ID: 1125849818

View in Genome Browser
Species Human (GRCh38)
Location 15:42892404-42892426
Sequence TGGACCTTTAATAAAATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125849817_1125849818 -5 Left 1125849817 15:42892386-42892408 CCTAACATATTTATTATTTGGAC 0: 1
1: 1
2: 20
3: 224
4: 1129
Right 1125849818 15:42892404-42892426 TGGACCTTTAATAAAATGTTTGG 0: 1
1: 0
2: 5
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125849818 Original CRISPR TGGACCTTTAATAAAATGTT TGG Intronic
905712556 1:40118826-40118848 TGGATATATAATATAATGTTAGG - Intergenic
906378702 1:45317656-45317678 TGGAGCTTTTTTTAAATGTTGGG - Intergenic
909110571 1:71471674-71471696 CGTACTTTTAATCAAATGTTAGG + Intronic
909721336 1:78773833-78773855 TGGACCTTTAAGAAATGATTGGG + Intergenic
910674352 1:89801720-89801742 TTGACCTGTTATAAAGTGTTTGG + Intronic
911215995 1:95195427-95195449 TGCACATTTATTTAAATGTTTGG - Exonic
911896590 1:103443494-103443516 TGGACATTTAAGGAAATGTGTGG + Intergenic
912872936 1:113326721-113326743 TTGACCTTAAATACAACGTTTGG + Intergenic
913956774 1:143306414-143306436 TGGAACTTTAATAAATTGACTGG + Intergenic
913980668 1:143509241-143509263 TGGAACTTTAATAAATTGACTGG - Intergenic
914075030 1:144335679-144335701 TGGAACTTTAATAAATTGACTGG - Intergenic
914104148 1:144630816-144630838 TGGAACTTTAATAAATTGACTGG + Intergenic
916956579 1:169842867-169842889 AGGACCTTTAATAAATCTTTTGG + Intronic
916960486 1:169883411-169883433 TAGAGCTTTAATATCATGTTAGG - Intronic
918848789 1:189655586-189655608 TGAAACTTTAATAAAATGTATGG + Intergenic
923082115 1:230667909-230667931 TTGACATTTTATAATATGTTTGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063497379 10:6522648-6522670 TCTTCATTTAATAAAATGTTTGG + Intronic
1063968340 10:11363849-11363871 TGGACATTTTTTAAAATCTTAGG + Intergenic
1064803365 10:19102428-19102450 TGGACTTTTAATAGAGTGATAGG + Intronic
1066380705 10:34899035-34899057 TGAACTTTTAATGAAATGATAGG + Intergenic
1067949265 10:50713816-50713838 TGTACCATTGATAAAATGTAAGG - Intergenic
1068242993 10:54328876-54328898 TGGAAGTTTAATAAAATTTCTGG - Intronic
1069223187 10:65909083-65909105 AGTTCCTTTAATAAACTGTTTGG + Intergenic
1070460244 10:76660016-76660038 TTTACCTTTAATACAATATTTGG - Intergenic
1070884580 10:79878828-79878850 TGTACCATTGATAAAATGTAAGG - Intergenic
1073973362 10:109070894-109070916 TTTACTTTTAACAAAATGTTTGG - Intergenic
1074897337 10:117788633-117788655 TGCAGCATTAATAAAATGTGAGG - Intergenic
1076139168 10:128065781-128065803 TGGTCAGTTAATAAAATGTATGG + Intronic
1078616859 11:12874101-12874123 TGGCCCATGAATAAACTGTTTGG + Intronic
1080296340 11:30733312-30733334 CTGTCTTTTAATAAAATGTTCGG + Intergenic
1086193569 11:84109909-84109931 TTGAGTTTTAATAAAATGTAGGG - Intronic
1086603815 11:88669443-88669465 AGAACCTTCAATAAAATATTGGG - Intronic
1092640179 12:10498184-10498206 TGGACCTTATCCAAAATGTTAGG - Intergenic
1093194502 12:16113702-16113724 TGAACCTTTAGCAAAAAGTTTGG - Intergenic
1093665210 12:21804263-21804285 TGTATTTTTAACAAAATGTTAGG - Intronic
1095233835 12:39773827-39773849 TGGATCTTTTATAAACTCTTTGG - Intronic
1095273741 12:40254378-40254400 TGGCACTTTAATAAAACGCTTGG + Intronic
1095437223 12:42203214-42203236 ATGTCCTTCAATAAAATGTTGGG + Intronic
1098930151 12:76402263-76402285 TGGACTTTTAATTAACTGTTGGG + Intronic
1099372672 12:81856553-81856575 TGGACTTTGTATAAAATGATTGG + Intergenic
1099581652 12:84455361-84455383 GTGACCTTTTATAAAATGTGGGG - Intergenic
1101880109 12:108620563-108620585 TGGTCCTTTAAGAAAAAGTTTGG + Intergenic
1106374166 13:29168329-29168351 TGGAACATTAATAAATAGTTAGG - Intronic
1108221237 13:48234853-48234875 TGGTCTTTAAAGAAAATGTTTGG + Intronic
1108431605 13:50359236-50359258 TGGGCCTTTAAAAAAAAGTCTGG - Intronic
1109560783 13:64047462-64047484 TGGTCATTTAAAAAAATGTATGG - Intergenic
1110350154 13:74497382-74497404 TGGACCTTTGACAAAAAGTGTGG + Intergenic
1110938998 13:81325903-81325925 TGAAGCATTCATAAAATGTTTGG - Intergenic
1114251300 14:20963902-20963924 TGTATCTTTTATAAATTGTTTGG - Intergenic
1114836269 14:26205962-26205984 TGGACATTTAATAGAATTTGGGG - Intergenic
1115813519 14:37136062-37136084 TGGACATCTAATCAAAGGTTTGG + Intronic
1115837700 14:37427585-37427607 TGTACCTTTAAAAAAATGTGTGG - Intronic
1116130447 14:40849642-40849664 TAGACATTTAATAAAATTCTAGG + Intergenic
1116385813 14:44328541-44328563 TGGAACTTTTGTAAAATGTGAGG - Intergenic
1116532514 14:45990218-45990240 TGGTCTTTAAATAAAAGGTTTGG + Intergenic
1116632232 14:47350713-47350735 TGGAAATTTATTAAAATGCTAGG - Intronic
1118534512 14:66745185-66745207 TCAAACTTTAAAAAAATGTTGGG + Intronic
1120186583 14:81400093-81400115 TGGAACTGTAATGAAATGTCCGG + Intronic
1120646002 14:87075100-87075122 TGGAGCATTAATATACTGTTAGG - Intergenic
1120792202 14:88595230-88595252 TGGACCTTTAATGACAAATTTGG + Intronic
1121169908 14:91844908-91844930 TGGACCATTAACACAGTGTTTGG - Intronic
1121385022 14:93512507-93512529 TGGGACTTTAAAAAAATATTTGG + Intronic
1202939181 14_KI270725v1_random:128090-128112 TGGAACTTTAATAAATTGACTGG + Intergenic
1123393964 15:19908186-19908208 TGGAACTTTAATAAATTGACTGG - Intergenic
1123566053 15:21547841-21547863 TGGTATTTTAAAAAAATGTTTGG + Intergenic
1125256830 15:37774202-37774224 CAGACCTTCAATTAAATGTTAGG - Intergenic
1125327522 15:38551564-38551586 TGGACTATTAATTAAATCTTTGG + Intronic
1125611609 15:40975245-40975267 TGTACCTTTTCTAAATTGTTGGG - Intergenic
1125849818 15:42892404-42892426 TGGACCTTTAATAAAATGTTTGG + Intronic
1127111307 15:55674166-55674188 TGCAGTTTTATTAAAATGTTTGG - Intronic
1127278207 15:57466153-57466175 TAGTCCTTTAAAAGAATGTTTGG - Intronic
1128757831 15:70195491-70195513 TGGACCTTTAACAGGATGTATGG - Intergenic
1129045058 15:72726468-72726490 TGGTCCCTTAATAGAATGTCTGG + Intronic
1129489003 15:75904802-75904824 TTGACCGTTCATCAAATGTTGGG + Intronic
1129490191 15:75917332-75917354 TGGATCCTTAATAAAATGAAAGG - Exonic
1129610365 15:77049743-77049765 TGGCCCTTTAAGAAAATGTTTGG - Intronic
1132788598 16:1672196-1672218 TGCACCTTTAATAAAATCCTGGG + Intronic
1134358803 16:13510530-13510552 TGGACCAGTAAGAAAATGTTTGG - Intergenic
1134913779 16:18052151-18052173 TGGCCCTTTAAGAAAATGTTCGG + Intergenic
1136138328 16:28272044-28272066 TGTACATTTAAAAATATGTTAGG - Intergenic
1136699976 16:32126071-32126093 TGGAACTTTAATAAATTGACTGG - Intergenic
1136767677 16:32801385-32801407 TGGAACTTTAATAAATTGACTGG + Intergenic
1136800473 16:33069312-33069334 TGGAACTTTAATAAATTGACTGG - Intergenic
1136958362 16:34813020-34813042 TGGAACTTTAATAAATTGACTGG - Intergenic
1138730710 16:59191430-59191452 TTGAACTTTATTAAATTGTTAGG + Intergenic
1140689444 16:77467595-77467617 TGGACCTTGAATAAATTGTATGG - Intergenic
1203070070 16_KI270728v1_random:1063418-1063440 TGGAACTTTAATAAATTGACTGG + Intergenic
1146221003 17:31020456-31020478 TGGACTTTTAAAAAAATGTTTGG + Intergenic
1147353645 17:39872974-39872996 TGGACCTTTATTGAAATGTTTGG + Intronic
1147992454 17:44343416-44343438 TGAAACTTTCATGAAATGTTAGG - Intergenic
1153163947 18:2240986-2241008 TGGACCTTTGATAAAAGTCTTGG + Intergenic
1153405527 18:4734433-4734455 TTGACCTGTAAGAAAATATTAGG - Intergenic
1153604039 18:6813502-6813524 TTGATCTTTAATAAAACTTTTGG + Intronic
1153675555 18:7453295-7453317 AGGAGCTTTACTAAAATGTACGG - Intergenic
1154517171 18:15184190-15184212 TGGAACTTTAATAAATTGACTGG + Intergenic
1156618017 18:38811123-38811145 TGTCACTTTGATAAAATGTTTGG + Intergenic
1156649277 18:39205255-39205277 TGCACTTTTCATAAAATGTTTGG + Intergenic
1157214942 18:45774926-45774948 AGGAACTTAAATATAATGTTGGG - Intergenic
1158178476 18:54685182-54685204 TAGACGTGGAATAAAATGTTGGG - Intergenic
1158532485 18:58276044-58276066 TGAGAATTTAATAAAATGTTTGG - Intronic
1159284024 18:66326235-66326257 TGGACATGCAATAAAATGATTGG + Intergenic
1159520464 18:69513910-69513932 TTAAAATTTAATAAAATGTTAGG + Intronic
1159733342 18:72060687-72060709 TGGAATTTTTAAAAAATGTTTGG - Intergenic
1159921243 18:74229145-74229167 TAGACCTTTGATACAATGGTTGG - Intergenic
1162196020 19:8985384-8985406 TGGAGGTTAAATAAAAAGTTAGG + Intergenic
1165250499 19:34529672-34529694 TGCACCTTTAATAAATTCATCGG + Intergenic
925775266 2:7329120-7329142 GGGATCTTTTATACAATGTTAGG + Intergenic
926005771 2:9372557-9372579 TGGGCCTTTATTCAAAAGTTTGG - Intronic
926562434 2:14433048-14433070 TAAACCTATAAGAAAATGTTTGG + Intergenic
926994732 2:18722222-18722244 TGGACTTTTCATTAAATATTTGG + Intergenic
928934922 2:36665929-36665951 TGGCCCTTTAAGGAAAAGTTTGG - Intergenic
928934934 2:36666198-36666220 TGGCCCTTTAAGGAAAAGTTTGG - Intergenic
928978705 2:37116460-37116482 TGGACTTTTAATACAATCTTAGG + Intronic
929612218 2:43279455-43279477 TAGAAATTTAATAAACTGTTAGG - Intronic
930479651 2:51930746-51930768 TGAACCTTTAAAAATATGTCAGG - Intergenic
930685255 2:54300742-54300764 AGGACTTTTAATAATTTGTTAGG + Intronic
932661377 2:73655982-73656004 TGCACCTTTGGTAATATGTTTGG + Intergenic
933038910 2:77435534-77435556 ATGACCTTTAAACAAATGTTGGG - Intronic
936606259 2:113958222-113958244 TGTGCCTTTATTAGAATGTTAGG - Exonic
937755990 2:125539482-125539504 TGGACCTCTAGTAAAATGCATGG - Intergenic
938737103 2:134196048-134196070 TACACCTTGAATAATATGTTGGG - Intronic
940189856 2:151029149-151029171 TGCTACTTTACTAAAATGTTGGG - Intronic
941124536 2:161569996-161570018 TGTAGCTTTAATTAAATTTTTGG + Intronic
942975118 2:182007702-182007724 TGGACCTATCAAAAAATGTAAGG + Intronic
943199778 2:184805765-184805787 TTGACATTTATTAAAATGTGAGG + Intronic
945869994 2:215217212-215217234 TGTACATCTAATTAAATGTTGGG - Intergenic
948234426 2:236377530-236377552 TGGACCTATAATTATATATTCGG + Intronic
948352114 2:237349539-237349561 TGGTCCTTTTATACAGTGTTAGG + Intronic
948736056 2:240005743-240005765 CTGACCTTTAATGAAATGGTGGG + Intronic
1170633210 20:18082876-18082898 TGGAACTCTAAGAAAATTTTGGG - Intergenic
1170926544 20:20729900-20729922 TGAAGCTTTAAAAAAAAGTTGGG + Intergenic
1176584014 21:8559113-8559135 TGGAAATTTAATAAATTGATTGG - Intergenic
1177035004 21:16031731-16031753 TGGACTTTTAAAAAAAGATTTGG + Intergenic
1177093272 21:16797823-16797845 TGGATCTTTAAAAAAATAGTGGG + Intergenic
1177098338 21:16867605-16867627 TAGACCAAAAATAAAATGTTAGG + Intergenic
1180266825 22:10536025-10536047 TGGAAATTTAATAAATTGATTGG - Intergenic
1181884875 22:26012695-26012717 TGGACCTTTTAGAAAATTTGAGG + Intronic
1182042115 22:27246259-27246281 TAGACCTTTAAGAAAACATTGGG - Intergenic
1183816941 22:40310035-40310057 TGCACTTTGAATAAAATTTTAGG - Intronic
949350905 3:3124285-3124307 AACAACTTTAATAAAATGTTAGG - Intronic
951608019 3:24458591-24458613 TTTACCATTTATAAAATGTTTGG - Intronic
951736631 3:25873413-25873435 TGGTTCTCCAATAAAATGTTTGG - Intronic
951841641 3:27040299-27040321 TGGATATTTAATTAACTGTTTGG + Intergenic
955353739 3:58213436-58213458 TGGACCTTTTAAAAAATGCCTGG + Intronic
955355847 3:58232003-58232025 TGGACCTTTAATAAGAGGTGAGG - Intergenic
955577549 3:60382534-60382556 TGGACATTTAAAAAAATTATCGG - Intronic
955590067 3:60525575-60525597 TGGCTCTTTAATAATATCTTGGG + Intronic
957487598 3:80882749-80882771 TGGTCATTTAAAAAAATGTGTGG - Intergenic
957829715 3:85500996-85501018 TGGATATTTAATAATATCTTTGG - Intronic
958499815 3:94890771-94890793 TGGAAGTGTAATAAACTGTTTGG - Intergenic
963304298 3:143633468-143633490 TGGAGCTTTAAAAAAATTTATGG - Intronic
964494571 3:157274419-157274441 TGGACCTTTAATAAAAATGGAGG + Intronic
964542508 3:157795252-157795274 TGGACCTTAATTAAAATTTGTGG + Intergenic
964901775 3:161668872-161668894 GGAACCATTAATAAAATGATAGG - Intergenic
965306392 3:167069516-167069538 TGTATGATTAATAAAATGTTAGG + Intergenic
965462477 3:168984269-168984291 TGCAACTTTAATAAATTGTATGG + Intergenic
967139602 3:186544110-186544132 TAAACCCTTAATAAAGTGTTCGG + Intronic
967244685 3:187473884-187473906 TAGACCTAAAATAAAATGTCTGG + Intergenic
968628842 4:1639916-1639938 TGCACTTTTAATAAAATCGTAGG - Exonic
971554320 4:27994008-27994030 ATGACATTTTATAAAATGTTAGG + Intergenic
974049022 4:56922887-56922909 TGACCCATTAATATAATGTTAGG + Intronic
974231517 4:59121561-59121583 TTTACCTTTTATAAAATGTATGG - Intergenic
975943650 4:79678449-79678471 TTAACATTTAGTAAAATGTTTGG - Intergenic
977262063 4:94809103-94809125 TGGACCTTTATAAATGTGTTTGG + Intronic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
979587009 4:122432348-122432370 TGGACCTTTGGTAAAAGGTTGGG + Intergenic
979841542 4:125448405-125448427 TGGAATTTAAATAAAATATTTGG - Intronic
979923684 4:126532828-126532850 TGCAGCTTAAATAACATGTTTGG + Intergenic
980274293 4:130629028-130629050 TGGACCTGTATCAAAATGTCTGG - Intergenic
980451322 4:132976053-132976075 TTAAGCTTTAATAAAATGATTGG + Intergenic
980515326 4:133850561-133850583 TGCACCTTTAATAAAATGAGAGG + Intergenic
980788730 4:137589995-137590017 TGGACACTTACTAAAATGGTAGG + Intergenic
981502401 4:145466283-145466305 TGGAGCTATAACAAAGTGTTAGG - Intergenic
981614311 4:146630972-146630994 TAGACATTTAAAAAAGTGTTGGG - Intergenic
982599432 4:157427687-157427709 AGGACATTTGATAAAATATTTGG - Intergenic
983090636 4:163497688-163497710 TGGACCTTTAGGATTATGTTGGG + Intronic
983161222 4:164417337-164417359 TGGACCTTTAAAAAATAGTCAGG - Intergenic
984398596 4:179231772-179231794 TAGACCTTTAAAAAATTGTTAGG + Intergenic
985584745 5:724742-724764 TGAAATTTTAATAAAATATTGGG - Intronic
985598248 5:809056-809078 TGAAATTTTAATAAAATATTGGG - Intronic
987018534 5:13846138-13846160 TGAACCTAAAATAAAAAGTTGGG - Intronic
987736765 5:21855885-21855907 TTTTCTTTTAATAAAATGTTAGG + Intronic
987768233 5:22264020-22264042 TGGTTCTTTAAAAAAATGATGGG - Intronic
988320422 5:29687673-29687695 TGGGCCTCTTATAAAATATTAGG + Intergenic
988684260 5:33512647-33512669 TGAATCATTAATAAACTGTTGGG - Intergenic
988822855 5:34904668-34904690 TGGACCTTTAATGCAGTGGTGGG - Intergenic
990336682 5:54779877-54779899 AGGACCTTCAGGAAAATGTTAGG - Intergenic
991081288 5:62603162-62603184 TGGATCTTTATTAAGAAGTTCGG - Intronic
991231443 5:64337374-64337396 TGAACCTTTAACAAAATATAAGG - Intronic
992979549 5:82154327-82154349 TGGCTCTTTAAGAAAATGTTTGG + Intronic
992979648 5:82155579-82155601 TGGCCCTTTAGAAAAATGTTTGG + Intronic
993669037 5:90738271-90738293 TGTAGCTATAATAAACTGTTAGG - Intronic
994527055 5:100918816-100918838 TAGAACTTTAATACAATGATGGG - Intergenic
995700232 5:114927687-114927709 TGGACCTTTTATAAAATGAAGGG - Intergenic
996998595 5:129729700-129729722 AGCACCTTTTATAAAATTTTGGG - Intronic
999221760 5:149985553-149985575 TGGTCATTTAAGAACATGTTAGG + Exonic
999699788 5:154217946-154217968 TGGACCTGAATAAAAATGTTGGG + Intronic
1001161895 5:169325784-169325806 AGGACCTCTAATACAATGCTGGG - Intergenic
1002437735 5:179242386-179242408 TGGCCCTTTAAAAAAAGATTAGG + Intronic
1003734717 6:8865743-8865765 TGTACCTTTAATTAAATATTGGG + Intergenic
1005095967 6:22116566-22116588 TGGAACTATAATAAAATGTTAGG + Intergenic
1005228736 6:23674178-23674200 TGGGCCTTTAATAACATGGGTGG + Intergenic
1005595644 6:27376385-27376407 TGAAACTTTAATAACATCTTGGG - Intronic
1009479055 6:64133250-64133272 TGGACATTTTTTAAAATGTCAGG + Intronic
1012799640 6:103808529-103808551 TTGAGTTTAAATAAAATGTTAGG + Intergenic
1015285050 6:131476969-131476991 TGGAACTTTATTTATATGTTAGG + Intergenic
1015406907 6:132847939-132847961 TGGACCTGTTATAAAATGTCAGG + Intergenic
1015875222 6:137815958-137815980 TGGACCTTTAATACCCTGTAAGG + Intergenic
1016006839 6:139098011-139098033 TGGACTTTTATTAATATGTCAGG - Intergenic
1016514332 6:144877618-144877640 TGTGGCTTTAAAAAAATGTTTGG - Intergenic
1016854576 6:148654267-148654289 TGAAACTTTAATAAAAAGATTGG + Intergenic
1017377931 6:153792398-153792420 TGGAACTTTGATGAAATATTTGG - Intergenic
1017961890 6:159230645-159230667 TGGATCTTTATTAACTTGTTTGG - Intronic
1019101776 6:169636778-169636800 TTCAGCTTTAATAAAATCTTTGG - Intronic
1021141762 7:17034232-17034254 TGGCCATTTAAAAAAGTGTTTGG + Intergenic
1021142772 7:17048040-17048062 TGAAGGTTTAATATAATGTTTGG - Intergenic
1021233912 7:18119156-18119178 TGGACCTTTTAGTAAATGGTAGG + Intronic
1022164768 7:27747540-27747562 TGGACCTATGATGAAATGATAGG + Intronic
1022329316 7:29362544-29362566 TGGACCTTGAATGACATGCTGGG - Intronic
1022451108 7:30516190-30516212 AGGATCTTTAAGAAAATGCTTGG - Intronic
1024369647 7:48566197-48566219 TGGAAATTAAATAAAATGTTTGG - Intronic
1025562692 7:62389254-62389276 TGGAACTTTAATAAATTGACTGG - Intergenic
1025622548 7:63187159-63187181 TGGATATTTACTAAAATCTTTGG - Intergenic
1025631840 7:63279584-63279606 TGGACCTTTAAGAAGATATCAGG - Intergenic
1025706395 7:63868934-63868956 TCCACTTTTATTAAAATGTTTGG + Intergenic
1026237527 7:68540615-68540637 TTGTCCTTTTATAAAATGGTGGG - Intergenic
1026277406 7:68892130-68892152 TGGACCTTTCATAAATGGCTTGG - Intergenic
1026386426 7:69853603-69853625 TGTACCTTTAATGAAATTATTGG + Intronic
1026733226 7:72929451-72929473 TGGAGGTTTAGTAAAATGATGGG + Intronic
1027895987 7:84045474-84045496 GGGACCTTTATAAAAATTTTTGG + Intronic
1032100937 7:128976922-128976944 TAGCCCTTTAAGAAAATGTTTGG - Intronic
1033910371 7:146256313-146256335 GGAACATATAATAAAATGTTAGG + Intronic
1035380050 7:158432148-158432170 TGGACCTTTAATGACGTGTGAGG + Intronic
1037086375 8:14855911-14855933 TCGGCCTTTAATGAAAAGTTGGG - Intronic
1037203655 8:16288161-16288183 TTGACCTTTAATACAATTATTGG - Intronic
1038404781 8:27313420-27313442 TGGAAGTTTATTAAAAAGTTTGG + Intronic
1038662851 8:29512026-29512048 TGGCCCTTTAAGAAAAAGTGTGG - Intergenic
1040706924 8:50139565-50139587 TGGACTTTTAATAAAATAGTTGG - Intronic
1041231072 8:55752618-55752640 TGAACATTTAATATAATGTGGGG - Intronic
1041936286 8:63335449-63335471 TGACCCCTTAATAAAATCTTTGG + Intergenic
1041979060 8:63834396-63834418 TGGACATTTAGATAAATGTTTGG + Intergenic
1042366607 8:67944135-67944157 TGTATCTTTAGTAAAAGGTTTGG - Intergenic
1044357291 8:91237776-91237798 AGGAGCTTTATTACAATGTTGGG - Intronic
1045718026 8:105071163-105071185 TGGACCAATGATAAAATGTGGGG + Intronic
1048915424 8:139178247-139178269 AGGACCTTTAATAGGATATTAGG + Intergenic
1050020347 9:1277532-1277554 TGGTCCTGTAATAGAATATTAGG - Intergenic
1054844283 9:69776135-69776157 TAGCCCTTTAATAAAAGGTTTGG - Intergenic
1055214603 9:73843410-73843432 TGAAGCTTTAATATGATGTTGGG - Intergenic
1055502945 9:76919938-76919960 TGGACCTTTAATCTAATGCCAGG + Intergenic
1055694782 9:78872086-78872108 GGGACCTGCAATAAAATCTTAGG - Intergenic
1055699066 9:78921376-78921398 TGGACCTTTAAAAAAACTTTTGG - Intergenic
1055870850 9:80877653-80877675 TGCAGCTTAAATAAAATGATAGG - Intergenic
1057519040 9:95746426-95746448 TGGACCTATAATAAATGGCTAGG - Intergenic
1058978118 9:110143546-110143568 TGCAACTTCAATACAATGTTTGG - Intronic
1060693344 9:125684728-125684750 TGGATTTTGAATAATATGTTAGG - Intronic
1062670220 9:137704450-137704472 TGGACATTTAAGATAGTGTTTGG + Intronic
1203613974 Un_KI270749v1:36973-36995 TGGAACTTTAATAAATTGACTGG - Intergenic
1186294712 X:8136220-8136242 TGGATTTTTAAGCAAATGTTGGG + Intergenic
1186971179 X:14845447-14845469 AGGACCTTTAAAAATGTGTTTGG - Intronic
1187168803 X:16830530-16830552 TTAACATTTAGTAAAATGTTGGG + Intronic
1187196943 X:17096064-17096086 AGGACATTTAATAAAACGTTGGG + Intronic
1187512308 X:19931743-19931765 TGTACCTTGCATATAATGTTAGG - Intronic
1189900152 X:45698130-45698152 TGAACATTTAAAAAAATATTTGG - Intergenic
1190124444 X:47691305-47691327 TTGAACTTTAAAAATATGTTTGG + Intergenic
1190640517 X:52479600-52479622 TGGTCCTTTATAAAATTGTTAGG + Intergenic
1190647155 X:52533265-52533287 TGGTCCTTTATAAAATTGTTAGG - Intergenic
1190938386 X:55016967-55016989 TGGACCTTGAAAAAAATCCTAGG + Intronic
1193682896 X:84542983-84543005 TGTACCTTTAATAATGTGCTTGG + Intergenic
1194197685 X:90915177-90915199 TGGCCATTTAATAAAAACTTTGG + Intergenic
1194453424 X:94073614-94073636 TGTACCTTTAATAAATTCATTGG + Intergenic
1196659757 X:118257416-118257438 TGGTACTTTAAGAAAATATTTGG - Intergenic
1198033329 X:132776856-132776878 TGGACCTTTAAAAAACTGAGTGG - Intronic
1198609293 X:138379846-138379868 TTGACATTTGATAAAAGGTTAGG + Intergenic
1198611052 X:138401083-138401105 TTGACATTTGATAAAAGGTTAGG - Intergenic
1199723108 X:150557431-150557453 TGGTCATTGATTAAAATGTTGGG + Intergenic
1200143811 X:153915400-153915422 TGGACTTTTAAAAAAAGGTGTGG - Intronic
1200544053 Y:4497636-4497658 TGGCCATTTAATAAAAACTTTGG - Intergenic
1201508011 Y:14725691-14725713 TGGACTTTTAATGAAATGAATGG + Intronic
1202328874 Y:23723723-23723745 TGAAACATTAATAAAATGTTAGG + Intergenic
1202331220 Y:23755276-23755298 CAGAACTTTTATAAAATGTTTGG - Intergenic
1202539549 Y:25914784-25914806 CAGAACTTTTATAAAATGTTTGG + Intergenic
1202541897 Y:25946331-25946353 TGAAACATTAATAAAATGTTAGG - Intergenic