ID: 1125846291

View in Genome Browser
Species Human (GRCh38)
Location 15:42857620-42857642
Sequence ATAGGCTGTAGAATTTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125846291 Original CRISPR ATAGGCTGTAGAATTTCCTC AGG (reversed) Intronic
900009095 1:89969-89991 AGAGGCTGTAGAATGTGCACTGG + Intergenic
900025248 1:266782-266804 AGAGGCTGTAGAATGTGCACGGG + Intergenic
900028850 1:356164-356186 AGAGGCTGTAGAATGTGCACGGG + Intergenic
900665835 1:3814954-3814976 ACACGCAGTAGAATTTCCGCAGG - Exonic
904236464 1:29120645-29120667 AGAGGCTGAAGAAATTCCTGAGG + Exonic
909966405 1:81916617-81916639 GTATGCTGTAAAATTTCCTATGG + Intronic
911237070 1:95423037-95423059 ATAGGCTGAAGAGATTCTTCAGG + Intergenic
920010384 1:202862673-202862695 ATCAGCTGCAGATTTTCCTCAGG - Intergenic
923171299 1:231420572-231420594 ATAAGCTGTTAAATTTCCTATGG - Intronic
1064892884 10:20198342-20198364 ATGGGCTTTAGAATTTCCAGAGG - Intronic
1067740841 10:48895223-48895245 ATAGACTAGAGAATTCCCTCTGG + Intronic
1067925500 10:50504300-50504322 CTAAGCTTAAGAATTTCCTCAGG - Intronic
1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG + Intergenic
1075760102 10:124849174-124849196 ACAGGCTGGAGCATTTGCTCTGG + Intergenic
1078416339 11:11169254-11169276 GAAGTCTGTAGAATTTCCTGAGG - Intergenic
1079316699 11:19413513-19413535 ATAGGATGTGGAAGTTCTTCTGG - Intronic
1079750149 11:24186602-24186624 ATATTTTGTAGCATTTCCTCAGG - Intergenic
1082000508 11:47391458-47391480 CTTGGCTCTAGCATTTCCTCTGG - Intergenic
1085176887 11:74496088-74496110 ATAGGCAGTAGAATGTCTTCAGG - Intronic
1088914893 11:114220018-114220040 CTAGGCTGGAGAAGTTCGTCTGG - Intronic
1089137127 11:116258495-116258517 AAAGGCTGTAGAAATCCGTCGGG + Intergenic
1092070008 12:5624584-5624606 AAAGGCAGGAGAATTTCCTGTGG - Intronic
1093686561 12:22061932-22061954 AGAGGTTATAGACTTTCCTCTGG + Intronic
1094389219 12:29931341-29931363 ATAACCTGTAGAGTCTCCTCTGG + Intergenic
1096079087 12:48822092-48822114 AGGGGCTTTAGAATGTCCTCAGG - Intronic
1096649702 12:53056015-53056037 ATGGTCTGTAGAGTTTCCTGGGG + Intronic
1099312590 12:81046330-81046352 ATATGCTGTTGGCTTTCCTCTGG + Intronic
1100669734 12:96798266-96798288 ACATGCTTTAGAATTTCCTTTGG + Intronic
1103213405 12:119182976-119182998 AGAGGCTGTGGGATTTGCTCAGG - Intronic
1105656571 13:22447297-22447319 AGAGTCTGGAGAATTTCCTGGGG + Intergenic
1110643622 13:77855275-77855297 AAAGGCTTTAGATTTACCTCAGG + Intergenic
1113607352 13:111619749-111619771 AAAGTCTGTAAAATTTCCTTTGG + Intronic
1115378789 14:32709666-32709688 GAAGGCTGTGGAATTCCCTCTGG - Intronic
1117138297 14:52760523-52760545 ATAGGCTGCAGAATGTGCTCTGG + Intronic
1117433082 14:55689261-55689283 TTAGGCTATACATTTTCCTCTGG + Intronic
1118339359 14:64880781-64880803 ATCGGTTCTAGTATTTCCTCTGG - Intergenic
1121162554 14:91758329-91758351 GTCTGCTGGAGAATTTCCTCTGG - Intronic
1125846291 15:42857620-42857642 ATAGGCTGTAGAATTTCCTCAGG - Intronic
1125965063 15:43867674-43867696 ACAGGCTATTGAATTTCCTTCGG - Exonic
1127675382 15:61233160-61233182 ATATACAGTAGAATTTCCTTGGG + Intergenic
1131129667 15:89889118-89889140 ATCTGCTGTTGAATTTCTTCTGG + Exonic
1131612766 15:93982471-93982493 CTGAGCTGTGGAATTTCCTCAGG - Intergenic
1131778648 15:95829767-95829789 CTAGTCTGTAGAATTTTATCTGG + Intergenic
1135533247 16:23272602-23272624 ATAATCTGAAGAATTTCCGCCGG - Intergenic
1136747314 16:32602238-32602260 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1139172433 16:64648063-64648085 ATAGGCTGGAGTTTTGCCTCTGG - Intergenic
1142455240 16:90216992-90217014 AGAGGCTGTAGAATGTGCACTGG - Intergenic
1203049449 16_KI270728v1_random:861444-861466 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1147125134 17:38362336-38362358 GAAGGCTGTAGAATCTCCTTTGG + Intronic
1148936046 17:51165604-51165626 ACAGGGTCTAGACTTTCCTCAGG + Intronic
1152183350 17:78839332-78839354 ATTTGCTGTAGAATTACCTGGGG - Intronic
1152950908 17:83230393-83230415 AGAGGCTGTAGAATGTGCACGGG - Intergenic
1155210092 18:23593093-23593115 ATAGGCTGCTGAGTGTCCTCAGG + Intergenic
1156170715 18:34481813-34481835 GTAGGTTATAGAATTTCATCAGG + Intergenic
1157870348 18:51224623-51224645 ATAGAGTGCAGAATTTCCTCTGG - Intergenic
928743153 2:34379510-34379532 GTTGGCTGAAGAATTTCATCTGG + Intergenic
929682406 2:44004784-44004806 ATTGGCTGTAGACTCTCTTCAGG + Intergenic
932842219 2:75094306-75094328 GTAGGCTATGGAATTTCGTCGGG + Intronic
935512374 2:103991878-103991900 ATAGGATGTGGAGTTTCTTCTGG - Intergenic
939925548 2:148169830-148169852 ACAGGATTTAGAATTTCCTTTGG + Intronic
940649476 2:156427039-156427061 ATATGCTCTAGAACTCCCTCAGG - Intergenic
941033306 2:160537699-160537721 ATAGACTAAAGAATTTACTCAGG - Intergenic
945899005 2:215517129-215517151 ATAGGCTGTTGCATGTCCGCAGG - Intergenic
949086721 2:242161718-242161740 AGAGGCTGTAGAATGTGCACTGG - Intergenic
1170444156 20:16407770-16407792 ATAGACTGGAGTTTTTCCTCTGG - Intronic
1170485313 20:16809871-16809893 AAAGGCAGCAGAATTTCCTCTGG - Intergenic
1174929403 20:54795834-54795856 TTAGTCTGAAGAATTTCCTTTGG + Intergenic
952496266 3:33918588-33918610 TCAGGCTCTAGAATTTCCTGAGG - Intergenic
954051464 3:47982189-47982211 ATAGACTGATAAATTTCCTCTGG + Intronic
958922038 3:100118109-100118131 AATGGGTGTAGAATTTCATCTGG + Intronic
959801821 3:110504336-110504358 ACAGGCTGTAGAATCTTCCCTGG + Intergenic
961069293 3:123906659-123906681 GAAAGCTGTAGAATTTTCTCTGG - Intronic
964233179 3:154494321-154494343 ATAGGCTTTAGAGTCTTCTCTGG - Intergenic
964558304 3:157965107-157965129 ACTGGATTTAGAATTTCCTCAGG - Intergenic
964880256 3:161416017-161416039 AGAGGCTGTAGAAAAGCCTCGGG - Intergenic
964930848 3:162020252-162020274 AGAAGCAGTAGAATTTCCACTGG - Intergenic
965080589 3:164025872-164025894 ATAGGGTGTAGAACTGGCTCAGG + Intergenic
965457223 3:168917530-168917552 ATAGGCCTTAGAATTCTCTCAGG - Intergenic
966248607 3:177837095-177837117 TTGGCCTGTATAATTTCCTCTGG + Intergenic
970147710 4:13054206-13054228 ATAGGCTGCAGGATTTCTTCTGG + Intergenic
970698757 4:18709949-18709971 ACAGGATGGAGAATGTCCTCTGG - Intergenic
974986687 4:69035808-69035830 ATAGTGTGTATAATTTCCTCAGG - Intronic
975390419 4:73810397-73810419 ATAAGGTTGAGAATTTCCTCTGG - Intergenic
975470713 4:74763158-74763180 ATAGGATATAGAATTTTTTCGGG - Intronic
976182252 4:82409928-82409950 ATTAGCTTTAGAATTTCCTTTGG + Intergenic
976440219 4:85064839-85064861 ACAGGCTGAAGGATTTACTCGGG + Intergenic
976820691 4:89203366-89203388 ATAGGAAGTAGAGTTTCATCAGG - Intergenic
978060284 4:104328251-104328273 ATTGGATGTAGGATTCCCTCGGG + Intergenic
979327267 4:119394767-119394789 ACAGAATGTAGAATTTCCTTAGG + Intergenic
983245151 4:165279455-165279477 ACAGAATGTAGAATTTCCTTAGG + Intronic
983519209 4:168689191-168689213 ATAGGTTTTAGAATTCCCTCAGG + Intronic
986256198 5:6103020-6103042 GTAGGCTTTGGAAATTCCTCAGG + Intergenic
988282022 5:29161757-29161779 ATTGGCTTTATAATTTCCTGAGG + Intergenic
991279530 5:64896281-64896303 ATATCCTTTAGAATTTCCTTTGG - Intronic
994712543 5:103282954-103282976 ATAATCTGTAGCATTTCCTACGG - Intergenic
995005227 5:107184666-107184688 AAAGCCTGGAGAATTTCCACTGG + Intergenic
998104936 5:139462480-139462502 AAAGGCTCTGGAATTTCCCCTGG + Intronic
998227652 5:140339317-140339339 ATTGGCTGCAGAGTTTCCTGTGG - Intronic
999041906 5:148423259-148423281 GTAGGCTCTAGAAACTCCTCAGG + Intronic
999646147 5:153718817-153718839 ATAGCCTCTGGACTTTCCTCTGG - Intronic
1002745140 5:181464207-181464229 AGAGGCTGTAGAATGTGCACGGG - Intergenic
1005613452 6:27549016-27549038 ACAGGCTTTAGAATATCCACTGG - Intergenic
1006905975 6:37533883-37533905 ATAGGCTCTAGAATTTCTTGAGG + Intergenic
1010134474 6:72534349-72534371 CTAGACTGTAGCATTTTCTCAGG + Intergenic
1014813306 6:125908587-125908609 AAAGTCTGTAGGATTTCCTGAGG - Intronic
1015092888 6:129379886-129379908 ATAGGCTTTAGAACTTCCAAGGG + Intronic
1019250048 6:170737753-170737775 AGAGGCTGTAGAATGTGCACGGG - Intergenic
1021303581 7:19003612-19003634 ATAGGCTATACAAATTCCTATGG + Intergenic
1022680701 7:32542792-32542814 GTAGGCTGTTGGTTTTCCTCAGG + Intronic
1023529935 7:41142361-41142383 GTAGTCTGTAGAATATCCTTTGG + Intergenic
1028694154 7:93689290-93689312 AAAGGCTGCAGATTTTTCTCTGG + Intronic
1029487389 7:100852098-100852120 ATAGGCTCTAGGATTTCTGCTGG + Intronic
1032981535 7:137289614-137289636 AAAGCCAGTAGAATTTCCTTGGG - Intronic
1034007500 7:147490371-147490393 GTATGCTGGAGCATTTCCTCTGG + Intronic
1035497988 8:69551-69573 AGAGGCTGTAGAATGTGCACTGG + Intergenic
1038879152 8:31588341-31588363 CTAAGCTGTAGAATTTCTTTTGG + Intergenic
1041304294 8:56444966-56444988 ATGGGCTGTCGAATCACCTCTGG - Intronic
1041438959 8:57873621-57873643 ATAGCATGTAGACTCTCCTCTGG - Intergenic
1041831598 8:62161443-62161465 ATGGGCTGAGGAAATTCCTCTGG - Intergenic
1041920142 8:63172822-63172844 ATAGTCTGTAAAATTTCTTCAGG - Intronic
1043193609 8:77259910-77259932 AGAGGATCAAGAATTTCCTCTGG - Intergenic
1046855971 8:119032479-119032501 ATGGCCTGTAGAATTTCCAGTGG - Intronic
1050569535 9:6923023-6923045 ATATGCTTTAGATTCTCCTCAGG + Intronic
1051034595 9:12728444-12728466 ACAGGCTTAATAATTTCCTCAGG - Intergenic
1055365847 9:75543972-75543994 ATAGAGTGCAGAATTTCCCCAGG - Intergenic
1056054348 9:82805300-82805322 TTAGCATGTAGAATTTCCCCTGG - Intergenic
1060453733 9:123769547-123769569 AAAGTCTGTAGAACTTCCTGTGG + Exonic
1061209042 9:129180143-129180165 ACAGGCTGTGGAACTTGCTCAGG + Intergenic
1203579610 Un_KI270745v1:30338-30360 AGAGGCTGTAGAATGTGCACGGG - Intergenic
1188484460 X:30668028-30668050 ACAGAATGTAGAATTTCCTTAGG - Exonic
1188899401 X:35711303-35711325 AAAGGCTGAAGAATGTCATCAGG + Intergenic
1192587866 X:72334166-72334188 CTAGCCTTTAGAATTTTCTCAGG - Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193987028 X:88255298-88255320 TTAGCCTGAAGAATTTCCTATGG + Intergenic
1195123383 X:101780350-101780372 ACAGAATGTAGAATTTCCTTAGG + Intergenic
1195372417 X:104190628-104190650 TTAGGCTGTAAAATTGTCTCAGG + Exonic
1196131697 X:112164154-112164176 AAAGCCTGTACAATTTCCACTGG + Intergenic
1196697283 X:118626608-118626630 ATTGGCTGTAGCATTTCATAGGG - Intronic
1198152271 X:133922732-133922754 ATAGGTTGTGCAACTTCCTCTGG + Intronic