ID: 1125834246

View in Genome Browser
Species Human (GRCh38)
Location 15:42736462-42736484
Sequence CGAGCGTGGAGGCCGCGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 216}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125834246_1125834268 25 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834268 15:42736510-42736532 TGCCCCCGCGGCGGGCCAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 147
1125834246_1125834253 -9 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834253 15:42736476-42736498 CCACGCTCGCGGGCCGGCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 161
1125834246_1125834264 17 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834264 15:42736502-42736524 CCGCCTCCTGCCCCCGCGGCGGG 0: 1
1: 0
2: 3
3: 47
4: 454
1125834246_1125834262 16 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834262 15:42736501-42736523 CCCGCCTCCTGCCCCCGCGGCGG 0: 1
1: 0
2: 0
3: 47
4: 367
1125834246_1125834267 24 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834267 15:42736509-42736531 CTGCCCCCGCGGCGGGCCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 172
1125834246_1125834254 -8 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834254 15:42736477-42736499 CACGCTCGCGGGCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 10
4: 119
1125834246_1125834269 26 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834269 15:42736511-42736533 GCCCCCGCGGCGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 243
1125834246_1125834259 13 Left 1125834246 15:42736462-42736484 CCAGGCCGCGGCCTCCACGCTCG 0: 1
1: 0
2: 3
3: 26
4: 216
Right 1125834259 15:42736498-42736520 GGCCCCGCCTCCTGCCCCCGCGG 0: 1
1: 0
2: 4
3: 71
4: 582

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125834246 Original CRISPR CGAGCGTGGAGGCCGCGGCC TGG (reversed) Exonic
900124676 1:1064157-1064179 TGAGGCTGGAGGCCACGGCCTGG - Intergenic
900223161 1:1520186-1520208 TGCGAGTGGAGGCCGAGGCCCGG + Exonic
900342193 1:2194555-2194577 CGGGCGTGGGGGCCGGGCCCGGG + Intronic
900414698 1:2529582-2529604 CGGGCGCGGCGGGCGCGGCCGGG + Exonic
900671417 1:3857169-3857191 TGAGAGTGGAGGCTGCGGCCGGG - Exonic
901643383 1:10704402-10704424 CGAGAGTGCAGGGCGCGGGCCGG + Intronic
902402997 1:16167989-16168011 GGGGCGGGGAGGCGGCGGCCCGG + Intergenic
903822197 1:26111444-26111466 AGGGAGGGGAGGCCGCGGCCGGG + Intronic
905404105 1:37721711-37721733 CCAGCGTGAGGGCCTCGGCCAGG + Exonic
905463072 1:38134003-38134025 CGAGGAGGGAGGCGGCGGCCGGG + Intergenic
905626071 1:39491427-39491449 CGGGCGAGGAGCCCGCAGCCTGG - Intergenic
906495846 1:46303239-46303261 CGACCATGGAGGCCACGTCCCGG - Exonic
910188816 1:84574389-84574411 CCAGCGTCGAAGCTGCGGCCGGG + Exonic
912383181 1:109258571-109258593 CCAGCGTGGCGGCCACCGCCTGG - Exonic
912716883 1:111989547-111989569 CGCGCGAGGAAGCTGCGGCCGGG + Intergenic
915121890 1:153634452-153634474 GGAGCGTGGAGGCCCCGGGGAGG + Intronic
917345155 1:174022046-174022068 GGAGCGGGGCTGCCGCGGCCGGG - Intronic
917975589 1:180235559-180235581 GGAGCGGGGAGGCCGCCGGCGGG + Intronic
1066685355 10:37976435-37976457 CGAGCCTGGAAGCCGCCTCCTGG - Intronic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1070947875 10:80408412-80408434 GGAGCTAGGAGACCGCGGCCCGG + Intronic
1072253794 10:93601436-93601458 CGCGCGGGGTGGCCTCGGCCAGG + Exonic
1075069299 10:119309988-119310010 GGAGCATGGAGGCCACAGCCTGG + Intronic
1075693750 10:124418769-124418791 GGCGCGGGGTGGCCGCGGCCCGG - Intronic
1075725290 10:124607843-124607865 CGGGGGCTGAGGCCGCGGCCCGG - Intronic
1075998984 10:126900528-126900550 GGAGTGTGGAGGCAGCGTCCAGG + Intergenic
1076035551 10:127196278-127196300 CGCGCGGGGAGGCAGCGGCTGGG + Intronic
1076840902 10:133044707-133044729 CAAGCGTGGCTGCCGTGGCCTGG - Intergenic
1076850593 10:133090651-133090673 GAAGCCTGGAGGCCGTGGCCAGG + Intronic
1076893903 10:133299495-133299517 AGATCTTGGAGGCCGCGGCAGGG + Exonic
1077164367 11:1128632-1128654 CGAGAGGGGAGGCCGGGGCTGGG - Intergenic
1083303734 11:61752495-61752517 GGAGCGTGGTGCCCGCGGCCGGG + Intergenic
1085348177 11:75781434-75781456 TGACCATGGAGGCCGTGGCCTGG - Intronic
1087912847 11:103773725-103773747 CGAGCGTGGTGGCCGGTGCCTGG - Intergenic
1090189602 11:124759583-124759605 CGAGGGTGGAGAGCGGGGCCTGG - Intronic
1090699230 11:129279384-129279406 GGGACTTGGAGGCCGCGGCCCGG - Intergenic
1091718332 12:2795307-2795329 CGCGCCCGGAGCCCGCGGCCGGG + Intronic
1092383589 12:8018708-8018730 CGGGCGCGGCGGCGGCGGCCTGG - Intergenic
1092659477 12:10722967-10722989 CGGGCGCCGGGGCCGCGGCCTGG + Exonic
1093685185 12:22046575-22046597 CGAGAGTGGGCGGCGCGGCCTGG + Intronic
1094354852 12:29566366-29566388 CGAGCATGGAGGCTGCTGCAGGG + Intronic
1095206285 12:39443347-39443369 CGGGCGTGGAGTCCCCAGCCTGG - Intronic
1095812224 12:46383388-46383410 GGAGCGGGGAGGCGGCGGGCGGG + Intergenic
1096101014 12:48970494-48970516 CGAGGGCGGAGGCCGCGGCCGGG + Exonic
1096493379 12:52025199-52025221 CGGGCGTGGTGGCGGCCGCCTGG - Intronic
1097166150 12:57087710-57087732 GGGGCGTGGAGGCCGTGGACCGG - Intronic
1100581273 12:95942766-95942788 CGAGCCTGGAGGCAGAGCCCCGG - Exonic
1102254088 12:111406150-111406172 CGAGCGAGGAGCCGGCGGGCGGG + Exonic
1103527996 12:121580308-121580330 CGCGCTCGGAGCCCGCGGCCGGG + Intronic
1104887828 12:132121477-132121499 CGCGCAGGGAGGCCGGGGCCAGG + Intronic
1107125403 13:36840462-36840484 CGAGCGTGGAGCCCTCGCCTGGG + Intergenic
1110436469 13:75482132-75482154 CGAGCGCGGCGGCCGCAGCGGGG - Intergenic
1111196524 13:84881886-84881908 CAAGAGTGAAGGCCTCGGCCGGG + Intergenic
1111672515 13:91348204-91348226 TGCGCGTGGCGGCCGCGCCCGGG + Intergenic
1112344024 13:98576313-98576335 CGAGCCTGGGGGACGCGTCCTGG + Intronic
1113656742 13:112072552-112072574 CTCGCGTGGAGGCCCAGGCCGGG + Intergenic
1113923589 13:113928347-113928369 CGCCTGTGGAGGCCGTGGCCGGG + Intergenic
1118994168 14:70822008-70822030 CGAGCGTGGGAGCCGAGCCCAGG - Intergenic
1119325814 14:73759202-73759224 CTGGCGTGGACGCCGCGTCCAGG + Intronic
1120789155 14:88563248-88563270 CCCGGGTGGACGCCGCGGCCTGG + Intronic
1121461380 14:94081209-94081231 CGTGCGTGGAGGTCCCGCCCCGG - Exonic
1122183421 14:99971753-99971775 CGTGCCTGGGGGCCGCCGCCGGG - Intronic
1123004583 14:105315089-105315111 GGCGCGCAGAGGCCGCGGCCAGG - Exonic
1125834246 15:42736462-42736484 CGAGCGTGGAGGCCGCGGCCTGG - Exonic
1127417382 15:58771081-58771103 CGGGCGTGGAGGGCGTGGCTAGG - Intergenic
1132480634 16:164822-164844 CGGGCGGGGCGGCCGGGGCCCGG + Intronic
1132497539 16:270932-270954 CCAGCGGGGAGGCTGCTGCCTGG - Intronic
1132554872 16:568032-568054 CCAGCATGGAGGCTGGGGCCAGG - Exonic
1132641681 16:981056-981078 CGAGCGTGGAGAGCGCGGGCGGG - Intronic
1134149658 16:11796480-11796502 CGACCTCGGAGGCCCCGGCCGGG + Intronic
1136585229 16:31180262-31180284 CCAGCTGGGAGGCCTCGGCCGGG - Intronic
1136585969 16:31185048-31185070 GGACCGTGGAGGCCGCGGCAGGG + Exonic
1139664725 16:68447819-68447841 CGAGTGTGGAGGAAGGGGCCTGG + Intronic
1139903523 16:70346733-70346755 GAAGCGAGGAGGCCGCGTCCTGG + Intronic
1141531364 16:84648800-84648822 CGAGTGGGGGCGCCGCGGCCGGG + Intronic
1141570300 16:84930001-84930023 AGAGCGTGGGGGCGGCAGCCTGG - Intergenic
1141832334 16:86516795-86516817 GGAGCTCGGAGGCCGCGCCCAGG - Intergenic
1141839714 16:86566992-86567014 CCAGCGGAGACGCCGCGGCCTGG - Intergenic
1142611102 17:1109521-1109543 GGAGCGAGGAGGCCGCGGCCGGG + Intronic
1142662833 17:1443275-1443297 AGAAAGTGGAGGCTGCGGCCGGG - Intronic
1142762425 17:2050235-2050257 CGGGCGCGGCGGCGGCGGCCGGG + Intergenic
1143390523 17:6556694-6556716 GGAGCGCGGCGGCCACGGCCCGG - Intergenic
1144013590 17:11172800-11172822 CGAGCGTGGAGGCGGGCCCCTGG + Intergenic
1147006301 17:37406799-37406821 CGGCCGTGGAGGCCCCCGCCGGG - Intronic
1147720452 17:42536514-42536536 CGGGCGTGGCGGCCGCCGCGGGG + Exonic
1147987609 17:44315389-44315411 CGGGGATGGGGGCCGCGGCCGGG + Intronic
1148848402 17:50542108-50542130 CGGGGGCGGGGGCCGCGGCCCGG - Exonic
1149997490 17:61412567-61412589 CGGGCTGTGAGGCCGCGGCCCGG - Exonic
1150133329 17:62680763-62680785 CGGGCGTGGGAGCGGCGGCCAGG - Intronic
1150258996 17:63773479-63773501 CGATCGCGGAGGCGGCGGCCAGG - Exonic
1151219927 17:72604807-72604829 CGAGGGTGCAGGCCTCGCCCTGG - Intergenic
1151537857 17:74748848-74748870 TGAGCGCGGACGCAGCGGCCGGG + Exonic
1151562514 17:74878205-74878227 GGAGAGTGGAGGCACCGGCCAGG - Exonic
1151696555 17:75721161-75721183 CGAGCCTGGAGCCCGGAGCCTGG + Intergenic
1152356512 17:79810164-79810186 CGATCGCCGGGGCCGCGGCCGGG + Intergenic
1152738918 17:82010727-82010749 CGAGTGGGGAGGCCACGCCCTGG + Intronic
1152824809 17:82458311-82458333 GGCCCGCGGAGGCCGCGGCCGGG - Intronic
1152861427 17:82698639-82698661 TGAGCGCAGAGGCGGCGGCCCGG + Exonic
1152920734 17:83065305-83065327 GGAGCGTGCAGCCCGCAGCCTGG + Intergenic
1154308410 18:13247654-13247676 CGTGCGTGGAGGGTGCTGCCAGG - Intronic
1156411143 18:36829077-36829099 CGAGCCTGCAGGCCGAGGCGTGG + Intronic
1160321533 18:77900372-77900394 CGAGGCTGGAGGGCGCGGCCGGG + Intergenic
1160437911 18:78865940-78865962 CCAGCGTGGAGGCAGAGGCCGGG + Intergenic
1160619466 18:80160577-80160599 CGAGCGTGGCAGCCTCGGCGCGG - Exonic
1160832242 19:1109433-1109455 GGGGCGTTGAGGCCGCGCCCCGG + Intronic
1161779129 19:6279679-6279701 GGAGCGGGGAGGCCGGGACCGGG + Intronic
1161984260 19:7645157-7645179 GCAGGGTGGAGGCGGCGGCCAGG - Intronic
1162914310 19:13865825-13865847 CGCGCGGGGAGGCCACGGGCCGG + Intronic
1163607141 19:18281577-18281599 CGGGCGCTGCGGCCGCGGCCGGG - Exonic
1163693489 19:18750473-18750495 CGGGCGTGGAGGCGGCACCCTGG + Intronic
1164676922 19:30107195-30107217 GCAGCGTGGAGGGCGCAGCCAGG + Intergenic
1165204614 19:34172827-34172849 GGAACGAGGAGGCCGCGGGCCGG - Intronic
1166662668 19:44657469-44657491 CCAGCGTGGAGGCGGCTGCTGGG + Intronic
1167080364 19:47273470-47273492 AGAGCGCGGAGGCCGCGGTCCGG - Intergenic
1168026554 19:53647820-53647842 AGAGGGAGGAGGCCGCGGCGGGG - Intergenic
925893947 2:8457175-8457197 CGGGCGTGGAGGCCGCTCCCGGG + Intergenic
926217455 2:10914142-10914164 GACGAGTGGAGGCCGCGGCCTGG + Exonic
927714017 2:25341367-25341389 CCCGCCTGGAGCCCGCGGCCAGG - Intronic
929501578 2:42494614-42494636 AGAACGTGGGGGCCGGGGCCGGG - Exonic
933875996 2:86622943-86622965 CGAGGGCGGGGGCCGCGGCTCGG + Exonic
934656041 2:96117136-96117158 CGCGCGAGGAGGGCGCGTCCCGG + Intergenic
935301462 2:101697365-101697387 CGAGCGCGGAGGCCGCACCCTGG + Intronic
936038175 2:109129106-109129128 GGAGCGTGCACGCCGCGCCCCGG + Intergenic
936038387 2:109129966-109129988 CGAGCGTGGGGGCCGCACTCTGG - Exonic
936561233 2:113541588-113541610 CGCGGGTGGAGGCTGCGGCCAGG + Intergenic
937042763 2:118834642-118834664 GGGGCGAGGAGGCCGCGGCCTGG - Intergenic
937906938 2:127057033-127057055 CGAGGGCGGGGGCAGCGGCCAGG - Intronic
941905921 2:170716172-170716194 CGGGCGTGGGGGCGGCGGGCTGG + Intronic
941992886 2:171574285-171574307 CGCCCGTGGAGGCCCCGGGCTGG - Intergenic
947188027 2:227472318-227472340 GGAGGGCGGCGGCCGCGGCCAGG + Exonic
948140828 2:235670653-235670675 CGTGCGACGAGGCCGCGGCCGGG + Intronic
948828727 2:240586968-240586990 AGAGCGAGGAGTCCGCGGCGGGG - Exonic
949004649 2:241638076-241638098 CGAACGGGGCGGCCGCGGTCCGG + Intronic
1172118435 20:32584540-32584562 CGCGCGCGGCGGCCGCGGGCGGG - Intronic
1172906833 20:38376797-38376819 GGAGGGTGGAGGCAGAGGCCAGG - Exonic
1175266999 20:57709313-57709335 CGAGCCGGGAGGGCGCGCCCGGG + Intronic
1176005588 20:62860970-62860992 CCCGGGTGGAGGCCGAGGCCGGG - Intronic
1176013397 20:62913152-62913174 AGAGCGTGGAGGCCACGGCCAGG - Intronic
1176062578 20:63178818-63178840 CGAGGGGGGAGCCTGCGGCCGGG + Intergenic
1176547955 21:8209463-8209485 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1176555849 21:8253678-8253700 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1176566886 21:8392498-8392520 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1176574786 21:8436712-8436734 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1176611400 21:8988005-8988027 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1178487559 21:33028343-33028365 CGACCCTGGAGGGCGCGGTCGGG - Exonic
1179209535 21:39313532-39313554 GGAGCGTGTAGGCCGCGCCGAGG + Exonic
1179925667 21:44532940-44532962 CCAGGCTGGAGGCCGAGGCCTGG - Intronic
1180801609 22:18634547-18634569 CGGGCCTGGAGGCGGCGACCAGG - Intergenic
1180852853 22:19030086-19030108 CGGGCCTGGAGGCGGCGACCAGG - Intergenic
1181220113 22:21360714-21360736 CGGGCCTGGAGGCGGCGACCAGG + Intergenic
1181902743 22:26169547-26169569 CGAGGGAGGAGGCCGCGGGCCGG - Intronic
1182254717 22:29030322-29030344 AGAGGCTGGAGTCCGCGGCCGGG - Intronic
1183364859 22:37401527-37401549 GGAGGGAGGAGGCCGCAGCCAGG + Intronic
1183482871 22:38074677-38074699 GGAGCGGGGAGGCCCCGGGCTGG + Intronic
1183665178 22:39242689-39242711 AGGGCTCGGAGGCCGCGGCCCGG - Intronic
1183956308 22:41382337-41382359 GGAGCCTGGAGGACGAGGCCGGG + Intronic
1184108202 22:42380898-42380920 TGAGCCTGGTGGCCTCGGCCAGG - Exonic
1184499856 22:44865136-44865158 CAAGCCTGGTGGCCGAGGCCAGG + Intergenic
1184523472 22:45008739-45008761 CGCGCGTGCAGGACGCGGCCCGG - Intronic
1184564635 22:45284864-45284886 CGCGCGAGGAGGCCGCGGATTGG + Intergenic
1184807189 22:46802823-46802845 CAAGAGTGGAGGCCGTGGGCTGG + Intronic
1185418002 22:50720557-50720579 CGGGCGGGGTGGCCGCGGGCGGG - Intergenic
1203252834 22_KI270733v1_random:125763-125785 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1203260890 22_KI270733v1_random:170849-170871 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
950109603 3:10410558-10410580 CCAGCGTGGATGCGGTGGCCAGG + Intronic
950472987 3:13197929-13197951 GGAGCGTGGTGCCCGCGGCTTGG + Intergenic
950473972 3:13204209-13204231 CGCACGTGGAGGCGGCGGGCGGG - Intergenic
950710557 3:14810592-14810614 CGAGCGCGGGGGCGGCGGCTGGG - Intergenic
954150978 3:48656869-48656891 ACAGCGTGGAGGCCGAGGCCAGG + Exonic
954437380 3:50503335-50503357 CCAGGGTGGGGGCCGCAGCCGGG + Exonic
958814488 3:98901251-98901273 CGGGGGCGGCGGCCGCGGCCCGG + Exonic
961578610 3:127859142-127859164 AGAGAGTGGAGGCCGAGGCTGGG + Intergenic
963733276 3:148992126-148992148 TCAGCGTGGCGGCCGGGGCCGGG - Intronic
963827407 3:149970557-149970579 CGGGCGGGGAGGCCGAGGCCCGG - Intronic
969610973 4:8227670-8227692 AGAGCCTGCAGGCCGAGGCCCGG + Exonic
969715776 4:8867544-8867566 CGGGAGCGCAGGCCGCGGCCGGG - Exonic
972418809 4:38867883-38867905 CGAGCGCGGGGGCGGCTGCCCGG + Intronic
977810124 4:101347711-101347733 CAAGCGGGGAGGCCGCCACCTGG - Intronic
981713607 4:147732228-147732250 CGAGCTCCGAGGCCGCTGCCAGG - Exonic
983940203 4:173529350-173529372 CGAGCGCTGAGGCAGGGGCCCGG - Exonic
985995959 5:3596783-3596805 CGCGAGTGGAACCCGCGGCCAGG - Intronic
989230056 5:39074711-39074733 CGAGCGGGGAGGAGGAGGCCGGG + Intergenic
992431530 5:76715738-76715760 CGACAGTGGACGCCCCGGCCAGG - Intergenic
994083332 5:95731561-95731583 CGCGCGAGGGGGACGCGGCCGGG + Exonic
997654267 5:135543964-135543986 CGTGGCTGGAGGCCGCGGCGCGG - Intergenic
998176399 5:139904548-139904570 CGAGGGTGGAGGGCGCGGGAGGG - Intronic
1002795910 6:470941-470963 CAAGGGTGGAGGGAGCGGCCAGG + Intergenic
1002927835 6:1615010-1615032 CGCGCCTGGAGGCTGCGGGCCGG - Intergenic
1004396253 6:15248522-15248544 CGAGCATGGCGGCGGCGGCCCGG + Intronic
1004690214 6:17987246-17987268 CGAGCCTGGAGACGGCGCCCCGG + Intronic
1006312628 6:33271640-33271662 CGACCATGGCGGCTGCGGCCCGG - Exonic
1008598480 6:53065812-53065834 CGAGGGTGGACGCCGCGGGGCGG + Intronic
1008631118 6:53363631-53363653 CGAGCGTGGTGCCGGCGGGCCGG + Intergenic
1011765037 6:90611123-90611145 CGCGCGCGGAGGAGGCGGCCGGG + Intergenic
1015625939 6:135181197-135181219 CGACCGCGGAGGCGGCGGGCAGG + Intergenic
1017311700 6:152983282-152983304 AGCACGGGGAGGCCGCGGCCCGG + Intronic
1019343001 7:517348-517370 CGCGCGGGGAGGGCGCGGGCGGG - Intronic
1019466477 7:1192308-1192330 CTAGGGAGGAGGACGCGGCCTGG - Intergenic
1021827941 7:24573355-24573377 CGCGCGCGGAGGCAGCGGCGGGG + Exonic
1022942543 7:35254223-35254245 CGGGCGCGGAGGGCGCGCCCAGG + Intergenic
1028871096 7:95772513-95772535 CGGGCGTGGAGGGCGTGGGCAGG + Intronic
1029640229 7:101815811-101815833 AGGGCGCGGCGGCCGCGGCCCGG - Intergenic
1030121113 7:106111974-106111996 AGGGCAGGGAGGCCGCGGCCTGG - Intronic
1033220414 7:139523693-139523715 TGTGCGTGGAGGCTGCGGCTCGG + Intergenic
1034129146 7:148699322-148699344 CGCGCCTGGAGGCGGCGGCCTGG + Intronic
1034470451 7:151251880-151251902 CGAGCGAGCGGGCGGCGGCCGGG + Intronic
1034911621 7:155002813-155002835 CGGGGGAGGAGGCCGCGGCAGGG + Intronic
1034977796 7:155458237-155458259 CGTGCGCGGCGGCCGCGGCCAGG - Exonic
1035165932 7:156989929-156989951 CGAGTGCAGAGGACGCGGCCTGG + Intergenic
1035212343 7:157337373-157337395 CGGGCGGGGAGGACGCGGCCGGG - Intronic
1037948320 8:23003227-23003249 GGAGGGTGGATGCCGAGGCCAGG + Intronic
1039618311 8:38974488-38974510 CGAGCGTGAAGTCTGCGGCGGGG + Exonic
1041489058 8:58411435-58411457 CGCGCTCGGAGGCCGCGGCCCGG - Exonic
1044685664 8:94823433-94823455 TGAGCGCGGAGGCGGCGGACCGG + Exonic
1046962621 8:120126242-120126264 AGAGCCTGGAGGCCGCCGGCAGG + Intronic
1048592850 8:135837562-135837584 AGAGTGTGGAGGAGGCGGCCAGG + Intergenic
1049349112 8:142154618-142154640 ATAGCGGGGAGGCCGTGGCCTGG - Intergenic
1049644067 8:143728306-143728328 GGCGCCTGGAGGCCGAGGCCGGG - Exonic
1049784705 8:144444731-144444753 CGCGCGTGGAGCCCTCTGCCCGG + Intergenic
1049997425 9:1046033-1046055 CGCGCGTGGACGCCCCGGCACGG - Intergenic
1055536235 9:77248355-77248377 CGGGCGTGGTGGCGGGGGCCTGG - Intronic
1056492284 9:87119763-87119785 AGAGCGTGGAGGGGCCGGCCAGG - Intergenic
1056746984 9:89311431-89311453 CGGGGGTGGGGGCCGGGGCCTGG + Intronic
1058467592 9:105244768-105244790 CGCCCGGGGAGGGCGCGGCCTGG - Exonic
1058618776 9:106862440-106862462 CGAGCGCGCACGCCTCGGCCCGG + Intergenic
1060700720 9:125747303-125747325 CGCGCGGGGAGGGGGCGGCCCGG - Intergenic
1060855815 9:126914628-126914650 TGAGCTCGGAGGCCGAGGCCCGG + Intergenic
1061231761 9:129319672-129319694 GGCCCGTGGAGGCCGGGGCCGGG + Intergenic
1061415568 9:130445205-130445227 GGAGCGTGGGGGACGCGGCGGGG + Intronic
1061838647 9:133345141-133345163 CCAGGGTGGAGGGCACGGCCTGG - Intronic
1062022590 9:134326490-134326512 GGCGCGCGGAGGCCGCGGCGCGG - Intronic
1062082219 9:134630134-134630156 GGAGCCTGGAGTCCGCAGCCAGG + Intergenic
1062162400 9:135087630-135087652 TGCGCGCGGGGGCCGCGGCCGGG - Intronic
1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG + Exonic
1203469237 Un_GL000220v1:108914-108936 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1203477058 Un_GL000220v1:152886-152908 CGGGCGCGGGGGCGGCGGCCGGG - Intergenic
1185761235 X:2691180-2691202 CGCGCGTGGAGGCCGGGGCGGGG + Exonic
1187394271 X:18906423-18906445 TGAGAGTGGAGGCCGTGGCCGGG + Intronic
1187464449 X:19515163-19515185 CGGGGGTGGAGGGCGCGGCCGGG - Exonic
1189322584 X:40095858-40095880 GCAGCGTGTAGGCCGTGGCCGGG - Intronic
1195060747 X:101191624-101191646 CGCCCGGGGAGGCCGCTGCCCGG + Intergenic
1195306265 X:103586338-103586360 AGAGTGTGGAGGGCCCGGCCAGG + Intronic
1195308579 X:103608727-103608749 AGAGTGTGGAGGGCCCGGCCAGG + Intronic
1197241421 X:124127045-124127067 CAAGGGTGGAGGCCTTGGCCAGG - Intronic
1198270551 X:135052184-135052206 CGAGGGTGGGGGCCCGGGCCGGG + Intronic
1200310247 X:155071034-155071056 CAAGCGTGTAGGCCGCGCACGGG + Exonic