ID: 1125844243

View in Genome Browser
Species Human (GRCh38)
Location 15:42836898-42836920
Sequence GCTTCTCCATGTACAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125844240_1125844243 -8 Left 1125844240 15:42836883-42836905 CCTCCTTGAGACTCAGCTTCTCC 0: 1
1: 0
2: 10
3: 113
4: 752
Right 1125844243 15:42836898-42836920 GCTTCTCCATGTACAAAAGAGGG 0: 1
1: 1
2: 2
3: 22
4: 252
1125844239_1125844243 8 Left 1125844239 15:42836867-42836889 CCAGACAAATCACAAACCTCCTT 0: 1
1: 0
2: 1
3: 11
4: 177
Right 1125844243 15:42836898-42836920 GCTTCTCCATGTACAAAAGAGGG 0: 1
1: 1
2: 2
3: 22
4: 252
1125844238_1125844243 26 Left 1125844238 15:42836849-42836871 CCATCAAGTAGGCTAGTACCAGA 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1125844243 15:42836898-42836920 GCTTCTCCATGTACAAAAGAGGG 0: 1
1: 1
2: 2
3: 22
4: 252
1125844237_1125844243 27 Left 1125844237 15:42836848-42836870 CCCATCAAGTAGGCTAGTACCAG 0: 1
1: 0
2: 2
3: 7
4: 48
Right 1125844243 15:42836898-42836920 GCTTCTCCATGTACAAAAGAGGG 0: 1
1: 1
2: 2
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125844243 Original CRISPR GCTTCTCCATGTACAAAAGA GGG Intronic
900922769 1:5684158-5684180 GGGTCTGCATGTACAAAAGGAGG + Intergenic
901608506 1:10477813-10477835 ATTTCTCCATGTGCAAAACAGGG + Intronic
902243680 1:15104841-15104863 GTTTCTCCATCTATAAAGGAGGG - Intronic
902444207 1:16451828-16451850 TCTTCTTCATGTTCTAAAGAGGG - Exonic
902772024 1:18650674-18650696 GTTTCTCCATCTATAAAAAAAGG - Intronic
902936242 1:19766864-19766886 GTTTCCCCATCTACATAAGAGGG + Intronic
903471140 1:23588217-23588239 GCTTCCCCAGGTAGAGAAGAAGG + Intronic
904534213 1:31188460-31188482 CCTTCTCCATGTGGAGAAGATGG + Intronic
905130511 1:35752727-35752749 GTTTCTTCATATACAAAATAAGG + Intronic
905874280 1:41422369-41422391 GCTGGGCCAAGTACAAAAGAGGG + Intergenic
906942393 1:50266710-50266732 GTTTCTCCATGTATAAAATGAGG + Intergenic
909071163 1:70995074-70995096 GTTTATGGATGTACAAAAGAGGG + Intronic
909362126 1:74773684-74773706 GCTTTTCCATTTAAAAAATATGG - Intergenic
910625844 1:89305527-89305549 ACTTCTCCATGTAGACCAGAGGG - Intergenic
910654709 1:89608153-89608175 GCTTCTTCATCTGCAAAACAGGG + Intergenic
910697138 1:90031273-90031295 GTTTCTACATGTACAAGAGTGGG - Intronic
910722061 1:90297072-90297094 GTTTCTCCAGGTAGACAAGATGG - Intergenic
912560333 1:110547044-110547066 GTTTCTTCATGTACTAAACAGGG - Intergenic
914332061 1:146681149-146681171 TCTGCTCCATCTACAAAATATGG + Intergenic
914418362 1:147505309-147505331 GCTTCTCCATGCATAAAATAAGG + Intergenic
914794526 1:150908937-150908959 GCTTCTTAAAGTACAAAAGTTGG + Intergenic
918513012 1:185332035-185332057 GCTTCTTCATTTACCAAAGCAGG + Intergenic
919341927 1:196321247-196321269 GCTTCTCCAATTACAAGACAGGG - Intronic
920004863 1:202825707-202825729 GTTTCTCCTTGTAGAAGAGAAGG - Exonic
920927592 1:210357358-210357380 CCTTCTCTATACACAAAAGAAGG + Intronic
1064198537 10:13265204-13265226 GCTTCTTCATTTATAAAATAGGG - Intergenic
1065382861 10:25107490-25107512 GCTTCTCCATTTGCAAAACGAGG - Intergenic
1066192068 10:33065139-33065161 GATTCTCCATTTATAAAATAGGG + Intergenic
1066217556 10:33302445-33302467 GCTCCTCCTTGATCAAAAGATGG + Intronic
1066237207 10:33497241-33497263 GCTTCTCCATTTGAAATAGAGGG - Intergenic
1068426034 10:56865251-56865273 GTTTCTCCATTTACAACAGGAGG + Intergenic
1068848477 10:61707952-61707974 GATTCTTCATCTACAAAATAAGG + Intronic
1069164691 10:65139174-65139196 ACTTCTCAATTTACAATAGAAGG - Intergenic
1069788547 10:71005009-71005031 GTTTCCCCATTTACACAAGAGGG - Intergenic
1072481452 10:95813337-95813359 GCTTCTCCATGTTCAAAAAATGG + Intronic
1072486444 10:95860891-95860913 GTTTCTTCATGGACACAAGATGG + Intronic
1073644630 10:105288101-105288123 GCATCGCCATGCACAAATGATGG + Intergenic
1075794750 10:125111882-125111904 GCTTTTCCAGGAAGAAAAGATGG + Intronic
1075998341 10:126895807-126895829 GCTTGTCCAGGTTCAAAAAAAGG + Intergenic
1076242778 10:128922293-128922315 GCGTCTACATCTTCAAAAGATGG - Intergenic
1079550050 11:21684151-21684173 GCTTGTCCATGAACACAAGGGGG + Intergenic
1079610790 11:22430234-22430256 GCTTCTCCAATTATAAATGAGGG + Intergenic
1079849833 11:25517615-25517637 GCATTTCCATGTACAAAATCTGG - Intergenic
1083405054 11:62451003-62451025 TCATCTCCATGTACCAAAGATGG - Intronic
1083545304 11:63545086-63545108 GCCTCTCCATGTGCAGAGGAGGG + Intronic
1085911100 11:80827733-80827755 GCTGCCCCAGGTACAAAACATGG - Intergenic
1086771104 11:90768736-90768758 GGCTCTCCAGGTCCAAAAGAGGG + Intergenic
1087803405 11:102528934-102528956 GTTTCTTCATGTATAAAATAGGG - Intronic
1088216986 11:107521925-107521947 ATTTCTTCATTTACAAAAGATGG + Intronic
1089679033 11:120109288-120109310 CCTTCTCCATCTACAAAATGAGG - Intergenic
1090520829 11:127477223-127477245 AGTTCTCCATGTGCAAAGGAAGG - Intergenic
1090727944 11:129544412-129544434 GTTTCTTCATCTATAAAAGAAGG - Intergenic
1091810000 12:3389231-3389253 GTTTCTTCATCTACAAAGGAAGG - Intronic
1091998213 12:5011836-5011858 GCTTCTCCATCTAGAAAATAGGG - Intergenic
1092335605 12:7630024-7630046 CCTTTTCCCAGTACAAAAGATGG + Intergenic
1092920220 12:13224452-13224474 GCCACGCCATGAACAAAAGAGGG + Intergenic
1093742674 12:22706337-22706359 CCTTCTTCATGGAGAAAAGAAGG - Intergenic
1093850472 12:24030482-24030504 GCATATCCATATGCAAAAGAAGG + Intergenic
1094365816 12:29679825-29679847 GCTTCTAAATCTACAAAACAGGG - Intronic
1094445425 12:30524537-30524559 GCCTCGCCATGTATGAAAGATGG - Intergenic
1095456660 12:42392903-42392925 GTTTCTTCATTTACAAAATAGGG - Intronic
1095535847 12:43246219-43246241 GTTTCTCCATTTACAAAATAAGG + Intergenic
1096930144 12:55199075-55199097 GCTTCTCCCTGTGGAGAAGAGGG + Intergenic
1098276482 12:68817192-68817214 GCTTCCCCATTTATAAAATAGGG + Intronic
1098670365 12:73220912-73220934 GCTTCTTCATGTTCAAAATGAGG - Intergenic
1099764452 12:86964827-86964849 ATTCCTCCTTGTACAAAAGAAGG + Intergenic
1100066878 12:90658412-90658434 GCTTCGGCATGGACAACAGAGGG + Intergenic
1101851727 12:108408745-108408767 GCTTTTCCATCTATAAAATAAGG - Intergenic
1101861714 12:108487711-108487733 CTTTCACCATATACAAAAGATGG + Intergenic
1103630589 12:122257000-122257022 GCTACTACTTGTACAAAAGTGGG + Intronic
1104769604 12:131352849-131352871 GCTTCACCACGTACCAAGGAAGG - Intergenic
1104786577 12:131453929-131453951 GTTTCTTCATCTGCAAAAGAAGG + Intergenic
1107484787 13:40815239-40815261 GCTTCCCCATGTACATAACCTGG - Intergenic
1107575913 13:41722110-41722132 GCTTCTTTATGTACTAAAAAAGG + Intronic
1107611592 13:42118763-42118785 GCTCCTACATGTACCATAGAAGG - Intronic
1107901155 13:45015845-45015867 GTTTCTCCATCTATAAAATAAGG - Intronic
1108468817 13:50747521-50747543 GCTTCTCCATCTATGAAAGGAGG - Intronic
1108775388 13:53759527-53759549 TCTTCCCCATTTACAAGAGAAGG - Intergenic
1109263000 13:60165238-60165260 GCTGCTTCATCTACAAAAGGGGG + Intergenic
1112565003 13:100545301-100545323 GCTTCCCCATCTGCAAAAGGGGG - Intronic
1113232453 13:108228802-108228824 GCTTCTCAATGTAGAAGAGCTGG - Intronic
1113282469 13:108804137-108804159 GCTTCTCCATCTGCAAAATAAGG + Intronic
1114397754 14:22382396-22382418 GGTTCTTCATCTACAAAAGTGGG + Intergenic
1115064058 14:29233576-29233598 GATTCTCCATGTAAACAAGTCGG - Intergenic
1117098857 14:52324830-52324852 TCTTCTCCAAGTATAAAAGAAGG + Intronic
1117771060 14:59135226-59135248 GCTTCTCCTTGGTCAAAAAAAGG + Intergenic
1122074869 14:99229526-99229548 GCTTCTCCATCTGCAAAATGGGG + Intronic
1123776662 15:23587603-23587625 CCTTCTCCCTGAACAACAGAAGG + Intronic
1125844243 15:42836898-42836920 GCTTCTCCATGTACAAAAGAGGG + Intronic
1125876896 15:43156312-43156334 GTTTCTCCATTTACAAACCAAGG - Intronic
1127859083 15:62978215-62978237 GCCTCTCCATTTATAAAGGATGG - Intergenic
1127931325 15:63599510-63599532 GTTTCTTCATGTACAAAACTGGG + Intronic
1129104601 15:73297496-73297518 GTTTCTTCATCTACAAAAGAGGG - Intronic
1129525977 15:76214688-76214710 GCTTCCCCATCTGTAAAAGAGGG + Intronic
1130629693 15:85554227-85554249 GTTTCTTCATCTACAAAATAGGG + Intronic
1130751598 15:86718547-86718569 GCTTCTCCATCAACACAGGATGG - Intronic
1130859915 15:87876651-87876673 GCTTCTCTGTGTACTAGAGAAGG + Intronic
1131713732 15:95085332-95085354 GCTACTCCTTGTGCAAGAGAGGG + Intergenic
1133427015 16:5701450-5701472 CTTCCTCCATGTACAAAGGATGG + Intergenic
1133851198 16:9505493-9505515 GCTTCTCCATGTTCAAAACATGG + Intergenic
1136790709 16:32966475-32966497 GCTGCTGCATCTAGAAAAGATGG + Intergenic
1136879106 16:33887457-33887479 GCTGCTGCATCTAGAAAAGATGG - Intergenic
1137253745 16:46758663-46758685 GAATCTCCATCTACAAAATAAGG - Intronic
1137761861 16:50947670-50947692 GTTTCTCCATGTTTAAAATAAGG - Intergenic
1137960060 16:52873864-52873886 GTTTCCCCATTTGCAAAAGAAGG + Intergenic
1138309082 16:56007934-56007956 GCTTCTTCATTTTAAAAAGATGG - Intergenic
1138732247 16:59208244-59208266 GCCTCTCAATGTACATGAGAGGG + Intergenic
1140001489 16:71029769-71029791 TCTGCTCCATCTACAAAATATGG - Intronic
1141681919 16:85549840-85549862 GCATCTTCATGCACAAAAGTGGG + Intergenic
1203092910 16_KI270728v1_random:1227933-1227955 GCTGCTGCATCTAGAAAAGATGG + Intergenic
1144363251 17:14516995-14517017 GCTTCTCCATGTATCAAACTTGG + Intergenic
1144480846 17:15627856-15627878 GTTTCTCCATCTGCAAAATAAGG + Intronic
1144917514 17:18736200-18736222 GTTTCTCCATCTGCAAAATAAGG - Intergenic
1146499528 17:33352479-33352501 GCTTCTCATTTTACAAAAGCAGG - Intronic
1146528104 17:33584242-33584264 CCCTCTCCATGAACTAAAGATGG - Intronic
1147535820 17:41322799-41322821 GTTTCTTCATGCACAAAATAAGG - Intergenic
1147555779 17:41478218-41478240 GGTTCTCTATGCAGAAAAGAGGG - Intronic
1147670235 17:42172858-42172880 GCTTCTCCATGTCTTAAAGGGGG - Intronic
1148165156 17:45478540-45478562 GCTTGTCCATGTAAAAAAGGTGG - Intronic
1148968220 17:51455910-51455932 GTTTCTCCATCTGCAAAAGGGGG - Intergenic
1150396386 17:64825264-64825286 GCTTGTCCATGTAAAAAAGGTGG - Intergenic
1151618225 17:75228740-75228762 CCTTCTCCATGTTCATATGAAGG - Intronic
1153128194 18:1822003-1822025 TCTTCTCCATGAACACAAAATGG + Intergenic
1154013541 18:10596112-10596134 GCATTTCCATGTACTACAGAGGG + Intergenic
1154152762 18:11919699-11919721 GCATTTCCATGTACTATAGAGGG + Intergenic
1154179946 18:12127396-12127418 GCTTCTTCTTATAAAAAAGACGG + Intronic
1155384141 18:25258819-25258841 GCCTCTCCATCTACACAACAGGG + Intronic
1155581734 18:27316088-27316110 GTTTCTCCATGTAAAAAAATAGG + Intergenic
1158069367 18:53452488-53452510 TCTTCTCAATGTGCAAAAGTGGG + Intronic
1160495072 18:79368637-79368659 GCTTATCCATGTAAGAATGAAGG + Intronic
1162841146 19:13357368-13357390 GCTTCTCTATGTACAGGAGGAGG + Intronic
1162908801 19:13838816-13838838 GCTTCCCCATCTGCAAAACAGGG + Intergenic
1163682361 19:18690446-18690468 GCTGCTCCCTGAACAAAAGGTGG + Intronic
1164681444 19:30136289-30136311 GCTTCTCCATGCTCCAGAGAAGG + Intergenic
1166752126 19:45169275-45169297 GTTTCCTCATGTAAAAAAGAGGG + Intronic
1168322804 19:55520346-55520368 GCTTCTCCAACTATAAAACAGGG + Intergenic
925350906 2:3200226-3200248 GGCTCTCCATAAACAAAAGAAGG - Intronic
925457616 2:4029356-4029378 GCTGCTTTATCTACAAAAGAGGG - Intergenic
928666185 2:33552746-33552768 GTTTCTTCATCTACAAAATAAGG - Intronic
932226502 2:70045323-70045345 GCTTGCCCATGTGCAAAAAATGG + Intergenic
932579919 2:72986420-72986442 GCTTCTCCATCTGTAAAAGGCGG - Intronic
932639928 2:73434653-73434675 TTTTCTCCATTTTCAAAAGAAGG + Intronic
932941383 2:76170983-76171005 CATTTTCCGTGTACAAAAGAGGG - Intergenic
933052231 2:77613661-77613683 GCTTCTCCACGTCAAAATGAAGG + Intergenic
935835338 2:107045346-107045368 GTATCTCTATGAACAAAAGAAGG - Intergenic
937463234 2:122107509-122107531 GTTTCTTCATCTACAAAATACGG + Intergenic
945335589 2:208588964-208588986 GCTTCTTCAAGGACAACAGAAGG + Intronic
946739154 2:222784967-222784989 TCTTCTCCATGTTCAAAAGCAGG - Intergenic
947230707 2:227883050-227883072 GCTTTTCCATGAAAAAAAGTTGG - Intronic
1168994217 20:2120641-2120663 GCTTGTCCATCTACAAAACTTGG - Intronic
1169807670 20:9576185-9576207 ACTTCTTTATGTACAAAATAAGG - Intronic
1170088606 20:12565566-12565588 GTTTCTTCATGTACAAAATGGGG + Intergenic
1172840383 20:37899508-37899530 GTTTCTCCATCTGTAAAAGAAGG + Intergenic
1173421208 20:42902626-42902648 GCTTCTCTAAGGACAAAATAAGG - Intronic
1173542691 20:43866600-43866622 GTTTCTCCATGTATAACACATGG - Intergenic
1176267215 20:64216367-64216389 GATTTTACATGCACAAAAGATGG - Intronic
1176947081 21:14995284-14995306 GTTTCTTCATTTACAAAAGAGGG + Intronic
1179429236 21:41308296-41308318 GCTTCTTCATCTACACAACAGGG - Intronic
1180566691 22:16674083-16674105 GCTTCTTCTTATAAAAAAGAGGG - Intergenic
1181531222 22:23518607-23518629 GCTTCTCCACCTATAAAACAGGG + Intergenic
1184097021 22:42321638-42321660 GCTTCTTCATGTAAAACAGGGGG + Intronic
1184627454 22:45747733-45747755 GCTTCTTCATGTATAAAATAGGG + Intronic
949319583 3:2794456-2794478 GCTTTTCTATGAACAAAAAAAGG - Intronic
949420199 3:3857233-3857255 GTTTCTCCATCTGCAAAACAAGG - Intronic
949498855 3:4658983-4659005 GCTTCTTCATCTACAAGAAAGGG - Intronic
950312443 3:11970294-11970316 GCTTCTCCATCTGCAAAAGGAGG - Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953034825 3:39202512-39202534 GCTTCCCCATGTGTAAAAGGGGG - Intergenic
953041089 3:39255532-39255554 GCTGTTTCATGCACAAAAGATGG + Intergenic
955792736 3:62605326-62605348 GCTTCTTCATTTATAAATGAGGG - Intronic
957140696 3:76351835-76351857 GTTTCTTCATTTATAAAAGAGGG + Intronic
957964249 3:87302178-87302200 GCTTCTCCTTTATCAAAAGATGG + Intergenic
958257577 3:91342485-91342507 GATTTTCCATTTACAAAATATGG - Intergenic
959210705 3:103376558-103376580 GCTTCTTCATGGCAAAAAGATGG + Intergenic
959995515 3:112676408-112676430 CCTTCTCCTAGTATAAAAGATGG - Intergenic
960593238 3:119385704-119385726 GGTTCTTCATGTATAAAATAAGG - Intronic
960991769 3:123316128-123316150 CCTTCTCCATGTACCATAGCAGG - Intronic
962724610 3:138210963-138210985 GCTTCTCAGTTTACAAAAAACGG + Intronic
963228438 3:142886727-142886749 GCTTCCCCATCTATAAAATAGGG + Intronic
969102586 4:4780486-4780508 GTTTCTCCATTTATAAAATAAGG + Intergenic
969182220 4:5451024-5451046 GCTTCCTCATTCACAAAAGAAGG + Intronic
970760329 4:19478287-19478309 GCTTTTTCATGTTAAAAAGATGG + Intergenic
970795974 4:19914054-19914076 CCTTCTCCATTTACAAAATGAGG + Intergenic
971921522 4:32946037-32946059 GCTACTGCATATGCAAAAGAAGG + Intergenic
972815594 4:42641571-42641593 TCTTTTCCATGTACAAAATGCGG - Intronic
972969507 4:44555505-44555527 GATTTTCCATGAACAAAAGCTGG + Intergenic
978017188 4:103759004-103759026 GCTTCACTAAGTACAAAGGAAGG - Intergenic
978352109 4:107830898-107830920 GCTTCTCCAAACACAGAAGATGG + Intronic
979690214 4:123551493-123551515 GCTGCCCCATGTATTAAAGAGGG + Intergenic
981068192 4:140507500-140507522 ACATCTCACTGTACAAAAGAAGG - Intergenic
981185044 4:141791467-141791489 ACTTCTTCATCTATAAAAGAAGG - Intergenic
982004763 4:151053169-151053191 ACTTCTCGATGTACCAAAGGAGG + Intergenic
985957219 5:3274821-3274843 GCTTATCTCTGCACAAAAGAAGG - Intergenic
985987241 5:3526191-3526213 CCTCCTCCATGTTCAAGAGAAGG - Intergenic
986651642 5:9969903-9969925 GGATATCCATATACAAAAGAAGG + Intergenic
988817079 5:34845054-34845076 GCTTCTTCTTCTACAAATGAGGG - Intronic
990848324 5:60171089-60171111 AATACTCCATGTACCAAAGATGG + Intronic
991221396 5:64223526-64223548 GTTTCTCCATCTATAAAATAGGG - Intronic
993884032 5:93395792-93395814 GCTTCTCCCTGAACAATAGAGGG + Intergenic
995014827 5:107298151-107298173 GGTTCTCCAGGTAAAGAAGATGG - Intergenic
996408047 5:123126181-123126203 ACTTATGCATGTACAAAAGTGGG - Intronic
997730241 5:136166602-136166624 GATTCCCCATTTACAAAATAGGG + Intronic
998071250 5:139199483-139199505 GCTTCTCCATTTATAAAAAGGGG - Intronic
998117797 5:139551400-139551422 TCTTCTCCAAGGACAGAAGAGGG + Intronic
998568151 5:143234259-143234281 GCTTCTTCATCTACAAAATAGGG - Intergenic
998769566 5:145526454-145526476 GCCTCTCCATGTACAAATATAGG - Intronic
999622364 5:153486251-153486273 GTTTCTCCATCTGCAAAATATGG - Intergenic
999641800 5:153680001-153680023 GCTTCTCCATTTACAAACCACGG - Intronic
999685361 5:154097886-154097908 GCTGCTGCATGTAAAAAAGGGGG + Intronic
1000301002 5:159955784-159955806 GCTTCTCCATGTACAAAACAAGG - Intronic
1001789731 5:174445791-174445813 GCTTCTCCCTCTACCAAAAAAGG + Intergenic
1002962816 6:1932332-1932354 GCTTCTTCATGTACAAAATGGGG - Intronic
1003103343 6:3194298-3194320 ACTTTTCAATTTACAAAAGATGG + Intergenic
1003689245 6:8336556-8336578 GCTTGGCAATGTAGAAAAGAAGG - Intergenic
1005115307 6:22329451-22329473 GATTCTCCAACTACAAAATAAGG - Intergenic
1006495211 6:34417979-34418001 GTTTCTCCATCTATAAAATAAGG - Intronic
1006704043 6:36001791-36001813 GCTTCTCCATATTCACAACATGG - Intronic
1007260730 6:40561346-40561368 GTTTCTCCATCTACTAAATAAGG - Intronic
1008997717 6:57678419-57678441 GATTTTCCATTTACAAAATATGG + Intergenic
1009186211 6:60577760-60577782 GATTTTCCATTTACAAAATATGG + Intergenic
1014251758 6:119122612-119122634 TCTTCTCCATGTTCAAAAAATGG + Intronic
1016897248 6:149065645-149065667 ATTTCTCCATCTGCAAAAGAGGG + Intronic
1018913998 6:168121605-168121627 GCTTCTCCATCTAGGAAGGAAGG - Intergenic
1021079551 7:16347794-16347816 GCTTCTCCCTGTGGAAAAGAGGG + Intronic
1021256461 7:18398336-18398358 TATTTTCCATGTAGAAAAGAAGG + Intronic
1022384269 7:29887200-29887222 GTTTGTCCATGTTCAAAATAAGG + Intronic
1022886738 7:34654518-34654540 GCTTCTCCTAGCAGAAAAGAAGG + Intergenic
1023546240 7:41320327-41320349 GCCCCTACAAGTACAAAAGAGGG + Intergenic
1023781544 7:43660531-43660553 GCTTCTTCACTTACAAAATAGGG - Intronic
1024964268 7:55007746-55007768 GCTTCCACATGTACTATAGAAGG - Intergenic
1027641275 7:80736446-80736468 GCATCTCCATGTTCATAAAATGG + Intergenic
1028764466 7:94536541-94536563 GGTTCTCCATATACATAAAAGGG + Intronic
1030768853 7:113447467-113447489 GCATCTCCAAGGACAAGAGAAGG + Intergenic
1030941603 7:115657730-115657752 GTCTCTCCATGTACATAAAATGG + Intergenic
1031798527 7:126211046-126211068 GCTTCTCCATCTGAAAAATAAGG + Intergenic
1034714183 7:153224091-153224113 CCTGCTACATGTGCAAAAGATGG - Intergenic
1034780358 7:153873802-153873824 GTGTCTTCATGTCCAAAAGATGG + Intergenic
1036176503 8:6543261-6543283 GCATCTTCATGTACAGAAGATGG - Intronic
1038062783 8:23930885-23930907 GTTTCCTCATCTACAAAAGAGGG - Intergenic
1038078746 8:24107920-24107942 GCATCTCCAGGTAAAAGAGATGG + Intergenic
1041389341 8:57335154-57335176 TCATCTCCATTTACAGAAGAGGG - Intergenic
1042991562 8:74646181-74646203 TCTTCTCCATTCACAGAAGAGGG + Intronic
1043186573 8:77159094-77159116 GCATCTTCATCTACAAAATAAGG + Intergenic
1043513025 8:80968308-80968330 GTTTCTCCATATACAAAATGGGG - Exonic
1043555281 8:81423263-81423285 GCTTCTCCATCTTTAAAGGAGGG - Intergenic
1043823296 8:84894970-84894992 GTTTTTCCATCTATAAAAGAGGG + Intronic
1045639413 8:104230798-104230820 GCTTATCTATCTATAAAAGAAGG + Intronic
1045756126 8:105544659-105544681 GCTTCTTCATGGACACAAGTTGG + Intronic
1045814819 8:106267573-106267595 GTTTCCCCATGGACAAAAAAAGG - Intergenic
1046949777 8:120008837-120008859 GCATCTCCCTGTAGAAAAGGTGG - Intronic
1047358926 8:124149960-124149982 GTTTCTGCATGTATAAAATAAGG - Intergenic
1047365891 8:124211182-124211204 GCTCCTCCCTGGACAAAGGAAGG + Intergenic
1047881826 8:129203031-129203053 CCTTCTCTAGGTACAAAAAATGG + Intergenic
1048168849 8:132086126-132086148 GTTGCTCCATGAAGAAAAGAAGG + Intronic
1056399867 9:86216148-86216170 TCTTCTCCAGGAACAAAACATGG + Intergenic
1057045353 9:91882009-91882031 GCTTCTCCCTGTACATGACAAGG - Intronic
1057873985 9:98739518-98739540 GTTTCCTCATCTACAAAAGAGGG + Intronic
1058475242 9:105326465-105326487 GCTTATCCATGTACCATGGAGGG - Intronic
1058906713 9:109487942-109487964 GTTTCTCCATCCAGAAAAGAGGG + Intronic
1060001581 9:119963648-119963670 GTTTCTCCATCTACAAAATGGGG + Intergenic
1060082922 9:120669014-120669036 GTGTCTCCATGTACAAAATGTGG + Intronic
1060122463 9:121006670-121006692 CCTTCTTCATTTACAAAAAAAGG + Intronic
1060581553 9:124751937-124751959 GCTTCTTCAAATACAAAAGGAGG - Intronic
1060778864 9:126397085-126397107 GCTGCTCCAAGTACAAGTGATGG - Intronic
1060789343 9:126475426-126475448 TGTTATCCATGTACACAAGATGG - Intronic
1186065727 X:5761936-5761958 GCTTCCACATGTGAAAAAGAGGG - Intergenic
1186682491 X:11890688-11890710 GCTTCTCCATGTACAAGTGTGGG - Intergenic
1187501994 X:19846411-19846433 TCTTCTCCATGCACAAAAAAAGG - Intronic
1188474545 X:30577266-30577288 GCTTCTGCATTTTTAAAAGAAGG - Intronic
1188633245 X:32395045-32395067 TCATCTTCATGTACAAATGAAGG + Intronic
1188663436 X:32789679-32789701 GTTTTTCCATTTATAAAAGAAGG + Intronic
1189328581 X:40129021-40129043 GCTTCATCATGTGCAAAATAGGG - Intronic
1189634485 X:42991366-42991388 ATTTCTCCTTGGACAAAAGAAGG - Intergenic
1192699775 X:73456354-73456376 GCTTCTCAAACTACAAAATAGGG - Intergenic
1195888145 X:109663050-109663072 GCTTCTCCATCAGCAAAACAAGG - Intronic
1197907436 X:131441297-131441319 GATTCTCCATTTGCAAAATAAGG + Intergenic
1198257597 X:134938082-134938104 GGTTCTCCATGTACAAATTGGGG + Intergenic
1198926745 X:141805354-141805376 ATCTCTGCATGTACAAAAGAGGG - Intergenic