ID: 1125841030

View in Genome Browser
Species Human (GRCh38)
Location 15:42801347-42801369
Sequence CAGCTCAGACAGCTTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 3, 2: 15, 3: 35, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125841022_1125841030 16 Left 1125841022 15:42801308-42801330 CCGCGCCATGTCTTGACTGGCTA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG 0: 1
1: 3
2: 15
3: 35
4: 182
1125841023_1125841030 11 Left 1125841023 15:42801313-42801335 CCATGTCTTGACTGGCTAGCTGC 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG 0: 1
1: 3
2: 15
3: 35
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125841030 Original CRISPR CAGCTCAGACAGCTTGGCAT TGG Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
908788559 1:67758479-67758501 CTCTTCACACAGCTTGGCATTGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
910626195 1:89310605-89310627 GAGCTCAGACACCTTCGCTTTGG + Intergenic
911453716 1:98097141-98097163 CAGAACAGAAAGCTTGGCTTTGG - Intergenic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
913292096 1:117283403-117283425 GGGCTCTGACAGGTTGGCATAGG + Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915937237 1:160096692-160096714 CAGGCCACACAGCTGGGCATGGG - Intronic
918005027 1:180533947-180533969 CAGAACAGACACCTTGGCTTGGG + Intergenic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
1062853053 10:760045-760067 CTGGTCAGCCAGCATGGCATGGG - Intergenic
1062965098 10:1601082-1601104 AAGTTCAGACAGGTTTGCATTGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064052944 10:12073752-12073774 CAGGCCCCACAGCTTGGCATGGG + Intronic
1064707656 10:18089920-18089942 TAGCCCAGGCAGCCTGGCATGGG + Intergenic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1070218916 10:74419560-74419582 CAAAGCAGACAGCTTGGCATTGG - Intronic
1071033409 10:81212867-81212889 CAGCTCAGGCAGGACGGCATAGG - Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1075455150 10:122580223-122580245 CAGCACAGACAGCAAGGCAGGGG + Intronic
1075461860 10:122621708-122621730 CAGCACAGACAGCGGGGCAGAGG + Intronic
1075650403 10:124124411-124124433 CAGGTCACACAGCTAGGCAGGGG + Intergenic
1077161701 11:1116253-1116275 CCTCTAAGACAGCGTGGCATTGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077775703 11:5269493-5269515 CAGCTCACTCAGCTTAGCAAAGG + Exonic
1081776738 11:45680981-45681003 GAGGTCAGACAGTTTGGCCTTGG - Intergenic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1085315167 11:75540398-75540420 CAGCTCAGGCAGCTCAGCAAAGG - Intergenic
1088328365 11:108625351-108625373 GAGCTCAGAAAGCCTGGAATTGG + Intergenic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089535138 11:119156421-119156443 CATCTCAAAGAGCTTGGCACTGG - Exonic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1089696757 11:120220687-120220709 CAGCTGAGACAGCTGAGCACAGG + Intronic
1090131027 11:124142184-124142206 CAGCTCACACAGCTTGCCTGCGG + Intronic
1090823832 11:130369358-130369380 CAGCTCAGACAGCAAGGGACAGG - Intergenic
1093237155 12:16624842-16624864 CATCTCAGACCAATTGGCATGGG - Intergenic
1096485027 12:51974249-51974271 TAGCTCTGACCTCTTGGCATGGG - Intronic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1096587192 12:52630399-52630421 CACCTCAGCCAGCTTGTCCTGGG + Intergenic
1096609452 12:52791340-52791362 CAGCTCTTGGAGCTTGGCATTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097303524 12:58043597-58043619 GAGCCCAGAGAGTTTGGCATAGG - Intergenic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1098639228 12:72819586-72819608 CTGATCAGGCAGCTTAGCATAGG + Intergenic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1102243995 12:111343429-111343451 CTGCTCAGGAAGCTTGGCAGGGG - Intronic
1102945418 12:116983212-116983234 AAGAGCAGACATCTTGGCATGGG + Intronic
1103012919 12:117471204-117471226 AACCTCAGCCAGATTGGCATGGG - Exonic
1103341918 12:120225274-120225296 CGGCTCAGACAGCCTGGCCCTGG + Intronic
1104034823 12:125091084-125091106 CAGATCAGACAGCTGTGCAAAGG + Intronic
1104993568 12:132640507-132640529 CAGGCCAGACAGCTAGGCATTGG + Intronic
1106504164 13:30356631-30356653 TAGCTCAGTCAGCTGGGCATGGG + Intergenic
1106759134 13:32850571-32850593 CAACTGAGACAACTTCGCATGGG - Intergenic
1110188627 13:72704086-72704108 CAGCTCAGACTCCTTCCCATTGG - Intergenic
1111300404 13:86342125-86342147 CAGCTCAGCCACATTGGAATAGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1117332214 14:54724324-54724346 AAGCTCAGACAGCTGAGCAGTGG - Intronic
1118709031 14:68504595-68504617 AAGCTCAGACAGCTAGAGATGGG + Intronic
1120412747 14:84177827-84177849 CAGCTCAAACAGTTATGCATAGG - Intergenic
1120549027 14:85846531-85846553 CAGGTGAGAGAGCTTGGTATGGG - Intergenic
1121288095 14:92752190-92752212 CAGCTCACACAGCTTGTAAGTGG - Intergenic
1122137545 14:99643658-99643680 CTGCACAGACAGCTGGGAATAGG - Intergenic
1125174401 15:36804394-36804416 ATGATCAGACAGCTTTGCATTGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126106168 15:45148304-45148326 CACCTCAGCCAGCTGGGCCTTGG - Exonic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127427450 15:58870082-58870104 CAGCTCAGACTCCTTCCCATTGG - Intronic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128526910 15:68418774-68418796 GAGCTCAGACAGTTTGGTTTTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1129861203 15:78863280-78863302 CAGCTCAGGCTCCTTCGCATTGG + Intronic
1130993813 15:88892962-88892984 CAGCCCAGTCACCTTGGCAGTGG + Intronic
1131526734 15:93158736-93158758 AAGCACAGACAGCTGGGCAGTGG - Intergenic
1132026056 15:98405369-98405391 GAGCTCAGACAGGCTGGCCTTGG - Intergenic
1133823267 16:9255854-9255876 CAGCTCTGCCACCTTGGAATTGG + Intergenic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1135239780 16:20793971-20793993 CAGCTCCGGGGGCTTGGCATAGG + Intronic
1138503604 16:57464526-57464548 CAGCTCAGAGAGTTTGGATTAGG + Intronic
1139534631 16:67563446-67563468 CAGCTCAGCCAGCCTTGCAGAGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1142601544 17:1055430-1055452 AAGGTCACACAGCTTGTCATGGG + Intronic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1143264514 17:5626045-5626067 CAGGTGAAACAGCTTGGCAAAGG - Intergenic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1144849833 17:18238466-18238488 CTGCTCAGCCAGCTGTGCATTGG - Exonic
1146186524 17:30727921-30727943 CTGCCCACACAACTTGGCATCGG + Intergenic
1148669562 17:49400462-49400484 CAGCTCAGACGCCTTACCATTGG + Intronic
1150379240 17:64707728-64707750 AAGCTCAGGCAGCCTGGCAGAGG + Intergenic
1150516378 17:65814291-65814313 CAGAGCAGACAGCTTGGTTTTGG - Intronic
1152154234 17:78622533-78622555 CGGCCCTGACAGCTGGGCATGGG - Intergenic
1153280028 18:3406375-3406397 CAGCTCAGGCTGCTTCCCATTGG + Intergenic
1153379159 18:4416771-4416793 CATCACAGACAGAATGGCATGGG + Intronic
1154941649 18:21119215-21119237 CAGCTCAGGCTGCTTCCCATTGG + Intergenic
1156453342 18:37279088-37279110 CAGCTTAGGCAGCTGGGCAGTGG - Intronic
1156498875 18:37544341-37544363 CAACTCACACAGCTTGTCAGCGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157478903 18:48040289-48040311 CTGCTCAGGCAGCTGGGCAAAGG + Exonic
1157580939 18:48773794-48773816 CAGCTCAGGCAGGTTGGTATGGG - Intronic
1159331645 18:67002386-67002408 GAGCTCAGTTATCTTGGCATAGG + Intergenic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1159946728 18:74449522-74449544 GCAGTCAGACAGCTTGGCATTGG - Intronic
1160359837 18:78265005-78265027 CAGGTAAGGCAGCTTGGTATTGG - Intergenic
1160390001 18:78522745-78522767 CAACTCAGAAAGCTCTGCATTGG - Intergenic
1161100943 19:2421683-2421705 CAGGTCACACAGCCAGGCATGGG + Intronic
1161125758 19:2556347-2556369 CAGCTCAGGAAGCTGGGCCTGGG - Intronic
1161777248 19:6270304-6270326 GAGCACAGCCAGGTTGGCATGGG - Intronic
1163463385 19:17452682-17452704 CAGCTCAGACAGGTGGGGAGTGG + Intronic
1165069576 19:33247793-33247815 CATCACAGCCTGCTTGGCATAGG - Intergenic
926332021 2:11833393-11833415 AAGCACAGAGAGCTTGGTATGGG - Intergenic
927007028 2:18861531-18861553 CAGCCTAGAGGGCTTGGCATGGG - Intergenic
929600356 2:43200651-43200673 CAGCACAGAAAGCTGGGCAAGGG - Intergenic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
935186646 2:100740214-100740236 CAGGTCAGGAATCTTGGCATGGG - Intergenic
936057527 2:109272109-109272131 CAGCTCCGACAGCTGGCCAGAGG - Intronic
936892951 2:117393348-117393370 CACCTCTGAAAGCTAGGCATGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943521574 2:188957763-188957785 CACCTCAGAAAGCTTTGAATAGG + Intergenic
943858464 2:192828662-192828684 CAGCTCAGAGAGATCGGCAGCGG - Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
944909899 2:204300288-204300310 AAGCTCACACAGCTTGCCAGTGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
946577261 2:221089118-221089140 CAGCGCAGACAGCTATGCATTGG + Intergenic
949069448 2:242015265-242015287 CAGCTCAGTCATCTTAGCATGGG + Intergenic
1170207780 20:13817924-13817946 AAGCTCAGACAGCTTAGGATAGG + Exonic
1171201600 20:23246445-23246467 CAGCTCCATCAGCTTTGCATGGG + Intergenic
1173006491 20:39143263-39143285 AAGCACACACAGCTTGGCACTGG + Intergenic
1173226990 20:41167933-41167955 CAGCTCAGGCCTCTGGGCATAGG + Intronic
1174707894 20:52675675-52675697 CAAATCAGACAGCTTCTCATTGG - Intergenic
1174819564 20:53714718-53714740 CAGGTCACACAGCTAGGCAACGG - Intergenic
1175612504 20:60363554-60363576 CAGGTCACACAGCTTGTCAGTGG + Intergenic
1178693001 21:34765317-34765339 CAGCTTTGACAGCATGTCATGGG + Intergenic
1179669393 21:42935510-42935532 CTGGTCAGGCAGCTTAGCATGGG - Intergenic
1181671048 22:24425526-24425548 CAGCTCAGCCAGCTCAGCACTGG - Intronic
1184302413 22:43569455-43569477 AAGCCCAGGCACCTTGGCATGGG - Intronic
1184776376 22:46625575-46625597 CAGCTCAGAAAGCTGGTCAGTGG + Intronic
1184839468 22:47044037-47044059 CAGCCCAGGCAGCTGGGCACTGG + Intronic
1185022441 22:48386385-48386407 CAACCAAGACAGCATGGCATTGG + Intergenic
1185288816 22:50014117-50014139 CAGCTCAGCCAGCCTGGGATAGG - Intergenic
950005578 3:9689067-9689089 CAACTCAGGCAGCTTGGTAAGGG + Exonic
950262607 3:11553695-11553717 GAGCTCAGATAGTTTGGCCTCGG + Intronic
950524600 3:13516581-13516603 CTGCTCTGGCGGCTTGGCATAGG + Intergenic
950704044 3:14769219-14769241 GAGCTCAGAGGGCTTGGCAGAGG + Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
951941289 3:28081643-28081665 CAGCCCAGACAGCTGCACATGGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953856841 3:46505763-46505785 CAGCTCACACAGCTGTGCAGAGG - Intergenic
953863588 3:46565212-46565234 CCGCCCAGGCAGCTTGGCCTTGG - Intronic
955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG + Exonic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
966529743 3:180962925-180962947 CAGCTGCGACAGATTGGTATGGG + Exonic
967545450 3:190721410-190721432 CAGCTAAGAAAGCTTGGCTAAGG + Intergenic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
968876038 4:3268518-3268540 CAACTCCTACAGCATGGCATTGG + Intronic
971452060 4:26809663-26809685 CAGCTGAGACCGCTGGGCAATGG + Intergenic
972275253 4:37551166-37551188 CTGATCAGGCAGCTTAGCATAGG - Intronic
972278496 4:37581583-37581605 CAGCTCAGCCACATTAGCATAGG - Intronic
972800846 4:42474324-42474346 CAGCTCAAACAGGGTGCCATGGG - Intronic
973291025 4:48470784-48470806 CAGCCCAGACAGTTTCACATTGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978853271 4:113363859-113363881 CAGCTCAGAGCACTTTGCATGGG - Intronic
979439463 4:120734150-120734172 CAGCACAGCCAGCCTGGCACAGG + Intronic
980232260 4:130060252-130060274 CAACTCAGACAGCAGGACATGGG - Intergenic
983217121 4:165012399-165012421 CAGCTCAGACTCCTTCCCATTGG + Intergenic
985695266 5:1336573-1336595 CAGCTCACACAGCTCTGTATGGG + Intronic
988066656 5:26233609-26233631 CACCTCAGTCGTCTTGGCATGGG - Intergenic
990714970 5:58626523-58626545 GAACTCAGACAGCCTGGCTTTGG - Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
993438464 5:87925897-87925919 GAGCCCAGAGAGTTTGGCATGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
996662870 5:126025580-126025602 TAGCTCAGAGTGCTTGGCATTGG - Intergenic
998183556 5:139962001-139962023 CAGCACAGAGAGCTGGTCATTGG + Intronic
998424002 5:142012141-142012163 TGGCTCAGACAGCTTGGGAAGGG - Exonic
998530970 5:142884200-142884222 CAGCTGAGACAGATTGTCACAGG - Intronic
998770884 5:145543849-145543871 CAGTTCATAAAGCTTGTCATTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1001567001 5:172706378-172706400 GAACTCAGTCAGCTTGGCAGTGG + Intergenic
1002154384 5:177265186-177265208 CAGCTCAGACTCCTTCCCATTGG - Intronic
1003053931 6:2802640-2802662 CAGCTCAGAGAGCCTGACAAAGG + Intergenic
1004667825 6:17764692-17764714 CATGTCAGACAGGGTGGCATTGG + Exonic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1007078633 6:39083600-39083622 CAGGTCACACAGCTCGGCAGTGG - Intronic
1007249215 6:40484291-40484313 CTGATCACACAGCTTGGCAGAGG - Intronic
1008511781 6:52282762-52282784 CTCCTCATACTGCTTGGCATAGG + Exonic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1027447986 7:78296847-78296869 CAGCTCAGTCAGCGTGGGAAAGG + Intronic
1028666970 7:93356694-93356716 CAACTCAGTGAGCTTGGTATGGG + Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1031932748 7:127702969-127702991 CATCTCAGACTTCTTGGCAAAGG - Intronic
1041013325 8:53566411-53566433 CAGCTCAGACAGTTAGGGTTAGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1047739879 8:127797910-127797932 CAGGTCACACAGCTTGGGAGAGG + Intergenic
1048982381 8:139709723-139709745 GAGCTCAGCCAGCCTGGCCTCGG - Intergenic
1051342470 9:16124380-16124402 CAACTCAAACAGCTTGTCAGAGG - Intergenic
1052144989 9:25037515-25037537 CAGCCCAGACAAGATGGCATAGG - Intergenic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1053361524 9:37490454-37490476 CAGCTCAGGCTGCTTCCCATTGG + Intronic
1054766705 9:69048162-69048184 AGGCTGAGACAGCTGGGCATGGG - Intronic
1057061372 9:92006489-92006511 CAGCTCAGGCTGCTTCCCATTGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1059325982 9:113504247-113504269 CAGCTCAGCAAGCTTGGAAAAGG - Intronic
1059418679 9:114177727-114177749 CAGCACACAGAGCATGGCATGGG - Intronic
1060864580 9:126985310-126985332 CAGCTCTGCCAGGTTGGCTTTGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1193986552 X:88248848-88248870 CAGCATAGACACCTGGGCATGGG + Intergenic
1194356885 X:92896336-92896358 CAGCCCAGAGGGTTTGGCATGGG - Intergenic
1197649884 X:129052905-129052927 CAGTTAAGACAGCTTGGAAAAGG + Intergenic
1198579584 X:138048946-138048968 GAGCTCAGAGGGTTTGGCATGGG + Intergenic
1200665218 Y:6013330-6013352 CAGCCCAGAGGGTTTGGCATGGG - Intergenic
1200930378 Y:8691584-8691606 CAGCTCTGACAGTTGGGCACTGG - Intergenic