ID: 1125856609

View in Genome Browser
Species Human (GRCh38)
Location 15:42956078-42956100
Sequence GGTGCCAAAAAAGCCTAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125856600_1125856609 14 Left 1125856600 15:42956041-42956063 CCACTGCTTTAGAGTGGTTTGAT 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1125856609 15:42956078-42956100 GGTGCCAAAAAAGCCTAAGCGGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125856609 Original CRISPR GGTGCCAAAAAAGCCTAAGC GGG Intronic
919966680 1:202533701-202533723 GTGGCCAAAAATGCATAAGCTGG - Intronic
921677446 1:217991834-217991856 GGAACCAAAAAAGCCTAAAATGG + Intergenic
1069454288 10:68541444-68541466 GAAGCCAAAAAAGCCTAATTAGG - Intergenic
1070064431 10:73019167-73019189 GGTGCCTCAACAGCCTAGGCTGG - Intronic
1077903434 11:6509820-6509842 GTTGCCTAAAGGGCCTAAGCAGG + Intronic
1090915966 11:131162213-131162235 GGTGCCATGGAAGCCTAAGGTGG - Intergenic
1093851474 12:24045014-24045036 GGTTCCAAAAAAATCTGAGCAGG + Intergenic
1099613562 12:84907723-84907745 TGTTCCAGAAAAGCCTATGCAGG + Intronic
1105011456 12:132759760-132759782 ACTCCCAAAAAAGCCTAACCAGG + Intronic
1120578286 14:86212039-86212061 GGTGCCACAAAAGCAAAAACAGG - Intergenic
1122355783 14:101122149-101122171 GATCCCAAAATAGCCTCAGCTGG - Intergenic
1125856609 15:42956078-42956100 GGTGCCAAAAAAGCCTAAGCGGG + Intronic
1126858635 15:52862611-52862633 GGTGTCAACAGAGCCTTAGCAGG + Intergenic
1127900613 15:63338429-63338451 GATGCCAAGAAAGCCTAGGGAGG + Intronic
1132344046 15:101096934-101096956 GGTGCCAAAAAAGGCTGGGGAGG - Intergenic
1136912953 16:34159412-34159434 GGGGCCACCACAGCCTAAGCTGG - Intergenic
1139073656 16:63416061-63416083 GGAGCCAAATAAACCTATGCTGG + Intergenic
1141888906 16:86913329-86913351 GGTGCCATCAAAACCTAAGTTGG - Intergenic
1152376998 17:79924011-79924033 GGTGGCAGAAAAACCTAAGCTGG - Intergenic
1153618756 18:6956686-6956708 GCTGTCAGAAAGGCCTAAGCTGG - Exonic
1157755473 18:50213575-50213597 GGTGGCACAAAAACCTAAGGAGG + Intergenic
925783415 2:7405019-7405041 GGTGGCAATAAAACCTATGCAGG - Intergenic
928558476 2:32451295-32451317 AGGGCCAAAAAAGACTAAACGGG - Intronic
930071563 2:47369942-47369964 GGTTCCAAAACAGCCCCAGCCGG + Intronic
935782081 2:106517271-106517293 GATGTCAAAAATGCCTAGGCTGG - Intergenic
944093612 2:195942151-195942173 AGTGCCAAAAAAGTCAAAGGTGG + Intronic
944277324 2:197853772-197853794 GGTGCCATAAAAGCATAAAATGG - Intronic
944419220 2:199510853-199510875 GGTGCCAAAAAAGCATTTGATGG + Intergenic
1174034461 20:47659804-47659826 TGTGACAAAAAAGCATAAGATGG - Intronic
1179559716 21:42207682-42207704 GGTGTCAACAAAGGCTGAGCAGG - Intronic
1180312870 22:11253484-11253506 GGGGCCACCACAGCCTAAGCCGG + Intergenic
1184650209 22:45916176-45916198 GGGGCCAAAGAAGCCACAGCTGG - Intergenic
1184650228 22:45916247-45916269 GGGGCCAAAGAAGCCACAGCTGG - Intergenic
1184650245 22:45916318-45916340 GGGGCCAAAGAAGCCACAGCTGG - Intergenic
1184650262 22:45916389-45916411 GGGGCCAAAGAAGCCACAGCTGG - Intergenic
1184650279 22:45916460-45916482 GGGGCCAAAGAAGCCACAGCTGG - Intergenic
949095515 3:81020-81042 GCTGCCAAAAAAGGCCAAGTAGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
954425344 3:50440146-50440168 GGTGCACAAAAACCCTAATCTGG + Intronic
957313869 3:78552397-78552419 GGTGCTATAAAACCCAAAGCAGG + Intergenic
962482680 3:135811210-135811232 GTTGCCAGAAAAGCCAAAGGAGG + Intergenic
964562594 3:158014142-158014164 GGTGGGAAACCAGCCTAAGCTGG - Intergenic
965066315 3:163854963-163854985 TGGGCAACAAAAGCCTAAGCAGG + Intergenic
969456214 4:7301125-7301147 GCAGCCAGAAAGGCCTAAGCAGG - Intronic
974071657 4:57129522-57129544 GCTTCCAAAGAGGCCTAAGCAGG - Intergenic
974764170 4:66319749-66319771 GGTGCAAAAAAAGCAAAAGATGG - Intergenic
976449791 4:85175129-85175151 AGTGCAAAAAAAGCCTATGGAGG + Intergenic
978338775 4:107698906-107698928 GGTTCCAATAAAACCTCAGCAGG - Intronic
982913269 4:161172891-161172913 GGTGCAAAATAAAACTAAGCAGG - Intergenic
983476847 4:168222662-168222684 TGTGCCAAACAAGTCTCAGCAGG - Intronic
985131136 4:186739932-186739954 GCTGGCTAAAAGGCCTAAGCAGG - Intergenic
990015862 5:51062168-51062190 GGTGCCAAGAAAGCTCAATCGGG - Intergenic
991642812 5:68771376-68771398 GGTGCCAAAATGGTCTCAGCAGG - Intergenic
992221251 5:74575971-74575993 GGTACTCAAAGAGCCTAAGCCGG - Intergenic
994857772 5:105146627-105146649 TGTTCCAAAAAAGGCAAAGCTGG + Intergenic
996530809 5:124524986-124525008 GGTGGCTACAAAGCCTGAGCAGG - Intergenic
997837284 5:137205741-137205763 TGTGCCATAATAGCCTGAGCTGG + Intronic
1001155056 5:169265497-169265519 GATGCGAAAAAAGATTAAGCAGG - Intronic
1002878181 6:1229469-1229491 GGTGCCAACAGAGCCGAGGCTGG - Intergenic
1006203154 6:32314983-32315005 GATGCCAAAAGAGCCCAGGCAGG - Intronic
1006203876 6:32322022-32322044 GATGCCAAAAGAGCCCAGGCAGG - Intronic
1008588128 6:52967501-52967523 GGTGTCCAAAAAGCCTCAGCAGG + Intergenic
1013057668 6:106600146-106600168 GGTTCTCAAAAAGTCTAAGCTGG + Intronic
1016519630 6:144932095-144932117 AATGCCAAAAATACCTAAGCAGG + Intergenic
1016882038 6:148920989-148921011 GGTGCCAGAAATGCCTAATGAGG - Intronic
1022399918 7:30027250-30027272 GGGGCCAAACAACCTTAAGCAGG - Intergenic
1023570487 7:41566427-41566449 AGTGCCAAAAAAGAGTAGGCAGG - Intergenic
1029253005 7:99250401-99250423 GGGGCACAAAAAGCCTTAGCTGG + Intergenic
1031475196 7:122212624-122212646 GGGGGCAAAAAAGATTAAGCTGG + Intergenic
1033753818 7:144380708-144380730 GGTGTCATAAAAGTCTAAGGTGG + Intergenic
1038327747 8:26585443-26585465 GGTGCCAAGAAAGCTGAAACAGG - Intronic
1038499209 8:28029442-28029464 GGTGCCAAAGATTTCTAAGCAGG - Intronic
1044722833 8:95167523-95167545 GGTCCCAAAGTAGCCTAAGGAGG - Intergenic
1047360746 8:124166670-124166692 GGTGTCAGAAAAGCCCAAGTAGG - Intergenic
1047542843 8:125787111-125787133 GGTCCCAAGAAAGCAAAAGCAGG - Intergenic
1054906320 9:70417064-70417086 GCTGGCAAAACAGCCCAAGCCGG - Intergenic
1059736714 9:117107702-117107724 GCTGCCAATAAAGCTGAAGCAGG - Intronic
1061511939 9:131067000-131067022 GGTGCCCAAAGAGCCCCAGCGGG - Exonic
1187173286 X:16871182-16871204 GGTGACAAAAATGACTCAGCAGG - Intergenic
1189149951 X:38696266-38696288 GATGCCAAAAAAGTCTTGGCTGG - Intergenic
1190904150 X:54709588-54709610 GGTGTCAAAAGAGCCTACGAAGG - Intergenic
1192306759 X:69968502-69968524 GAGGCCAAAATAGCCTAAGGGGG + Intronic
1201077085 Y:10196597-10196619 GGGGCCACCACAGCCTAAGCGGG - Intergenic