ID: 1125854487

View in Genome Browser
Species Human (GRCh38)
Location 15:42935993-42936015
Sequence GTGGCAGTCTTGATGAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125854487_1125854494 22 Left 1125854487 15:42935993-42936015 CCTCCACTCATCAAGACTGCCAC No data
Right 1125854494 15:42936038-42936060 CCACAGAGACCAATGCTCTACGG No data
1125854487_1125854495 28 Left 1125854487 15:42935993-42936015 CCTCCACTCATCAAGACTGCCAC No data
Right 1125854495 15:42936044-42936066 AGACCAATGCTCTACGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125854487 Original CRISPR GTGGCAGTCTTGATGAGTGG AGG (reversed) Intergenic
No off target data available for this crispr