ID: 1125851648

View in Genome Browser
Species Human (GRCh38)
Location 15:42909335-42909357
Sequence ATACTACTGACTTTGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125851648 Original CRISPR ATACTACTGACTTTGAAGGT GGG (reversed) Intronic
905151941 1:35936043-35936065 AGACAACTGAATTAGAAGGTAGG - Intronic
906968033 1:50479008-50479030 AGAATACTGACTTTGAGGGGAGG - Intronic
908344511 1:63218011-63218033 ATTCTCCAGACTTTGAAGTTGGG - Intergenic
908523688 1:64967683-64967705 AGACTACTGAATTTGAGGTTTGG + Intergenic
909174566 1:72339663-72339685 ATAATATTGACTTTGGAGCTAGG + Intergenic
909965886 1:81909814-81909836 ATGATACTGAATTTGAACGTGGG - Intronic
910672908 1:89791117-89791139 ATACTACTAATTTTCAATGTAGG - Intronic
911411473 1:97514006-97514028 ATTTTACTTACTTTGATGGTGGG - Intronic
914444409 1:147737783-147737805 ATACTACTAAGTTTGAAGACGGG + Intergenic
914770904 1:150683967-150683989 ATACATCTGTCTTTGAAGATAGG + Intronic
916576746 1:166073817-166073839 TTACTTCTGACCTTGAAGATTGG - Intronic
918950743 1:191133338-191133360 ATACTGCAGACTTAGAATGTGGG - Intergenic
921934004 1:220779311-220779333 ATCTTACTGATTCTGAAGGTAGG - Intronic
923155978 1:231279870-231279892 AGAGTACATACTTTGAAGGTTGG - Intergenic
923586179 1:235273978-235274000 ATACTACTCACTATGAACGCTGG + Intronic
1063506518 10:6605130-6605152 ATGCTGCTGGCTTTGAAGGTGGG - Intergenic
1063765419 10:9134756-9134778 ATATGACTGACATTGAAGGCTGG + Intergenic
1063994039 10:11599966-11599988 AGACTCCTTACTTTGAAAGTAGG - Intronic
1066422432 10:35275429-35275451 ATAATTCTCACTTTGCAGGTGGG + Intronic
1066931975 10:41774034-41774056 AAACTACTGAATTTGAGGGAAGG - Intergenic
1069174254 10:65270855-65270877 AAACTGCTGACTCTGAAGGCAGG - Intergenic
1069330166 10:67282740-67282762 TGACTACTGACTTTCAAGATTGG + Intronic
1069873053 10:71544795-71544817 ATCCGACTCCCTTTGAAGGTGGG - Intronic
1070575118 10:77671823-77671845 ATAATACTGACATGGAAGGAGGG - Intergenic
1071141903 10:82519377-82519399 ATTCAAATGACTTTTAAGGTTGG - Intronic
1072423131 10:95306352-95306374 ATACAACTGCTTTTGAAGGTTGG - Intergenic
1081410901 11:42757135-42757157 ACACTACTGACATTGTAAGTTGG - Intergenic
1082984974 11:59160738-59160760 ACACTGCTGGCTTTGAAGATGGG + Intergenic
1086169689 11:83822066-83822088 AAAATACTGACTTTGAAGCTGGG + Intronic
1091046405 11:132329679-132329701 ATACTACAGCATTTGAATGTAGG - Intronic
1091936950 12:4442050-4442072 ATGCTACTGAGGGTGAAGGTAGG + Intronic
1092491208 12:8947303-8947325 GTACTAATGAGTTTGAAGATGGG + Intronic
1093286065 12:17265216-17265238 ATATTAATTACTTTGTAGGTAGG + Intergenic
1094005794 12:25749332-25749354 ATATGACTGACTTTGAAGTCTGG - Intergenic
1094713697 12:32990492-32990514 TTACCACTGACTTTGAAGGAAGG + Intergenic
1095735161 12:45548224-45548246 ATGCTACTGGCTTTGAAGAACGG + Intergenic
1097383667 12:58923795-58923817 ATGATAATGAATTTGAAGGTTGG + Intergenic
1097480669 12:60121276-60121298 ATACTAGTGACTGTGAATGAAGG + Intergenic
1097766097 12:63528700-63528722 ATGCTACTGATTTTGTATGTTGG + Intergenic
1098011867 12:66061780-66061802 ATACGTCTAACTTTAAAGGTGGG - Intergenic
1098169127 12:67728464-67728486 ATAGTACTTACTTTGCAGGATGG - Intergenic
1098525559 12:71482784-71482806 AAACTACTGGCTTTGGAAGTAGG - Intronic
1098702847 12:73651193-73651215 ATGCTACTGATTTTGTATGTTGG - Intergenic
1098824864 12:75283418-75283440 ATATGACTGTATTTGAAGGTAGG + Intronic
1099126066 12:78759769-78759791 ACACTGCTGACCTTGATGGTGGG - Intergenic
1099705006 12:86140922-86140944 ATACCACTCACTTGGAAGTTGGG - Intronic
1100162996 12:91882668-91882690 AAACCACTGACGTTGAAGGTAGG - Intergenic
1101229458 12:102725124-102725146 GTACTCCTGGCTTTGAAGATGGG + Intergenic
1101770189 12:107742717-107742739 TTACCACTGAATTTGAAAGTGGG - Intronic
1102053257 12:109878682-109878704 ATAATACTGACTCTCCAGGTGGG - Intronic
1103507672 12:121452777-121452799 AGACTTCTGACTCTGAAGGCAGG + Intronic
1109809113 13:67486481-67486503 ATACTACTTTTTTTCAAGGTGGG - Intergenic
1113081700 13:106526872-106526894 ACACTTCTGGCTCTGAAGGTCGG + Intronic
1118917528 14:70120357-70120379 CAACTTCTGAGTTTGAAGGTGGG + Intronic
1121131504 14:91451870-91451892 ATACTACCAACCTTCAAGGTTGG + Intergenic
1121131505 14:91451876-91451898 TTACTACCAACCTTGAAGGTTGG - Intergenic
1122349964 14:101083431-101083453 ATGCTGCTGGCTTTGAAGATGGG + Intergenic
1125851648 15:42909335-42909357 ATACTACTGACTTTGAAGGTGGG - Intronic
1127465490 15:59240526-59240548 ATACTATTGACTTTTAAGTGAGG - Intronic
1130293045 15:82621672-82621694 AGACTGCTGACTTTTAATGTAGG - Intronic
1130896132 15:88171768-88171790 ACACCACACACTTTGAAGGTGGG - Intronic
1131608626 15:93936830-93936852 GTCCTACTGAATGTGAAGGTAGG + Intergenic
1132248026 15:100312305-100312327 CCACTGCTGACTTTGAAGGAGGG + Intronic
1133745302 16:8681948-8681970 ATACTACTGACGTGGAAGCGAGG + Intronic
1135384217 16:22021933-22021955 ATACTTCTTACCTTGAAGGGTGG + Intronic
1138609688 16:58112809-58112831 GTACTACTGGCCTTGAATGTAGG - Intergenic
1139246389 16:65448566-65448588 ATGTTGCTGACTTTGAAGATCGG + Intergenic
1140425803 16:74860180-74860202 ATTCTACTGCCTTGTAAGGTAGG - Intergenic
1143199060 17:5099427-5099449 ATTCCACTGACTCTGAAGGCAGG + Intergenic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1147504912 17:41006283-41006305 ATACTAATGAGGTAGAAGGTGGG - Intergenic
1148666147 17:49376505-49376527 TGACTGCTGGCTTTGAAGGTGGG + Intronic
1151022571 17:70634644-70634666 CAACTCCTGACTTTGAAAGTCGG + Intergenic
1153117667 18:1679141-1679163 ACACTGCTGGCTTTGAAGATGGG - Intergenic
1153638403 18:7133339-7133361 ATCCTTCTGGCTTTGAAGGGAGG - Intergenic
1154098399 18:11443216-11443238 AAATTAGTGACCTTGAAGGTAGG - Intergenic
1156122931 18:33866594-33866616 AAAATACTGAATTTGAAGCTTGG - Intronic
1158169314 18:54578364-54578386 TTACTTCTGACTGTTAAGGTGGG + Intergenic
1162857066 19:13476881-13476903 AAAGAACAGACTTTGAAGGTTGG - Intronic
1162857675 19:13481663-13481685 ATACAAGTGACGTTGAAGCTGGG - Intronic
1167712101 19:51118423-51118445 ATACTGGTGACTTTGCAGGCGGG + Intergenic
925967795 2:9082369-9082391 ACACTTCTGACTTTGAAAATGGG - Intergenic
926816078 2:16798810-16798832 ATACTTTTGTCTTTGAAGATTGG - Intergenic
927734333 2:25504956-25504978 TTACTACTAACTTTCAAAGTGGG + Intronic
927995969 2:27486568-27486590 TTACTTCTGACTTTGGAGATAGG - Intronic
931043370 2:58323109-58323131 AGGTTTCTGACTTTGAAGGTAGG - Intergenic
931274781 2:60734941-60734963 ATCATCCTGACTTTTAAGGTTGG + Intergenic
931461773 2:62456365-62456387 ATGCTGCTGGCTTTGAAGATGGG - Intergenic
933856074 2:86415767-86415789 ATGCTGCTGACTTTGAAGATGGG - Intergenic
934880518 2:97972814-97972836 ATGCTGCTGGCTTTGAAGGCAGG + Intronic
935538366 2:104321170-104321192 ATACAAATGACTCTGAATGTGGG + Intergenic
936463557 2:112728082-112728104 ATCCCACTGAGTCTGAAGGTGGG - Intronic
937351597 2:121167735-121167757 ATATTTCTGGTTTTGAAGGTCGG - Intergenic
938418263 2:131122639-131122661 ACAGTCCTGACTTTGAATGTAGG - Intronic
939845532 2:147241686-147241708 AAACTACTGTGTTTGAAGGAAGG + Intergenic
941680557 2:168393999-168394021 ATACTAATGCCTTGGAAGGTTGG + Intergenic
943520394 2:188942646-188942668 CTACTGCTGACTTTGAAGATGGG - Intergenic
943859674 2:192844897-192844919 CCACTACTGACTTTGATGGAAGG + Intergenic
944464986 2:199992061-199992083 ATTCAAATGACTGTGAAGGTAGG + Intronic
945984698 2:216344327-216344349 ATTCTACTGAATTTCATGGTGGG + Intronic
948075111 2:235160014-235160036 ATAGTACCAACTTTGAAGGGTGG - Intergenic
1169612452 20:7397306-7397328 ATACTACTTTCTTTCGAGGTAGG + Intergenic
1170380323 20:15752556-15752578 AAGGTCCTGACTTTGAAGGTTGG + Intronic
1173373811 20:42464074-42464096 GTACTACTGAACTTGGAGGTGGG + Intronic
1175834883 20:61987064-61987086 CTGCTGCTGACTTTGAAGCTTGG - Intronic
1176939478 21:14906523-14906545 ATACTACTGATTTTTTATGTCGG + Intergenic
1177007183 21:15688145-15688167 ATACTACTGACTTTTTAAATAGG - Intergenic
1177017395 21:15809399-15809421 TTCCTACTCACTTTGAAGTTAGG - Intronic
1177345485 21:19862902-19862924 ATACCCCTGAATTTGAAGGGAGG + Intergenic
1177984207 21:27952805-27952827 CTACTCCTGACTTTGAATTTAGG + Intergenic
1179931826 21:44575714-44575736 AGACTACTGATTTTGAAGCTAGG - Intronic
1182579506 22:31297367-31297389 TTAGTACTGACTTTTAAAGTAGG + Intergenic
1184543641 22:45149545-45149567 TTACTCCTTTCTTTGAAGGTTGG + Intergenic
1184963887 22:47952368-47952390 ACACTACTGACATTCTAGGTAGG + Intergenic
952697165 3:36279447-36279469 CTATTACTGACTTTGAAGATGGG + Intergenic
953202461 3:40789703-40789725 ATGCTGCTGACTTTGAAGAAGGG + Intergenic
957931417 3:86882719-86882741 ATATGACTGAATTTGAAGATAGG + Intergenic
957941752 3:87014767-87014789 ATACTACATACTCTGAAGGAGGG - Intergenic
958264252 3:91418973-91418995 ATGCTACTGATTTTTAAGGCTGG - Intergenic
958609096 3:96401211-96401233 ACACTGCTGACTTTGTGGGTTGG - Intergenic
959133577 3:102388975-102388997 ATACAACTGAGGGTGAAGGTTGG - Intronic
959960559 3:112293645-112293667 ATCTTACTGACTCTGAAGGTGGG + Intronic
961864045 3:129940697-129940719 GTACTACTAAATCTGAAGGTTGG + Intergenic
962380511 3:134894737-134894759 ATACACCTGACATAGAAGGTAGG + Intronic
963826340 3:149958368-149958390 CAACTACTGGCTTTGAAGATAGG - Intronic
965042213 3:163523572-163523594 ATAAATATGACTTTGAAGGTGGG + Intergenic
965221001 3:165925342-165925364 ATACTGCTGATTTTGAAGATGGG + Intergenic
965791374 3:172391735-172391757 ATACCTGTGACTTTGAAGATAGG + Intronic
966048076 3:175577647-175577669 ATACAAATGATTTTGATGGTGGG - Intronic
967730566 3:192903155-192903177 ATTCTGCTGACTTTGAAGACAGG - Intronic
970657228 4:18244786-18244808 ATGGTACTGACTTTCAATGTTGG + Intergenic
974396603 4:61344224-61344246 ATTCAAGTGACTTTGAAGGAAGG - Intronic
974790157 4:66677984-66678006 ATATTACTGATTTTGTATGTTGG - Intergenic
976045575 4:80942856-80942878 ATATTACTGACTTTTCAGTTAGG - Intronic
976447561 4:85149364-85149386 ATAATATTGAATTGGAAGGTGGG + Intergenic
976997547 4:91454354-91454376 ATACTGCTGGCTTTAAAGATGGG - Intronic
977121353 4:93105691-93105713 AGACTGCTGGCTTTGAAGATGGG - Intronic
978370880 4:108028724-108028746 ATACAACTGCCTTTCAAGGTAGG - Intronic
979010957 4:115367030-115367052 AGAATACTGGCTTTGAAGGATGG - Intergenic
979559241 4:122083505-122083527 AGGCTGCTGGCTTTGAAGGTGGG + Intergenic
984049064 4:174841451-174841473 ATGCTACTGTATTTGGAGGTAGG - Intronic
984789659 4:183603920-183603942 ATACTACTGCCTTTAATGATAGG - Intergenic
986287488 5:6370634-6370656 ATATTACTGATGTTGAAGCTGGG - Intergenic
987149607 5:15025486-15025508 ATTCTACTGACTTTGGAGAAAGG + Intergenic
989696824 5:44211654-44211676 ATAGTAGTGACTTTGGAAGTGGG + Intergenic
990750201 5:59006453-59006475 ATACTACTGAGGTGGGAGGTGGG + Intronic
991166856 5:63573271-63573293 ATACTACGGACTTTGAATAGTGG - Intergenic
991187869 5:63831704-63831726 ATACTATTTCCTTTGAAGGATGG - Intergenic
991617078 5:68508252-68508274 ATGCCACTGTCTATGAAGGTTGG + Intergenic
998070634 5:139195350-139195372 ATAATATTTACTTTGAAGGGTGG - Intronic
998096520 5:139398713-139398735 ATCCTACTGTCTTCAAAGGTTGG + Intronic
999180149 5:149664502-149664524 AGACTACTTACTTTGAGGGAGGG + Intergenic
1000305206 5:159988177-159988199 ACACTGCTGACTTTGAAGATGGG + Intergenic
1002852904 6:1012110-1012132 ATATTGCCGACTTTGAAGGAAGG - Intergenic
1003154253 6:3577938-3577960 ATAATACATACTTTGAAGGGTGG - Intergenic
1003737294 6:8890979-8891001 AAAATACTGTCTATGAAGGTGGG + Intergenic
1005491440 6:26351026-26351048 ATCTTGCTGACTATGAAGGTGGG - Intergenic
1005495231 6:26382413-26382435 ATGTTGCTGGCTTTGAAGGTTGG - Intergenic
1007983266 6:46180728-46180750 ATTCTACTGAATTTGAAGCTGGG + Intergenic
1008650340 6:53554940-53554962 ATACTACTGACATTTAGAGTAGG - Intronic
1008991186 6:57604008-57604030 ATGCTACTGATTTTTAAGGCTGG + Intronic
1009179711 6:60502246-60502268 ATGCTACTGATTTTTAAGGCTGG + Intergenic
1010646083 6:78389208-78389230 ATACTGCTGGCTTTGAAGATGGG - Intergenic
1010791689 6:80072357-80072379 ATACTCCTCATTTTGAAGATGGG + Intergenic
1010977404 6:82331459-82331481 AAAGCACTGACTCTGAAGGTAGG - Intergenic
1012087342 6:94845599-94845621 ATAGTACTGAATTTGAATTTTGG + Intergenic
1015804440 6:137094086-137094108 ATATTACAGACCTTGAAGATGGG + Intergenic
1015912045 6:138178819-138178841 ATCTTACTGACTGAGAAGGTCGG + Intronic
1016208364 6:141497916-141497938 ATACTACTCACTTTAAACTTTGG - Intergenic
1016546679 6:145231976-145231998 CTGGTTCTGACTTTGAAGGTGGG + Intergenic
1016917890 6:149262193-149262215 AAATTACTGACTTTGATGCTTGG - Intronic
1017678803 6:156842841-156842863 ATACTACTCACTTTGCCAGTGGG + Intronic
1019882321 7:3873684-3873706 AGACTACTGAACTTGAAGATGGG - Intronic
1020597116 7:10221009-10221031 ATCCTACTGACTTTAATGATAGG - Intergenic
1021161536 7:17279064-17279086 ACACAATTGACTTTGCAGGTTGG + Intergenic
1023754048 7:43399436-43399458 TTTCTACTGTTTTTGAAGGTTGG - Intronic
1025765927 7:64449949-64449971 GTGCTACTAATTTTGAAGGTTGG - Intergenic
1027809602 7:82878143-82878165 ATGTTACTGAATTTGAAGTTGGG + Intronic
1027943628 7:84717672-84717694 ATTCTGCTGGCTTTGAAGATGGG + Intergenic
1028662982 7:93303678-93303700 CTACTAATGACTTTCAAGGAAGG - Intronic
1029877125 7:103765963-103765985 TTGCTACTGACTCTGGAGGTGGG - Intronic
1031485788 7:122321849-122321871 TTACTACTGATTTTTAAAGTAGG + Intronic
1032810659 7:135412733-135412755 ATACTTCTCATTTAGAAGGTGGG - Intronic
1033915083 7:146314526-146314548 ATACTGCTCACTTTGAACCTGGG + Intronic
1035849612 8:2903035-2903057 ATACTACTGAACTGGAAGGCAGG + Intergenic
1036275490 8:7348294-7348316 AGACCACTGACTTTGAATGTTGG - Intergenic
1042259644 8:66844900-66844922 ATGCTACTGACTTAGAACATTGG + Intronic
1043888238 8:85627344-85627366 ATGCTACTGCCTTTGTATGTGGG - Intergenic
1043927011 8:86048703-86048725 AAACTACTGATTTTGGAGGCTGG - Exonic
1047761085 8:127955069-127955091 ATATGACTGGATTTGAAGGTAGG + Intergenic
1048247966 8:132830196-132830218 CCACTGCTGACTTTGAAGATGGG - Intronic
1049943921 9:576138-576160 CTACTGCTTACTCTGAAGGTGGG + Intronic
1051567448 9:18516603-18516625 AAACTACTGATTTTGAATATTGG + Intronic
1055323836 9:75107938-75107960 TTAATATTCACTTTGAAGGTTGG + Intronic
1056776336 9:89515895-89515917 CTACTACTGTCTTTGGATGTAGG + Intergenic
1057041127 9:91848242-91848264 TTAATACTGACCTTCAAGGTAGG - Intronic
1059604148 9:115815257-115815279 CTCTTACTGACTTTGAAGGTTGG - Intergenic
1059677310 9:116551595-116551617 AGACCACTGACTCTGAATGTTGG - Intronic
1059716982 9:116922106-116922128 TTACTACTTCCTTTGAAGGTGGG + Intronic
1060440805 9:123637248-123637270 AGATTACTGACTTTAAAGGGAGG + Intronic
1060502508 9:124172245-124172267 ATCTTACTGTCTTTGAAGATGGG + Intergenic
1060564432 9:124577423-124577445 GTATTACTGACTCTGAGGGTTGG + Intronic
1185922416 X:4108193-4108215 ACATTCCTGACTTTGAAGGTGGG + Intergenic
1186166930 X:6836564-6836586 ATATTGCTGACTTTGAAGATTGG - Intergenic
1188269426 X:28120279-28120301 ATACTACATACCTTGCAGGTGGG - Intergenic
1194336789 X:92658077-92658099 ATAATACTGACTTTGAATTTGGG + Intergenic
1194696977 X:97064607-97064629 ATAATTCTGAATTTGATGGTTGG - Intronic
1195121219 X:101754980-101755002 ATACTAGTTACTTTGAATGGTGG + Intergenic
1195201911 X:102559996-102560018 ATACTAGTGGTTTTGGAGGTGGG - Intergenic
1198939782 X:141940990-141941012 ATATCACAGACTTTGGAGGTAGG - Intergenic
1200645222 Y:5774817-5774839 ATAATACTGACTTTGAATTTGGG + Intergenic
1202261266 Y:22972836-22972858 ATACTTCTGGCTTAGAATGTAGG + Intergenic
1202414254 Y:24606577-24606599 ATACTTCTGGCTTAGAATGTAGG + Intergenic
1202456531 Y:25063509-25063531 ATACTTCTGGCTTAGAATGTAGG - Intergenic