ID: 1125829635

View in Genome Browser
Species Human (GRCh38)
Location 15:42704994-42705016
Sequence CCCATTCATCCTGATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125829623_1125829635 27 Left 1125829623 15:42704944-42704966 CCAGGCTGCTACCATGCTGAAAT 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1125829622_1125829635 28 Left 1125829622 15:42704943-42704965 CCCAGGCTGCTACCATGCTGAAA 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1125829627_1125829635 16 Left 1125829627 15:42704955-42704977 CCATGCTGAAATTTATTTGGGGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1125829628_1125829635 -6 Left 1125829628 15:42704977-42704999 CCCAGTGATGTGAGAATCCCATT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1125829629_1125829635 -7 Left 1125829629 15:42704978-42705000 CCAGTGATGTGAGAATCCCATTC 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125829635 Original CRISPR CCCATTCATCCTGATGGGGT GGG Intronic
900219426 1:1499551-1499573 TCTATTCACCCTGGTGGGGTTGG + Intergenic
901441876 1:9282889-9282911 CCCATTCATCCAGAGAGGGATGG + Intergenic
901745591 1:11371192-11371214 CCGAGTCAGCCTGAGGGGGTGGG + Intergenic
901830488 1:11889056-11889078 CCCATTGATCACGATGGGGTGGG + Intergenic
902081398 1:13823434-13823456 CCCAGCCTTCCTGTTGGGGTGGG + Exonic
902290110 1:15429758-15429780 CCCATGCTTCCTCAGGGGGTGGG - Exonic
904937800 1:34144170-34144192 ACCATTCCTCTTGATGGGGTGGG + Intronic
905848852 1:41258042-41258064 CCCATTCCTCCTCAGTGGGTAGG - Intergenic
906783224 1:48590929-48590951 GCCATTCATCATGGTGGAGTGGG + Exonic
909051619 1:70774476-70774498 CCCATTCCTCCTCACTGGGTGGG - Intergenic
909100249 1:71340715-71340737 CCCATTCATCCTTAGGGTTTTGG + Intergenic
912924969 1:113905573-113905595 CCCATTCATGGTGGTAGGGTTGG - Exonic
913098325 1:115540563-115540585 CCCATTTATTATGGTGGGGTGGG - Intergenic
913541154 1:119822346-119822368 CCCATCCTTCCTCATTGGGTGGG - Intergenic
915245222 1:154551649-154551671 CCCTTTCATTCTGCTGGGCTGGG - Intronic
916262034 1:162851679-162851701 CCCCTTCTTCCTCATGGGGGAGG + Intronic
917259245 1:173148930-173148952 CCCATTCTTCCTCACTGGGTGGG - Intergenic
917714686 1:177722257-177722279 CTCATTCCTCCTGATTGGGTGGG + Intergenic
917933983 1:179846483-179846505 CCCATTCAGATTGATGGGGCTGG - Exonic
919841814 1:201614640-201614662 TCCATTTGTCCTGATGGGGCGGG + Intergenic
922135482 1:222821208-222821230 CCAATTAATTCAGATGGGGTTGG + Intergenic
922422864 1:225471288-225471310 CCCAGGAACCCTGATGGGGTTGG - Intergenic
922958056 1:229622164-229622186 GTCATTCTTCCTGATGGGGGTGG - Intronic
924952548 1:248898001-248898023 CCCATTCCTCCTCACTGGGTGGG + Intergenic
1065062114 10:21913068-21913090 CCTATACATCCTGATGGGGGTGG + Intronic
1067242800 10:44510458-44510480 CCCATCGATCCTGCTGGGGCAGG + Intergenic
1068773828 10:60850686-60850708 CTCCTTCATCCTGATAGGGCTGG + Intergenic
1069687872 10:70330671-70330693 GGCATGCATCCTGATGGGGTGGG + Intronic
1074193095 10:111155024-111155046 CCCATTCATCCTGGTAGGACTGG - Intergenic
1076485261 10:130811551-130811573 CCCACTCATCCTCATGGGAGGGG - Intergenic
1077150025 11:1068528-1068550 CATATTCATCCTGATTGGGGTGG + Intergenic
1078174132 11:8956072-8956094 CCCATTATTCCTTTTGGGGTAGG + Intronic
1080188413 11:29519384-29519406 CCCTTCCATCCTTATGGGATGGG - Intergenic
1080214710 11:29827491-29827513 CCCATTCCTCCTCACTGGGTGGG + Intergenic
1080292629 11:30688138-30688160 CCCATTCCTCCCGAGTGGGTGGG + Intergenic
1082946907 11:58770861-58770883 CCCTTTCATCCTTTTGGGATAGG - Intergenic
1083617276 11:64032524-64032546 CCCACACAGCCTGGTGGGGTGGG - Intronic
1085451534 11:76637068-76637090 CCCATTCCTCCTGTTGCTGTAGG + Intergenic
1086021768 11:82239345-82239367 CCCATTCTTCCTGACAGGGTGGG - Intergenic
1086906506 11:92424132-92424154 CCCATTCTTCCTGATTGCTTTGG + Intronic
1088533931 11:110839416-110839438 CACATTCATCTGGAAGGGGTAGG - Intergenic
1091930558 12:4392274-4392296 CCCAGGCATCCTGAGAGGGTGGG - Intergenic
1092279302 12:7087636-7087658 CCCAATCCTCCTGATGGAGCTGG + Intronic
1093340459 12:17967316-17967338 CCCATCCATCCTCATTGGGCAGG - Intergenic
1094131415 12:27079433-27079455 CCCATTCAGCATGGGGGGGTTGG - Intergenic
1095188464 12:39228893-39228915 CCCTTTCATCATGATTGAGTGGG + Intergenic
1099667812 12:85653918-85653940 CCCATTCCTCCTCACTGGGTGGG - Intergenic
1100579147 12:95922225-95922247 CCTATTCACCCTGATGGTGATGG + Intronic
1101904612 12:108815283-108815305 CCCCTTCATCCCCCTGGGGTGGG - Intronic
1103012963 12:117471434-117471456 CACTTTCTTCCTCATGGGGTTGG + Intronic
1105668456 13:22586568-22586590 CCCATTCCTCCTCATTGGGTGGG - Intergenic
1107119187 13:36778821-36778843 TCCACTCCTCCTGATGGGGCAGG + Intergenic
1108186240 13:47891535-47891557 GCCATGCAAACTGATGGGGTAGG - Intergenic
1108699199 13:52929327-52929349 CTCATTCCTTCTGATGGGTTTGG + Intergenic
1110085660 13:71376118-71376140 CTCACTCATCCTCATGGGGGTGG - Intergenic
1113226863 13:108168875-108168897 CCCATTCCTCCTCACTGGGTGGG + Intergenic
1116493768 14:45536601-45536623 TCCACTCTTCCTTATGGGGTGGG - Intergenic
1117641105 14:57800041-57800063 CCCATTCCTCCTGACTGGGGAGG + Intronic
1119565154 14:75622467-75622489 CCCATTACTTCTGATGAGGTAGG - Intronic
1121432748 14:93899151-93899173 ACCTGACATCCTGATGGGGTGGG - Intergenic
1121599789 14:95194902-95194924 CCCAAGCATCCTGATGTGCTGGG + Intronic
1122577977 14:102753780-102753802 TCCATTCACCCTGGTGGGGTTGG - Intergenic
1125770610 15:42163176-42163198 ACCATTCATCCTGGTGTGCTTGG - Intronic
1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG + Intronic
1125875432 15:43140179-43140201 CCCAGTCATCTTTCTGGGGTTGG - Intronic
1128749846 15:70140981-70141003 CCCATTCATCCTGATGAGGCCGG + Intergenic
1129242287 15:74258895-74258917 CCCTTACACCCTGCTGGGGTGGG + Intronic
1129426500 15:75467407-75467429 CCCACTCATCCTTATGTGCTAGG - Exonic
1129466108 15:75725233-75725255 CCCAGTCATCCGGCTGGGGTTGG + Intronic
1135481999 16:22828364-22828386 CCCATACATGCTGATGAGGCTGG - Intronic
1138335553 16:56250063-56250085 CCAATTCTTCCTGATGGTTTGGG - Intronic
1138977511 16:62225819-62225841 TCACTTCATCCTGTTGGGGTTGG - Intergenic
1142434162 16:90046705-90046727 CCCTGTGACCCTGATGGGGTGGG - Intergenic
1142597610 17:1037118-1037140 CCCATCCATCCAGGTGGGGCTGG + Intronic
1142694629 17:1627100-1627122 CCCCTTCATCCCCATGGGGTTGG + Intronic
1146669132 17:34724819-34724841 CCCAGCCATTCTGATGGGGAAGG - Intergenic
1146844705 17:36175328-36175350 ACCATTCAACCTGCTGGGGCCGG - Intronic
1146857011 17:36263263-36263285 ACCATTCAACCTGCTGGGGCCGG - Intronic
1146863606 17:36325112-36325134 ACCATTCAACCTGCTGGGGCCGG + Intronic
1146872921 17:36387173-36387195 ACCATTCAACCTGCTGGGGCCGG - Intronic
1146880279 17:36438259-36438281 ACCATTCAACCTGCTGGGGCCGG - Intronic
1147066466 17:37925700-37925722 ACCATTCAACCTGCTGGGGCCGG + Intronic
1147075805 17:37987798-37987820 ACCATTCAACCTGCTGGGGCCGG - Intronic
1147077998 17:38005261-38005283 ACCATTCAACCTGCTGGGGCCGG + Intronic
1147087330 17:38067344-38067366 ACCATTCAACCTGCTGGGGCCGG - Intronic
1147093934 17:38129196-38129218 ACCATTCAACCTGCTGGGGCCGG + Intergenic
1147746912 17:42700388-42700410 CCCATCCATCATGACGTGGTGGG + Exonic
1148679084 17:49462972-49462994 CCAATTCAACCTGTTGGGGCAGG - Intronic
1149242148 17:54663224-54663246 CCCATTCTTCCTCACTGGGTGGG - Intergenic
1149847849 17:60017776-60017798 ACCATTCAACCTGCTGGGGCCGG - Intergenic
1150086205 17:62274393-62274415 ACCATTCAACCTGCTGGGGCCGG - Intronic
1151315345 17:73318434-73318456 CCCACTCATGCTGATGGCGTGGG + Intergenic
1152323438 17:79622245-79622267 CCCGTGGAGCCTGATGGGGTGGG + Intergenic
1153785304 18:8528972-8528994 CCCATTCCTCCTCATTGGGCGGG + Intergenic
1155464507 18:26120335-26120357 CCAATTCCTCCTCATGGGGCAGG + Intergenic
1157016306 18:43719494-43719516 CCCATCCCTCCTCATGGGGCAGG + Intergenic
1157726241 18:49966195-49966217 CCTACTCCTCCTGATGGGGGAGG - Intronic
1157778877 18:50420160-50420182 CCCATTCCTCCTCACTGGGTGGG - Intergenic
1159118236 18:64139721-64139743 CCCATCCATCCTGATAGAGAAGG - Intergenic
1163231135 19:16003054-16003076 CCCTTCCATCCTTATGGGGTGGG + Intergenic
1164011457 19:21206404-21206426 CCCCTTCATCCTCATGGGATGGG + Intergenic
1164015558 19:21253565-21253587 CCCCTTCATCCTTATGGGACGGG - Intronic
1164578415 19:29419347-29419369 CCCATCACTCCTGAGGGGGTGGG + Intergenic
1167616231 19:50535767-50535789 CCCATTCATCCTCCTGGGAGTGG + Intronic
926741325 2:16113978-16114000 CCCATTCTTCCTGATGTCATAGG + Intergenic
928035040 2:27815122-27815144 CCCATTGCTGCTGATGGAGTTGG - Intronic
929704554 2:44196558-44196580 CCAATCCACCCTTATGGGGTGGG + Intronic
930305028 2:49666427-49666449 CCCATTCCTCCTCACTGGGTGGG - Intergenic
933237571 2:79882436-79882458 CCCATCCATCCTCATTGGGTGGG - Intronic
933602529 2:84347771-84347793 CCCATCCTTCCTCATTGGGTGGG - Intergenic
934943362 2:98518593-98518615 CCCATCCATCCTGAAGGGCAGGG + Intronic
937883281 2:126883990-126884012 GCCATTCTTCTTGATGGCGTAGG + Intergenic
943612022 2:190045181-190045203 CCCATTCCTCCTCACTGGGTGGG - Intronic
943754589 2:191544848-191544870 GCCATTCTGCCTGAGGGGGTTGG + Intergenic
945811900 2:214559026-214559048 CCTGTTCACTCTGATGGGGTGGG - Intronic
1173226136 20:41163365-41163387 CCCACAGCTCCTGATGGGGTAGG - Exonic
1174483020 20:50844581-50844603 CACAGTCATCCCGATGAGGTTGG + Intronic
1176138056 20:63533668-63533690 CCCAGTCATCCCAATGGGGCAGG + Exonic
1178244535 21:30937871-30937893 ACCATTCAACTTGTTGGGGTGGG - Intergenic
1178997705 21:37420336-37420358 TCATATCATCCTGATGGGGTGGG - Exonic
1181013587 22:20056023-20056045 CCCTGGCAGCCTGATGGGGTGGG + Intronic
1181556614 22:23675061-23675083 CCCATTCAATGAGATGGGGTGGG + Intergenic
1181697775 22:24602522-24602544 CCCATTCAATGAGATGGGGTGGG - Intronic
1183043529 22:35201560-35201582 ACCACTCATGCTGAAGGGGTTGG + Intergenic
1185094073 22:48796481-48796503 CTGATTCATCCTGCTGGGGAGGG + Intronic
950772094 3:15320150-15320172 CCCATTCATCATGCTTTGGTTGG + Intronic
956547194 3:70417902-70417924 CTCCCTCATCCTGATGGGGTAGG + Intergenic
957394751 3:79622603-79622625 CCCATCCTTCCTCATTGGGTTGG + Intronic
959520459 3:107317828-107317850 CCCATTCCTCCTGACTGGGCGGG - Intergenic
961040636 3:123675758-123675780 CCGATACAGCCTCATGGGGTGGG - Intronic
961363231 3:126381050-126381072 CCAATTCCTCCTCATGGGCTGGG + Intergenic
962017089 3:131452967-131452989 CCCATTTATCCAGAAGGAGTTGG - Intergenic
962293485 3:134158118-134158140 CACCTTCTTCCTGATGGTGTGGG + Exonic
962796819 3:138856545-138856567 CCCATCCATCCCTGTGGGGTAGG - Intergenic
963052965 3:141158143-141158165 CCCATTCATCCTCACTGGGCAGG + Intergenic
963280871 3:143383817-143383839 CCCAGTCCTGCTGTTGGGGTGGG + Intronic
965317743 3:167212013-167212035 CCCATTCCTCCTCACTGGGTGGG + Intergenic
965609261 3:170527288-170527310 CACAGTCATCCTGATGAGGATGG + Intronic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969485523 4:7470440-7470462 TCCATTCATCCAGGTGGGATAGG + Intronic
969671865 4:8594102-8594124 CCCATGCATCCTGCTGGGTGAGG - Intronic
970666491 4:18342931-18342953 CCCATCCTTCCTCATTGGGTGGG - Intergenic
970717603 4:18944844-18944866 CCCTTTCATCAATATGGGGTTGG + Intergenic
974727393 4:65813805-65813827 CCCCATCATCCTGAAGGAGTTGG + Intergenic
977729203 4:100331403-100331425 CCCATTCCTCCTTACTGGGTGGG + Intergenic
979057531 4:116015562-116015584 TCCATTCATCCTTATGGGATGGG - Intergenic
982114715 4:152088608-152088630 CCCATTCATCCTTCTGGTGGAGG - Intergenic
982329582 4:154166182-154166204 CCCATTCATTCTCATAGTGTTGG - Intergenic
982646036 4:158026503-158026525 CCCATTCCTCCTCACTGGGTGGG + Intergenic
984211879 4:176860032-176860054 ATCATTCATTGTGATGGGGTAGG + Intergenic
987906725 5:24087915-24087937 TCCATTCCTCCTTATTGGGTTGG + Intronic
988221407 5:28350520-28350542 ATCATTCATCCTGATGAAGTGGG + Intergenic
989676673 5:43981471-43981493 CCCATTCCTCCTCACTGGGTGGG - Intergenic
989971984 5:50535927-50535949 TCCATTCATTCTGTTGGGGGGGG - Intergenic
990499719 5:56384016-56384038 CCCATTCCTCCTCACTGGGTAGG - Intergenic
991481689 5:67088063-67088085 CCCATTCATCCTGAAGATGAAGG + Intronic
993545139 5:89202713-89202735 CCCATTAATTCTGATGCCGTTGG + Intergenic
993792334 5:92223178-92223200 TCCATTCCTCCTGACGGGGTGGG - Intergenic
995599686 5:113781698-113781720 CCCATCAATCCTGATGGGTATGG + Intergenic
997418339 5:133746964-133746986 CCCAGGCATCCTGACGGGCTTGG + Intergenic
999953262 5:156672670-156672692 TCCCTTCATCCTTATGGGTTTGG + Intronic
1000166259 5:158651582-158651604 CTCATTCTTCCAGATGGGGAAGG - Intergenic
1001436821 5:171705623-171705645 GCCACACATCCTGATGGGGTGGG - Intergenic
1004314280 6:14572434-14572456 CCAATACATCCAGAAGGGGTGGG - Intergenic
1005882197 6:30070349-30070371 CCCATTTATACTTATGGGGAAGG + Exonic
1006604872 6:35249021-35249043 CCCTTCCAAGCTGATGGGGTCGG - Exonic
1007215586 6:40234975-40234997 CCCATTCCTCCTCATTGGGTGGG + Intergenic
1007472782 6:42101774-42101796 GCCAGCCACCCTGATGGGGTAGG - Exonic
1012741158 6:103018257-103018279 CCCATTCCTCCTCACTGGGTGGG - Intergenic
1012744093 6:103061444-103061466 TCAACTCATCCTGATGGTGTTGG + Intergenic
1017344908 6:153369549-153369571 CCCATTCCTCCTCACTGGGTGGG + Intergenic
1018914023 6:168121801-168121823 TCTATTAATCCAGATGGGGTAGG - Intergenic
1021975105 7:26004321-26004343 CCCTTTCCTCCTCATGAGGTTGG - Intergenic
1023207196 7:37763680-37763702 CCCATTCCTCCTCACTGGGTGGG + Intronic
1023640618 7:42253386-42253408 CCCATTCCTCCTCCTGGGATGGG + Intergenic
1027241014 7:76329048-76329070 CTCATTCATCCTTATGGTTTAGG - Exonic
1028120700 7:87053596-87053618 CTCATTCATCTATATGGGGTGGG + Intronic
1028517994 7:91698986-91699008 CCCATCCCTCCTGACTGGGTGGG + Intronic
1029682988 7:102125186-102125208 CCCACTCATCATCATGGGGAAGG - Intronic
1031804598 7:126292768-126292790 CCCATCCTTCCTCATTGGGTGGG + Intergenic
1032776818 7:135122305-135122327 CCCATCCTTCCTCATTGGGTGGG + Intronic
1041840735 8:62267710-62267732 CAAAATCATCCTGATGGTGTAGG - Intronic
1050405979 9:5309110-5309132 CCTATTCACCCTGTTGGAGTGGG - Intergenic
1052378279 9:27741957-27741979 CCCATTCCTCCTCACTGGGTGGG - Intergenic
1058418838 9:104816308-104816330 CACATGCTTCCTGATGAGGTTGG + Exonic
1062152712 9:135030168-135030190 CCCCCTCCTCCTGATGTGGTGGG + Intergenic
1186585424 X:10868132-10868154 CCCATACATTGTGGTGGGGTTGG - Intergenic
1188136040 X:26496679-26496701 CCCAATCATGGTGATGGGGAGGG - Intergenic
1188869859 X:35359947-35359969 CCCATTCTTCCTCACTGGGTGGG - Intergenic
1189684500 X:43549841-43549863 CTCATTCATCATGCTGGGGCAGG + Intergenic
1189973964 X:46444412-46444434 TTCAGTCATCCTGGTGGGGTGGG - Intergenic
1190342458 X:49308520-49308542 CCCCTTCATCCCTATGGGATGGG - Intronic
1191209724 X:57872059-57872081 TCCATTTCTCCTCATGGGGTGGG - Intergenic
1192067737 X:67904087-67904109 CCCGTTCCTCCTCATGGGGTGGG - Intergenic
1192923720 X:75734531-75734553 CCCATTCATCCTCAATGGGTGGG - Intergenic
1193675970 X:84453363-84453385 CACATGGATCCTGCTGGGGTTGG - Intronic
1193739751 X:85203275-85203297 CCCATTCTTCCTCACTGGGTGGG - Intergenic
1193758822 X:85440783-85440805 ACCACTCCTCCTCATGGGGTAGG - Intergenic
1193805140 X:85985595-85985617 CCCATTCCTCCTCATGAGGCAGG + Intronic
1194286794 X:92020462-92020484 CCCATTCTTCCTCATTGGGCAGG + Intronic
1194933873 X:99923675-99923697 CCCACTTATCCTAATGGGATAGG - Intergenic
1195486194 X:105409623-105409645 CCCACTCATCTTCATGTGGTTGG - Intronic
1196768615 X:119272050-119272072 CCCATCCATCCTGATGTGTGTGG + Intergenic
1196874723 X:120147142-120147164 CCCCTTCATCCTTATGGGATGGG - Intergenic
1199511572 X:148628458-148628480 CCCAATCATCCTGATTTAGTTGG + Intronic
1200604341 Y:5245022-5245044 CCCATTCTTCCTCATTGGGCAGG + Intronic
1202096022 Y:21248928-21248950 CCGTTTCATCCTTATGGGATGGG + Intergenic