ID: 1125874771

View in Genome Browser
Species Human (GRCh38)
Location 15:43134018-43134040
Sequence CAGATCGGGCACCGTGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125874767_1125874771 -9 Left 1125874767 15:43134004-43134026 CCGGGAGGCAGGTGCAGATCGGG 0: 1
1: 0
2: 7
3: 29
4: 263
Right 1125874771 15:43134018-43134040 CAGATCGGGCACCGTGCGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1125874758_1125874771 19 Left 1125874758 15:43133976-43133998 CCTGCAGGTGACGCGGCGGGAAG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1125874771 15:43134018-43134040 CAGATCGGGCACCGTGCGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1125874765_1125874771 -4 Left 1125874765 15:43133999-43134021 CCGGGCCGGGAGGCAGGTGCAGA 0: 1
1: 0
2: 1
3: 35
4: 476
Right 1125874771 15:43134018-43134040 CAGATCGGGCACCGTGCGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125874771 Original CRISPR CAGATCGGGCACCGTGCGGT GGG Intronic
900433190 1:2612469-2612491 CACATCGGGGACCTTGGGGTGGG - Intronic
1070754049 10:78980724-78980746 AAGATGGGGCAGCGAGCGGTGGG - Intergenic
1073103477 10:101019113-101019135 CAGCTCGGGCTCCCTGCCGTCGG - Exonic
1080568688 11:33536254-33536276 CAGACAGGGCACAGTGCGGATGG + Intergenic
1096256574 12:50065490-50065512 CACATGGGGCACCGTGGGCTTGG - Intronic
1114458876 14:22874336-22874358 CACATCTGGCACAGTGGGGTGGG + Intronic
1125874771 15:43134018-43134040 CAGATCGGGCACCGTGCGGTGGG + Intronic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1141167543 16:81670374-81670396 CCTATCGGGCACCGTGCAGTAGG - Intronic
1141426787 16:83949432-83949454 CAGACCAGGCACCGTGGGATGGG + Exonic
1144952994 17:19004107-19004129 CAGCTGGGGCACCGCGCGCTCGG + Exonic
1150643920 17:66966289-66966311 CAGATCGGGGACCGGGTGGAGGG + Intronic
1160139523 18:76309234-76309256 CAGATCAGGCACCCTGAGGTGGG - Intergenic
1161307040 19:3573990-3574012 CAGAGCTGGCATTGTGCGGTGGG - Intronic
925998651 2:9312469-9312491 AAGATGGGGCATCGTGAGGTGGG - Intronic
1176193748 20:63826977-63826999 CAGGTCTGGAACCGTGCGGGTGG + Intronic
1179486909 21:41716372-41716394 CAGATGGGGGCCCCTGCGGTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1029582657 7:101447719-101447741 CAGCACCGTCACCGTGCGGTAGG - Exonic
1035567412 8:650625-650647 CAGAGCCGGCACCGTGCCATAGG + Intronic
1041031257 8:53737596-53737618 CAGATCTGATACCGTGTGGTGGG + Intronic
1050359433 9:4815501-4815523 CAGATCTGGCCCAGTGGGGTGGG + Intronic
1192634429 X:72804300-72804322 GAGATTGGGCACTGTGTGGTGGG + Intronic
1192647281 X:72916501-72916523 GAGATTGGGCACTGTGTGGTGGG - Intronic
1194415495 X:93606556-93606578 CACCTCGGGCACAGTGAGGTAGG + Intergenic