG + Intergenic
995409252 5:111836065-111836087 ATGAATGAACGAAGGGAGGAAGG - Intronic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996626743 5:125579428-125579450 ATGAATGTAAAGTAGGAGAATGG + Intergenic
997002357 5:129776685-129776707 ATGAATGAACCATAGGAGCAAGG + Intergenic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
997673729 5:135696856-135696878 GGGTATGAACTGAAGGAGCAGGG + Intergenic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
997896420 5:137721893-137721915 AGGAATCAAAAGAATGAGCAAGG + Intronic
998269534 5:140694224-140694246 ATGTATGATCTGAAGGATCAAGG + Exonic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1000683372 5:164215386-164215408 ATGAATGAGCAGTAGGTGCTGGG + Intergenic
1000879070 5:166676359-166676381 ATGAATCAACAGAAGATGAATGG - Intergenic
1002761288 6:204423-204445 TTGAATGCAAGGAAGGAGCAGGG - Intergenic
1002882564 6:1265854-1265876 ATGAAGGGGAAGAAGGAGCAAGG + Intergenic
1002934982 6:1663750-1663772 ATGAAGGAAATGAGGGAGCAGGG - Intronic
1003226457 6:4210477-4210499 ATGATTGATCAGAAGAAACAGGG + Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003941777 6:11035434-11035456 AAGGATGGATAGAAGGAGCATGG - Intronic
1004051765 6:12088516-12088538 GTCAAAGAACAGCAGGAGCAAGG + Intronic
1004077758 6:12360802-12360824 ATAAATGAACATAAGGAGGAAGG + Intergenic
1004311421 6:14549283-14549305 CTGAATGAAGACAAGGAACAGGG + Intergenic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004763883 6:18702170-18702192 AAAAATGAAAAGAAAGAGCAGGG - Intergenic
1005101750 6:22179584-22179606 ATGAATGAACTGAAGCAAGAAGG - Intergenic
1005700301 6:28394072-28394094 ATGAGTTAACTGAGGGAGCAAGG - Intronic
1005818054 6:29573707-29573729 ATGTTTGATCAGAAGGAACAGGG + Intronic
1007036133 6:38675514-38675536 ATGAATTTAAAGAATGAGCAAGG + Intergenic
1007783246 6:44265800-44265822 ATGAATGGAGTGAAGGAGGAAGG - Intergenic
1008741163 6:54610117-54610139 ATGAATGAATGGAGGGATCAAGG - Intergenic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1010249007 6:73689063-73689085 ATTAATTAACAGAAGCAGCTGGG - Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1012217084 6:96600470-96600492 AGGAATGAAGAAAAGAAGCAAGG - Intronic
1012319285 6:97822942-97822964 AAGAAAGAAAAGAAGGAGAAAGG + Intergenic
1012756920 6:103243318-103243340 ATAAATGAAGAGAAAGAGCTAGG + Intergenic
1013989138 6:116233337-116233359 ATGAATGAAGAAAAGAAGGAGGG - Intronic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014791196 6:125674360-125674382 ATGAATCAATGGAAGGACCAAGG - Intergenic
1015159492 6:130136564-130136586 ATGAATGGGCAGCAGGAGCAGGG - Intronic
1015304691 6:131694886-131694908 ATGAAAGAACACAAGGGACAAGG + Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1016743118 6:147549402-147549424 ATGTATGAACAGGAAGTGCAAGG + Intronic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1018237139 6:161737372-161737394 ATGAATGAAGAGCAGAGGCAGGG + Intronic
1019903307 7:4041585-4041607 AGGGGTGAACAGGAGGAGCATGG - Intronic
1020603942 7:10311242-10311264 AAGTATGAACAGACGGGGCAAGG + Intergenic
1021131391 7:16916716-16916738 AAGAATGAGCAGAAAAAGCATGG + Intergenic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021506207 7:21388373-21388395 AGGAATGAATAGGTGGAGCATGG - Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1022948568 7:35313758-35313780 AAGAATGGAAACAAGGAGCAGGG - Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023754959 7:43407794-43407816 ATGAATGGAGGGAAGGAGGAGGG - Intronic
1024920799 7:54552533-54552555 ATGAATGAATAAATGAAGCATGG - Intronic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1026112913 7:67472676-67472698 ATGAAGGAACAAGAGGACCAGGG + Intergenic
1026956575 7:74380060-74380082 ATGTATGAACAGAAGTATGAGGG + Intronic
1027453844 7:78362728-78362750 ATAGTTGAACAAAAGGAGCATGG - Intronic
1028038059 7:86010544-86010566 GTGAATTAAAAAAAGGAGCAAGG - Intergenic
1028127468 7:87130215-87130237 ATAAATGAACTGAAGAAGAAGGG + Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029967430 7:104754766-104754788 ATTAAGGAACAGGAGGAGCATGG + Intronic
1030996687 7:116367986-116368008 ATGAATGAAAACAAGGAAAAGGG - Intronic
1034369118 7:150579202-150579224 ATGAATGAAATGAAGCAGGAAGG - Intergenic
1034567816 7:151929537-151929559 ATGAAAGATCAGAAGCAGAAGGG - Intergenic
1035090393 7:156305507-156305529 ATAAATGAACACAAGGAGCCAGG + Intergenic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1036768306 8:11562886-11562908 ATGGAAGGACAGCAGGAGCAGGG + Intronic
1037662874 8:20942175-20942197 ATGCATGGAGAAAAGGAGCAAGG + Intergenic
1037687502 8:21155576-21155598 AGGAATGAATAGCAGCAGCATGG + Intergenic
1038490775 8:27969506-27969528 AGGGATGAACAGGCGGAGCACGG + Intronic
1039312126 8:36328120-36328142 TGGAATGGACAGAAGGAGTAAGG - Intergenic
1040004829 8:42611019-42611041 AGGGATGAACAGACAGAGCACGG + Intergenic
1040461521 8:47653492-47653514 ATGAAGGAAAAGAGGGAGCGAGG - Intronic
1041532362 8:58883944-58883966 ATGAATGGAAAGAAGCAACAAGG + Intronic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043255457 8:78131084-78131106 ATGAATCATCAGAGGGAACAGGG + Intergenic
1043308019 8:78821253-78821275 ATGTAAGAACAGAAAGAGAAAGG - Intergenic
1043459663 8:80446626-80446648 ATGAGTGGGCAGAATGAGCAGGG + Intergenic
1043922116 8:85995428-85995450 GTGAATGTGCTGAAGGAGCAGGG - Intronic
1044288720 8:90441928-90441950 AAGAAGGAACAGAAGTAGAAGGG + Intergenic
1044547379 8:93474814-93474836 ATGAATACACAAAAGGTGCAAGG - Intergenic
1044554238 8:93544704-93544726 ATAAATAAAAAGAAGGAGTAAGG + Intergenic
1044750527 8:95411466-95411488 ATGAAGGGAAGGAAGGAGCAGGG - Intergenic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1046071930 8:109266003-109266025 TTGAATGACCAGAAGGTGAAAGG - Intronic
1046100237 8:109605467-109605489 TTGAATGAAAAAAAGGAGCAGGG - Intronic
1046504418 8:115118580-115118602 TTGAATGAACAGTATGAGAAAGG + Intergenic
1046740165 8:117819534-117819556 ATGAATGAAAGGGAGTAGCAGGG + Intronic
1047689739 8:127339633-127339655 AGGAATGTACAGATGGAGCTAGG + Intergenic
1047775644 8:128068092-128068114 ATGCATGCACAGCAGGAACAGGG - Intergenic
1047815921 8:128462349-128462371 ATGAGTGAAAAGAAGAGGCAAGG - Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048590667 8:135818083-135818105 ATGAGCTAACAGGAGGAGCAAGG + Intergenic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050002183 9:1089362-1089384 AAGAACGAACGGAAGGGGCAAGG + Intergenic
1050266622 9:3897295-3897317 ATTAATGAACTGAAGTAGTAGGG + Intronic
1050475912 9:6040944-6040966 AGGAAGGAAAAGAAGGAGGAAGG - Intergenic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1054736168 9:68752538-68752560 AAGAAGGAAGAGAAGGAGCAAGG - Intronic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1056638863 9:88353094-88353116 ATGATAGGACAGAAGGAGTATGG - Intergenic
1057727509 9:97578615-97578637 ATGAATAAGCCGAGGGAGCATGG + Intronic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG + Intronic
1059996785 9:119918333-119918355 ATGAATCAATAGTAGGAGCAGGG - Intergenic
1060028305 9:120191782-120191804 ATAAATGAAATGAAGGAGCAGGG + Intergenic
1060874101 9:127067713-127067735 ATGAATAAACAGAAGCCCCAGGG - Intronic
1061594850 9:131622112-131622134 AGGGACGAACAGACGGAGCACGG + Intronic
1062635817 9:137490726-137490748 ATGAAAGAAGAGCAGGAGGACGG + Intronic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1186011184 X:5134923-5134945 GTGAAGGAAAAGAAGGAGAATGG + Intergenic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1187259058 X:17668457-17668479 ATGCAGGAACAGAAGGAGTGAGG - Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1187707778 X:22024968-22024990 ATCAAGGAGCAGAAGGAGCAAGG - Intergenic
1188072623 X:25735906-25735928 CTGAATGACAAGAAGGAGCCAGG + Intergenic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189364899 X:40380730-40380752 AGGAAGGAAAAGAAGGAGGAAGG + Intergenic
1189637885 X:43031663-43031685 ATGAATGAAAACAAGGTGAAAGG + Intergenic
1190030093 X:46963772-46963794 AAGAGTGAATAGAAGCAGCAAGG + Intronic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1192115048 X:68402070-68402092 TGGAATGAACCGAAGGAGAAAGG + Intronic
1193492546 X:82166966-82166988 AAGAATGAACAGAAGAGGCTGGG + Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194213681 X:91100839-91100861 AGGAATGAAAAGAAGGAGTAGGG + Intergenic
1194430285 X:93795075-93795097 AAGAAAGATCAGAAGGAGCTGGG + Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199895652 X:152125154-152125176 AAGAATGAACATAATGAGAATGG + Intergenic
1199965259 X:152814684-152814706 ATGAATGAAAAGAGAGAACATGG - Intergenic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1201550574 Y:15212756-15212778 AAAAATGAACAGAAGGTGCAAGG + Intergenic