ID: 1125873415

View in Genome Browser
Species Human (GRCh38)
Location 15:43123055-43123077
Sequence CGATGCTGGTGAGCTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125873415_1125873423 20 Left 1125873415 15:43123055-43123077 CCAGTTCCAGCTCACCAGCATCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1125873423 15:43123098-43123120 AGGAGGTATCATCATATCATGGG 0: 1
1: 0
2: 1
3: 15
4: 94
1125873415_1125873424 28 Left 1125873415 15:43123055-43123077 CCAGTTCCAGCTCACCAGCATCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1125873424 15:43123106-43123128 TCATCATATCATGGGCTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1125873415_1125873422 19 Left 1125873415 15:43123055-43123077 CCAGTTCCAGCTCACCAGCATCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1125873422 15:43123097-43123119 TAGGAGGTATCATCATATCATGG 0: 1
1: 0
2: 0
3: 5
4: 77
1125873415_1125873421 3 Left 1125873415 15:43123055-43123077 CCAGTTCCAGCTCACCAGCATCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1125873421 15:43123081-43123103 CCTCACACTCAGTGTTTAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 92
1125873415_1125873419 0 Left 1125873415 15:43123055-43123077 CCAGTTCCAGCTCACCAGCATCG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1125873419 15:43123078-43123100 GCTCCTCACACTCAGTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125873415 Original CRISPR CGATGCTGGTGAGCTGGAAC TGG (reversed) Intronic
903381561 1:22900569-22900591 CCATTCTGCTGAGCTGGAATGGG + Intronic
905426081 1:37885774-37885796 AGATGCTGGTGTTGTGGAACTGG + Exonic
906662377 1:47592415-47592437 CGCTGCAGGTGAGCTGTAGCTGG - Intergenic
908655142 1:66380568-66380590 CAATGCTGGTGAGGTGGCACAGG + Intergenic
912506064 1:110157199-110157221 CGATGATGGTGATATGGATCAGG - Intronic
915556031 1:156661264-156661286 CCATGGTGGTGAGCTGGAAGGGG + Intergenic
916900831 1:169221195-169221217 AGATGATGGTGAGTTGGACCAGG - Intronic
918337108 1:183527654-183527676 CTATGCTGGTGACCTGGAGCCGG - Intronic
920181434 1:204134369-204134391 CGCTGGAGATGAGCTGGAACGGG + Intronic
920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG + Intergenic
1066640615 10:37551082-37551104 GGATGCGGGTGAGAGGGAACAGG + Intergenic
1067582860 10:47456431-47456453 CGATGCAGTCCAGCTGGAACTGG + Intergenic
1067737909 10:48873173-48873195 CCATGCTGATGAGCTGCTACAGG + Intronic
1069727064 10:70586838-70586860 TGATGCTGGGGAGCTGAAGCTGG + Intergenic
1070378540 10:75858150-75858172 CACTGCTGGTGGGCTGGTACGGG - Intronic
1075650345 10:124123927-124123949 CCATGCTGGTGAGCTGGAAGGGG - Intergenic
1077004228 11:344229-344251 GGAAGCTGGAGAGATGGAACGGG - Intergenic
1077159639 11:1106844-1106866 CGATGCTGGTGAGCAGGTAATGG + Intergenic
1083434070 11:62630750-62630772 CGAGGCTGATGTGCTGGAAGTGG - Exonic
1083844089 11:65321141-65321163 CGGTGCGGGTGAACTGGAAGGGG - Exonic
1086445951 11:86870457-86870479 AGATGGGGGTGAGCTAGAACAGG + Intronic
1090776939 11:129974041-129974063 AGCTGCTGGTGAGCTGGAGGCGG - Intronic
1093308076 12:17544163-17544185 GTATGCTGGTGAGGTGGATCGGG + Intergenic
1100335292 12:93623506-93623528 CCATGCTGGTGTGCTGCACCGGG + Intergenic
1104543857 12:129693567-129693589 CGGTGCTGGTGAGGTGGGATAGG + Intronic
1107991451 13:45822114-45822136 TGATGCTGGGGAGCTTGGACTGG - Intronic
1108259780 13:48645056-48645078 CCATGCTGGTGAGGTGCAATGGG - Intergenic
1108711849 13:53040978-53041000 AGATGCTGGTGAGATGGCAGAGG + Intronic
1116472295 14:45299768-45299790 TGATCCTGATTAGCTGGAACAGG + Intergenic
1122744517 14:103889965-103889987 TGATGCTGATGAACTGCAACTGG - Intergenic
1124918721 15:34002446-34002468 TGATGCTGGAGAGCAGTAACAGG - Intronic
1125873415 15:43123055-43123077 CGATGCTGGTGAGCTGGAACTGG - Intronic
1127720866 15:61698016-61698038 CAATGCTGGAGAGATGGAAATGG - Intergenic
1128734913 15:70048000-70048022 CGATGCTGGGTATCTGGAAGGGG + Exonic
1130859632 15:87874952-87874974 CGAGGCTGGTTAGCTGGACTGGG - Intronic
1132073825 15:98802367-98802389 TCATGGTGGTGAGCTGGAGCAGG + Intronic
1132598219 16:762743-762765 CGAGGCTGAAGAGCAGGAACAGG - Exonic
1134181128 16:12048613-12048635 CAGTGCTGGTGAGTGGGAACGGG + Exonic
1135307864 16:21382368-21382390 CAGTGCTGGTGAGTGGGAACTGG + Intergenic
1136304609 16:29361488-29361510 CAGTGCTGGTGAGTGGGAACTGG + Intergenic
1136319639 16:29475166-29475188 TGAAGTTGGTTAGCTGGAACAGG - Intergenic
1136434210 16:30214510-30214532 TGAAGTTGGTTAGCTGGAACAGG - Intergenic
1136867891 16:33770967-33770989 CGATCCGGGAGAGCTGGACCAGG - Intergenic
1137058210 16:35755369-35755391 GGGTGCAGGTGAGCTGGAAATGG - Intergenic
1138502763 16:57458287-57458309 CCATGCTGGTGAGCAGGCTCAGG - Exonic
1139195573 16:64914957-64914979 AGATGCTGGTGAGCAGGGAATGG - Intergenic
1145710051 17:26963263-26963285 CGAGCCTGGAGAGCTGGACCAGG - Intergenic
1152158389 17:78650225-78650247 GGCTGCTGGTCAGCTGGAAACGG + Intergenic
1203192365 17_KI270729v1_random:200680-200702 CGAGGCGGGAGAGCTGGACCAGG - Intergenic
1203201730 17_KI270730v1_random:117-139 CGAGGCGGGAGAGCTGGACCAGG - Intergenic
1157500185 18:48185105-48185127 AGATGCTGGTGAGGTTGGACAGG - Intronic
1160367314 18:78337508-78337530 GGATGCAGGTGCGCTGGAACTGG - Intergenic
1165454518 19:35902924-35902946 CCAGGCTGGAGAGATGGAACAGG - Intronic
1165498572 19:36169325-36169347 AGATGATGGTGGGCAGGAACTGG - Intergenic
927071699 2:19537063-19537085 CATTGCTGGTGAGCTGGTATGGG - Intergenic
927825857 2:26309884-26309906 CACTGGTGGGGAGCTGGAACCGG + Intronic
929093130 2:38239561-38239583 CGAGGCTGGCTTGCTGGAACCGG - Intergenic
934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG + Intergenic
935165066 2:100563066-100563088 AGATGCAGGTGAGCTAGGACGGG + Exonic
935225957 2:101053338-101053360 CAAGGCTGGCGAGCTGGAAAAGG + Intronic
935501670 2:103848656-103848678 AGATGCTGGTGAGATTGAAAAGG + Intergenic
939533821 2:143399522-143399544 AGTTGCTGGTGAGTTGGAAAAGG + Intronic
942958698 2:181804223-181804245 AGCTGCTGGGGAGCTCGAACTGG - Intergenic
948132916 2:235614141-235614163 TGGTGCTGGTGAGCAGAAACAGG + Intronic
1168949890 20:1790063-1790085 TGAGGCTGGAGAGATGGAACGGG + Intergenic
1178092084 21:29174757-29174779 GGATGCTGCTGAGCTGGTTCGGG + Exonic
1179251451 21:39674481-39674503 TGATGCTGCTGAACAGGAACTGG - Intergenic
1183986812 22:41574715-41574737 CGATGCTGGCGGGCAGGAAGAGG - Exonic
1185040286 22:48500531-48500553 CGATGCTGCTGAGGAGGAAGGGG + Intronic
952595627 3:35014410-35014432 CCATGCTGGTGTGCTGCACCCGG + Intergenic
952667377 3:35922828-35922850 CCATCTTGGTGACCTGGAACTGG - Intergenic
952700067 3:36318301-36318323 CAATGCTAGTCAGCTGGATCAGG + Intergenic
961380537 3:126493855-126493877 AGTTGCTGGTGAGCTCGACCAGG + Intronic
962008107 3:131368540-131368562 AGATGGTGGTGATCTGGAGCAGG + Intergenic
963597103 3:147342087-147342109 TGATGCTGTGGAGCTGAAACAGG + Intergenic
964183035 3:153910595-153910617 TAAAGCTGGTGATCTGGAACAGG - Intergenic
965902680 3:173662146-173662168 CAATGCTTGTGAGCTGAAAGAGG - Intronic
967187987 3:186961657-186961679 TGAGGCTGGTCAGCTGGAAAGGG + Intronic
969268218 4:6080062-6080084 TGATGCTGCTGAGCTGGGTCAGG - Intronic
970580670 4:17471493-17471515 TGATGCTGGAGAGGTGGAAGAGG + Intronic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
975526577 4:75357336-75357358 CCATGTTGGTGTGCTGGAAGAGG - Intergenic
975585158 4:75941226-75941248 CCAAGCAGGTGCGCTGGAACCGG - Intronic
975654667 4:76629593-76629615 AGATGCTGGTGACTTGGACCTGG + Intronic
976473647 4:85457951-85457973 AGATGCTGGAGAGCTGGGACAGG - Intergenic
976921853 4:90452261-90452283 CGAAGCTGGGGAGCTTGAACAGG - Intronic
979296596 4:119039648-119039670 TGATGCTGGTTGGCTGGAAGCGG - Intronic
980816843 4:137958823-137958845 AGATGCTGGTGACCTAGACCAGG - Intergenic
988044278 5:25929636-25929658 CGAGGATGGTGAACTGGGACTGG + Intergenic
992106626 5:73453410-73453432 AGAGGCTGCTGACCTGGAACAGG - Intergenic
997780952 5:136657936-136657958 AGATGCTGGTGAATTGGAACTGG + Intergenic
999211878 5:149896696-149896718 AGATCCTGGTGAGCTGAACCGGG - Exonic
1001436512 5:171703514-171703536 GGAGGCTGGAGAGCTGGGACTGG - Intergenic
1013198151 6:107864122-107864144 CACTGCTGGTGAACTGGAGCTGG - Intergenic
1019527625 7:1487767-1487789 CCAGGCTGGTGAGCTGCGACAGG + Exonic
1020070296 7:5223027-5223049 CGGAGCTGGAGAGCTGGAACAGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023409695 7:39877358-39877380 AGATGCTGGTGAGGTTGTACAGG - Intergenic
1024756377 7:52537951-52537973 CCATGGTGGTGAGATGGAAAGGG + Intergenic
1032642404 7:133784521-133784543 CGTTGCTGGTGAGCTCCATCAGG + Intronic
1034456497 7:151173849-151173871 CGTTGCTGGGGAGATGGCACTGG - Intronic
1039604229 8:38867529-38867551 GGATGCAGGTGAGAGGGAACAGG + Intergenic
1039726790 8:40226615-40226637 CCATGCCACTGAGCTGGAACAGG + Intergenic
1047986044 8:130234756-130234778 CTATGCTTGTGAGCTGCAAAAGG - Intronic
1048377337 8:133834154-133834176 CGTTGTTGGTGAACTGGCACTGG + Intergenic
1049698032 8:143993208-143993230 CCAGGCTGGGGAGCTGGGACAGG - Exonic
1049747078 8:144267459-144267481 GGAGGCTGGGGAGCTGGACCAGG + Intronic
1052247581 9:26355304-26355326 CAATGCTGGTTATCAGGAACTGG + Intergenic
1058139075 9:101339167-101339189 TGAGGCTGGTGAGGTGGACCTGG - Intergenic
1060274450 9:122171846-122171868 AGATGATGGAGGGCTGGAACAGG - Intronic
1062116629 9:134812935-134812957 AGATGCTTGTGAAATGGAACTGG + Intronic
1197707018 X:129641299-129641321 CCAAGCAGGTGTGCTGGAACAGG + Intergenic
1201142857 Y:11042823-11042845 CGTTGCTGGCTGGCTGGAACAGG + Intergenic