ID: 1125843931

View in Genome Browser
Species Human (GRCh38)
Location 15:42833580-42833602
Sequence TAAAAATTGTCGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2860
Summary {0: 1, 1: 7, 2: 61, 3: 460, 4: 2331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125843928_1125843931 1 Left 1125843928 15:42833556-42833578 CCATATAATTTCATCTATATACA 0: 1
1: 0
2: 10
3: 76
4: 614
Right 1125843931 15:42833580-42833602 TAAAAATTGTCGGCCAGGTGTGG 0: 1
1: 7
2: 61
3: 460
4: 2331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125843931 Original CRISPR TAAAAATTGTCGGCCAGGTG TGG Intronic
Too many off-targets to display for this crispr