ID: 1125843931 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:42833580-42833602 |
| Sequence | TAAAAATTGTCGGCCAGGTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2860 | |||
| Summary | {0: 1, 1: 7, 2: 61, 3: 460, 4: 2331} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1125843928_1125843931 | 1 | Left | 1125843928 | 15:42833556-42833578 | CCATATAATTTCATCTATATACA | 0: 1 1: 0 2: 10 3: 76 4: 614 |
||
| Right | 1125843931 | 15:42833580-42833602 | TAAAAATTGTCGGCCAGGTGTGG | 0: 1 1: 7 2: 61 3: 460 4: 2331 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1125843931 | Original CRISPR | TAAAAATTGTCGGCCAGGTG TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||