ID: 1125838551

View in Genome Browser
Species Human (GRCh38)
Location 15:42775882-42775904
Sequence CTTCCAAAGCAGGATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125838551_1125838555 5 Left 1125838551 15:42775882-42775904 CCTGCCACATCCTGCTTTGGAAG 0: 1
1: 0
2: 2
3: 13
4: 203
Right 1125838555 15:42775910-42775932 GCTCAGTTCTTTCCTCAGCAAGG 0: 1
1: 1
2: 3
3: 43
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125838551 Original CRISPR CTTCCAAAGCAGGATGTGGC AGG (reversed) Intronic
901780934 1:11594096-11594118 TTTCCAAAGCTGGATTTGGCTGG - Intergenic
902206958 1:14875596-14875618 CTTCCTACGCAGGATGTGCTGGG + Intronic
904438022 1:30511935-30511957 TTACTAAAGCATGATGTGGCAGG + Intergenic
904687299 1:32269813-32269835 CTTCCAAAGCAGGAGTTGGTAGG + Intronic
908731667 1:67232436-67232458 CTTCCACAGCAGGATGGCTCAGG - Intronic
910749955 1:90618391-90618413 CTTCCAAAGTTGAATGAGGCCGG - Intergenic
912116476 1:106413301-106413323 CTTGCAGAGGAGGATTTGGCAGG - Intergenic
912236046 1:107851680-107851702 TTGCCAAATCAGGATGTTGCTGG + Intronic
912391254 1:109304683-109304705 CTTCCAAAACAGGGAGAGGCTGG - Intronic
914764098 1:150622752-150622774 CTGCAAAAGCAGGAAGGGGCAGG + Exonic
914880345 1:151541546-151541568 CCTCAAGAGCAGGATGAGGCAGG - Intronic
916081341 1:161234756-161234778 CTCCCAAAGGAGGATGTAACTGG - Intronic
917735699 1:177918006-177918028 CTTCCATAGCAAGATGTTGGAGG + Intergenic
918142926 1:181733509-181733531 CTTCCAGCTCAGGATGGGGCAGG - Exonic
919082360 1:192882027-192882049 CTTCCAAATAAGGATGAGGGAGG - Intergenic
919451297 1:197775476-197775498 CTTGCAAATCAGGAAGTCGCCGG + Intronic
920102031 1:203522667-203522689 CTTCCTGAGCAGCATGGGGCTGG + Intergenic
921821887 1:219626383-219626405 CTTCCAAAAGAGGATGTGGTAGG - Intergenic
1062807289 10:432318-432340 CTTTCAAAACAGGAAGTGCCAGG - Intronic
1064145589 10:12823870-12823892 GTTGCCAAGCAGAATGTGGCAGG + Intronic
1067269359 10:44775865-44775887 CTTCCAAAGCTGGAGGTTGGGGG - Intergenic
1067921036 10:50457919-50457941 CTTCCAAAGCAAGTTGGGACTGG - Intronic
1069757432 10:70781866-70781888 CGTCCAAAGCAGTAGGTGCCAGG + Exonic
1072198702 10:93139589-93139611 CTTCCAGAGGTGGAAGTGGCTGG - Intergenic
1072939295 10:99745560-99745582 CTTAGAAAGTAGGATGGGGCTGG + Intronic
1073049731 10:100659904-100659926 CTTCCAAACCAGGGTCGGGCCGG - Intergenic
1074080629 10:110165694-110165716 CTACCCAAGGAGGAGGTGGCAGG - Intergenic
1074992048 10:118717860-118717882 CCTCCATAGCAAGATGTGCCGGG + Intronic
1075488740 10:122848149-122848171 CTTCCCAAGCATGCTGGGGCTGG + Intronic
1076126249 10:127976358-127976380 CTTGCAAAGGAGGATTTGTCTGG + Intronic
1076441938 10:130486090-130486112 ATTCCAAATCAGGGTGTGGGTGG + Intergenic
1077967839 11:7154887-7154909 CTTCCAAAGCAGGCTGCTCCTGG - Intergenic
1081908092 11:46681940-46681962 ATTCCAAGGCAGGGGGTGGCGGG - Intronic
1083113795 11:60438263-60438285 CATTCAAAGCAGGATGTAGAGGG + Intronic
1083298124 11:61726154-61726176 TTGGCAAAGCAGGATGGGGCAGG + Intronic
1083680296 11:64348646-64348668 TTTCCAAGGCAGGATTTGGCTGG + Intronic
1083967817 11:66053380-66053402 CTCCAAAAGCAGCTTGTGGCCGG + Intronic
1084323750 11:68387530-68387552 GTCACACAGCAGGATGTGGCAGG + Intronic
1084612341 11:70211693-70211715 CTTCCAAATCAGTTTCTGGCTGG + Intergenic
1084887009 11:72217317-72217339 TTTCTAAAGAAAGATGTGGCCGG - Intronic
1085511527 11:77090707-77090729 TTTCCATGGCATGATGTGGCTGG + Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1087894510 11:103572678-103572700 TCGCCAAAGCAGCATGTGGCAGG + Intergenic
1088155454 11:106797757-106797779 CATTCAAAGCAGTATGTGGAGGG + Intronic
1088807897 11:113368510-113368532 CATCCTAAAGAGGATGTGGCCGG + Intronic
1090409844 11:126500441-126500463 GTTGAAAAACAGGATGTGGCTGG + Intronic
1090973468 11:131662479-131662501 CTTTCAAAGCAGGGTGGGGGTGG - Intronic
1098071425 12:66679678-66679700 CTTCCAAAAAAGGACTTGGCTGG + Intronic
1098860619 12:75705990-75706012 ATTCCAAAGCACCATGTAGCTGG + Intergenic
1100124472 12:91407034-91407056 CATCCAAAGCAGAATGTGGCTGG + Intergenic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1104120808 12:125797976-125797998 CAGCCAGAGCAGGATGGGGCTGG - Intergenic
1104940107 12:132391091-132391113 CTTCCAAAGCTGTGTGTGACAGG + Intergenic
1108066504 13:46582795-46582817 CATCAAAAGCAATATGTGGCTGG - Intronic
1111667881 13:91292861-91292883 CTTACAAAACAGGTGGTGGCTGG + Intergenic
1112118307 13:96382028-96382050 CTCCCAAAGGAGGATGTGATTGG + Intronic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1117770692 14:59131247-59131269 CATCAAAAGCAGTAGGTGGCAGG - Intergenic
1117796714 14:59402212-59402234 CTTTCATAGCAGGATGATGCTGG + Intergenic
1118372551 14:65149873-65149895 CATACAAAGCAGGTGGTGGCTGG - Intergenic
1119893194 14:78198346-78198368 ATTGCAAGCCAGGATGTGGCTGG - Intergenic
1121080051 14:91100579-91100601 CTTGCAAAGCTGGATGAGGCTGG + Intronic
1123161604 14:106283692-106283714 CTTCAAAAGCATGGTGTGGTAGG + Intergenic
1123684594 15:22787629-22787651 TTGCCAATGCAGGATATGGCAGG + Intronic
1124021860 15:25932827-25932849 CCTCCACTGCAGGATGTGGTTGG + Intergenic
1124048525 15:26173940-26173962 CTTCCATAGCCAGATGTGGCTGG + Intergenic
1125838551 15:42775882-42775904 CTTCCAAAGCAGGATGTGGCAGG - Intronic
1126009530 15:44289139-44289161 CTCCTGAAGCAGGACGTGGCGGG - Exonic
1126016516 15:44356579-44356601 CTTCCAAAGCAGGAAGCACCAGG + Intronic
1127182107 15:56432211-56432233 TTTCCTAAGAAGGATCTGGCAGG + Intronic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1131023360 15:89118932-89118954 CTTCCATAGGAGGAGGTGGGTGG - Intronic
1131508820 15:93037718-93037740 CAGCCAAAGCAGAATGTGTCTGG - Intronic
1131568327 15:93506461-93506483 CATCCCAGGCAGGAAGTGGCAGG - Intergenic
1132985427 16:2764389-2764411 CTTCCAAAGAAGCCTGTGACTGG - Exonic
1134358536 16:13507507-13507529 CTCCCAAAACAAGATGAGGCTGG - Intergenic
1135668544 16:24355798-24355820 CTTCAAAAGCTGGATGGGGCTGG - Intronic
1137072010 16:35911981-35912003 CTTTCACAGCAGCATGTGCCAGG + Intergenic
1139847561 16:69931741-69931763 CTTCCACAGCAGGCAGGGGCGGG - Intronic
1140262089 16:73389212-73389234 TTTACAAAGCAGGCAGTGGCTGG - Intergenic
1143892991 17:10116549-10116571 CTTCCCTGGCAGGATGCGGCTGG - Intronic
1144623978 17:16835088-16835110 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1144882447 17:18437628-18437650 CTCCCAGAGGGGGATGTGGCAGG - Intergenic
1145149787 17:20506758-20506780 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1147378062 17:40034829-40034851 CTACCAAAGGAGCATGTGGCAGG - Intronic
1148829264 17:50419815-50419837 TTGCCAGAGCAGCATGTGGCAGG - Intergenic
1150804336 17:68307390-68307412 CTTTCAAAGCAGGAAGTCTCTGG - Exonic
1153951874 18:10064590-10064612 CTGCCAGTGCAGGATGGGGCGGG - Intergenic
1156185849 18:34662376-34662398 CTTCCCAAACATGATATGGCAGG + Intronic
1157303656 18:46500033-46500055 CTTCCAAAGTGGGATGTGCTTGG - Intronic
1158380016 18:56919318-56919340 CTTCCCAGGCAGGAAGTGGGAGG - Intronic
1158675771 18:59516740-59516762 CTTGGAAGGCAGAATGTGGCAGG + Intronic
1158707690 18:59808077-59808099 CTTCCAAAGCAGGGAGCTGCTGG + Intergenic
1160592963 18:79954136-79954158 CTTACAAAGATGCATGTGGCCGG - Intergenic
1161000168 19:1906737-1906759 CTCCCAAAGGAGGCTGAGGCAGG + Intronic
1164160243 19:22621458-22621480 CTGCCACAGCTGGATGGGGCTGG + Intergenic
1164667107 19:30047889-30047911 CTTCCGGAGCAGGATGGAGCTGG - Intergenic
1165152431 19:33768910-33768932 CTTTCAAAGGAGGAAGTTGCAGG + Intronic
1165359890 19:35329720-35329742 GTCCCAGAGCAGGTTGTGGCTGG + Intronic
1167068656 19:47206243-47206265 CTTCCCAAGCAAGATGGGGTAGG - Intronic
925106885 2:1299395-1299417 CACCCAAAGCAGGAAGAGGCAGG - Intronic
927102828 2:19800998-19801020 CTTCCCAAGTAGGCTGTGGGAGG - Intergenic
927890626 2:26745880-26745902 CTTCCAAAGTGAGATGAGGCTGG - Intergenic
932317537 2:70795933-70795955 CTTCCAAGGCAGGATTCGGGAGG - Intergenic
935050392 2:99520393-99520415 CATTCAAAGCAGGGTGTGGTCGG + Intergenic
935159235 2:100514844-100514866 CTTCTGAAGCAGGATGTGCAGGG - Intergenic
935180497 2:100685616-100685638 CTTGGAAAGGGGGATGTGGCAGG - Intergenic
935219760 2:101002351-101002373 ATCCCAAAGGAGGATGGGGCTGG - Intronic
936404688 2:112192363-112192385 CTTCCAAAGGAGGGTTTGGTGGG - Intergenic
937079955 2:119133744-119133766 CATGCACAGCAGGAAGTGGCAGG - Intergenic
937600800 2:123729395-123729417 CTCCCAAAGCATGATGTGCTAGG - Intergenic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938757456 2:134393858-134393880 CTTCCAAAGCAGCAGGTGGTGGG - Intronic
940401626 2:153254620-153254642 CATCCAAAGCAGTGTGTGGAGGG - Intergenic
941573171 2:167196802-167196824 CCTCCAAAGAAAAATGTGGCTGG + Intronic
943745311 2:191456126-191456148 CTTGCAGAGGAGGATTTGGCAGG + Intergenic
947432735 2:230044983-230045005 TTTCCAAAACACCATGTGGCAGG - Intronic
948427800 2:237898876-237898898 TTTCCAAAGCAGGGAGGGGCTGG - Intronic
1168996788 20:2139174-2139196 CATGCACAGCAGGATGGGGCTGG - Intronic
1169484894 20:6020926-6020948 CTTAAAAAGCAGGATTAGGCCGG - Intronic
1169675443 20:8147982-8148004 CTTCTAAAGGAGGCTGAGGCAGG - Intronic
1169718672 20:8648169-8648191 ATACCAAAGCAGGAAGTGGGTGG + Intronic
1173472095 20:43332156-43332178 CTTCCCAAGAAGGATCTGGTGGG + Intergenic
1174060099 20:47826533-47826555 CACCCCAAGCAGGAGGTGGCAGG + Intergenic
1175596649 20:60239892-60239914 CTAACAATGAAGGATGTGGCAGG + Intergenic
1176006896 20:62870256-62870278 CTGCCACATGAGGATGTGGCAGG - Intergenic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1178665551 21:34543311-34543333 CTTTATAAGCAGGATATGGCAGG + Intronic
1180151203 21:45948980-45949002 CTTCCAAAGCAGGATGGACGGGG - Intergenic
1180728833 22:17966129-17966151 GTTGTCAAGCAGGATGTGGCAGG - Intronic
1182018058 22:27057529-27057551 TTTACAAAACAGGAGGTGGCTGG + Intergenic
1182309298 22:29393350-29393372 CTCCCACAGCATGATCTGGCAGG + Intronic
1183006131 22:34904039-34904061 CTGTCAACTCAGGATGTGGCAGG - Intergenic
1183130093 22:35825868-35825890 CTACCAAAGGAGGTTGAGGCAGG + Intronic
1184016292 22:41788313-41788335 CTTCCAATACAGGTTGAGGCTGG - Intronic
1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG + Intronic
1184821943 22:46915955-46915977 CTTGGAAAGAAGGATGTGGTGGG + Intronic
952968264 3:38634323-38634345 CCACCAAAACAGGATGTGGTCGG + Intronic
953105571 3:39875492-39875514 CATTCAAAGCAGGATGTAGAGGG - Intronic
953912634 3:46900606-46900628 CTTTCAAACCAGGTTGTGGGGGG + Intronic
954581591 3:51706188-51706210 CTCCCACAGCAGGATGGGGAAGG - Intergenic
955943976 3:64173564-64173586 CTTGCAAGGCAGTATGAGGCCGG + Intronic
956004328 3:64762415-64762437 CTTTCAATGCATGATGTAGCAGG + Intergenic
958813661 3:98892364-98892386 CTTCCAGAGAAGGATAAGGCAGG - Intronic
959994143 3:112662301-112662323 CATCCAAAGCAGTGTGTAGCAGG - Intergenic
963787897 3:149553717-149553739 TTTTCAAAGCTTGATGTGGCTGG - Intronic
963929544 3:150989311-150989333 CTTCCAAAGGAGTAAATGGCTGG - Intergenic
964385586 3:156144513-156144535 CTTCTAAAGCAGGATGTGGTAGG - Intronic
966668738 3:182502903-182502925 CTTCCAATGCAGTATGTTTCTGG + Intergenic
967216811 3:187218177-187218199 TTTCCAAAGCAGCACTTGGCAGG + Intronic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
967919414 3:194603325-194603347 CTAACACAGCAGGATGTAGCTGG + Intronic
969498478 4:7539697-7539719 CCTCCACAGCAGGAAGGGGCGGG - Intronic
970230881 4:13909674-13909696 CTCCCAAAACAAAATGTGGCAGG - Intergenic
970806756 4:20045605-20045627 CTTCCAAAATAGGTTTTGGCTGG + Intergenic
971258298 4:25032894-25032916 CTTGCACAGCAGTAAGTGGCAGG - Intergenic
976192490 4:82501464-82501486 TTGCCAAAGCAGGAGGTGTCCGG - Intronic
980848090 4:138348292-138348314 ATTCAAGGGCAGGATGTGGCTGG + Intergenic
982007119 4:151074314-151074336 CTTCCATAGCAGGAAGAGGAGGG + Intergenic
983323769 4:166227475-166227497 GTTCCCAGGCAGGAAGTGGCGGG + Intergenic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
983951104 4:173642593-173642615 CTGCAAAAGCAGCATGTGGTAGG - Intergenic
984811697 4:183800980-183801002 CTTTCACAGCAGGATTTGCCAGG + Intergenic
984888118 4:184468937-184468959 CTTCCAAAGGAGGAAGTGATTGG + Intronic
986720908 5:10561054-10561076 CTTCCAAACCAAGGTGGGGCAGG + Intergenic
989822431 5:45810002-45810024 CTTCCAAAGCAGGAAGTAGTAGG + Intergenic
991338884 5:65582881-65582903 CTTCCCATACAGGATGTGTCAGG - Intronic
996986036 5:129565790-129565812 CTTCCAAATCTGGATGTGAAGGG + Intronic
997525062 5:134547726-134547748 CAACCAAAGAAGGAGGTGGCTGG + Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
999220179 5:149969624-149969646 CTTCCAAGGCAGGAAAGGGCAGG - Intronic
999262978 5:150249022-150249044 CTTCCACTGCAGGATGGGGATGG + Intronic
1000032083 5:157410942-157410964 CTTTCAAAGAAGCATGTGACTGG + Intronic
1001122356 5:168991315-168991337 CCTCCAAAGGAGGAAGTGGTAGG + Intronic
1004854055 6:19731434-19731456 CGTCCCAAGCAGGATGGAGCAGG - Intergenic
1005222622 6:23605105-23605127 CTTCCAAAGCAGAAAGTTCCAGG + Intergenic
1005291187 6:24380519-24380541 CTACCAGAGAAGGATGTGGCAGG + Intergenic
1006439979 6:34047897-34047919 CTTCAAAAGGAGCCTGTGGCTGG - Intronic
1009478367 6:64124008-64124030 CATCCAAACCAGGATTTTGCTGG + Intronic
1011513843 6:88130401-88130423 CTGCCAAAGCTGCATATGGCTGG - Intergenic
1013665765 6:112346705-112346727 CTTCCAAAAAAGGATTTGGAGGG - Intergenic
1016314571 6:142771737-142771759 CTTCCTAAGCAGGATGAGTTTGG - Exonic
1018376990 6:163222321-163222343 CATCCAAAGAAGGATGTGTGAGG + Intronic
1018763210 6:166908468-166908490 CTTCCCACGCTGGCTGTGGCAGG - Intronic
1023884667 7:44345201-44345223 CATCCAAAGCAGCATGAGGCAGG + Intergenic
1024115944 7:46193182-46193204 CTGCTAAAGGAGGATGTAGCAGG - Intergenic
1024226930 7:47332496-47332518 CTTCTGAAGCAGCCTGTGGCTGG - Intronic
1026165505 7:67905713-67905735 CTTCCAAAGCCCAAAGTGGCTGG - Intergenic
1027189072 7:75987576-75987598 CTTCCAGTCCTGGATGTGGCGGG - Exonic
1030641440 7:112010963-112010985 TTTCCAAAGAAGGATCTGGGAGG - Intronic
1030855494 7:114550410-114550432 CTTCAAAAGAAAGATGAGGCCGG - Intronic
1031360411 7:120843288-120843310 TCTCCAGAGCAGGATGTGTCTGG - Intronic
1031957532 7:127957614-127957636 CTTCCAGAGCAGGATTTCTCAGG + Intronic
1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG + Intergenic
1034090013 7:148354912-148354934 CCTCCAAATCAGTGTGTGGCTGG - Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1035225359 7:157429592-157429614 CTTCCCAGGATGGATGTGGCTGG + Intergenic
1044852960 8:96446869-96446891 CTTCCAAACCACCATATGGCCGG - Intergenic
1046648317 8:116809743-116809765 CTTCCAAACCAGGAGGCAGCTGG - Intronic
1046779748 8:118202481-118202503 CTTCAAAGGCAGGAAGTGACTGG + Intronic
1047299418 8:123600114-123600136 CTTCCAGAGCAGGAGGGGCCTGG - Intergenic
1048320911 8:133399668-133399690 CTTCCAGAGCAGGAGCTGACAGG + Intergenic
1049395106 8:142396460-142396482 GTTCCAGAGCAGAGTGTGGCAGG - Intronic
1051367308 9:16330090-16330112 CTTCCCACGCAGGGTGGGGCAGG + Intergenic
1055009089 9:71543981-71544003 CTTCAAAAGCACAATGCGGCCGG + Intergenic
1055260912 9:74432603-74432625 CATTCAAAGCAGGACTTGGCAGG + Intergenic
1055779549 9:79804915-79804937 CTTCACAAGCAGGAAGAGGCAGG - Intergenic
1059122164 9:111650790-111650812 CTTCTTAAGCAGGTTTTGGCTGG - Intronic
1059535159 9:115073799-115073821 CTTCCAGAGCAGGGTCAGGCTGG + Exonic
1061053320 9:128208674-128208696 CTCCCCAAGCAGGATGGGTCTGG - Intronic
1061500257 9:130997821-130997843 CATTCAAGGCAGGATGTGACCGG - Intergenic
1185834515 X:3332538-3332560 CTTAAAAAGAAGAATGTGGCCGG - Intronic
1185942651 X:4338846-4338868 CTTCCACAGATGAATGTGGCTGG - Intergenic
1186986333 X:15018275-15018297 TATCCAAAGCAGGAAGTGGAGGG + Intergenic
1187096626 X:16155617-16155639 CTGCCAAAGCAGAGTGTGGCAGG + Intergenic
1192804974 X:74500547-74500569 CTTCCAGAGAAGAGTGTGGCGGG - Intronic
1197640849 X:128966519-128966541 CTTCCAAAGCAGACTCTGGTTGG - Intergenic
1198302343 X:135344647-135344669 CTTCCAAAACAGCTTGAGGCTGG + Intergenic