ID: 1125878297

View in Genome Browser
Species Human (GRCh38)
Location 15:43168778-43168800
Sequence CTGCAGTCCTTGGGCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125878297_1125878302 13 Left 1125878297 15:43168778-43168800 CCAGATTTGCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1125878302 15:43168814-43168836 ACTGCCTTTCAAGTTTATTCAGG 0: 1
1: 93
2: 208
3: 305
4: 395
1125878297_1125878305 22 Left 1125878297 15:43168778-43168800 CCAGATTTGCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1125878305 15:43168823-43168845 CAAGTTTATTCAGGACCCTAGGG 0: 1
1: 1
2: 9
3: 24
4: 140
1125878297_1125878304 21 Left 1125878297 15:43168778-43168800 CCAGATTTGCCCAAGGACTGCAG 0: 1
1: 0
2: 6
3: 15
4: 140
Right 1125878304 15:43168822-43168844 TCAAGTTTATTCAGGACCCTAGG 0: 1
1: 2
2: 11
3: 29
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125878297 Original CRISPR CTGCAGTCCTTGGGCAAATC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
903226136 1:21895082-21895104 AGGCAGGCCTTGGCCAAATCTGG - Intronic
903286832 1:22282565-22282587 CTGCAGAACTTGGGCAATTTGGG + Intergenic
904292261 1:29495524-29495546 CTGGGGTCCTTGGAGAAATCTGG - Intergenic
905466789 1:38160647-38160669 CTGCAGGCCATGGGGAATTCAGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
910113705 1:83709458-83709480 CTGCATTAGTTGGGGAAATCTGG + Intergenic
911883043 1:103265863-103265885 CTGCAGTCATTGAGGAAGTCAGG - Intergenic
916262804 1:162859548-162859570 CTGCAGTCTTTGGTCCAGTCTGG + Exonic
920227941 1:204451389-204451411 CTTCAGTCCTTGGGTATATCTGG + Intronic
922221579 1:223612350-223612372 GTGCAGTCCTGGGGCAACTGAGG + Intronic
922514556 1:226197271-226197293 CTGCAGAGCTGGGGCAAACCTGG + Intergenic
923042275 1:230327743-230327765 CGGCAGTCCTTGGGCACTGCAGG - Intronic
1063042053 10:2352038-2352060 CCGCAGACCTTGGACAAAGCTGG + Intergenic
1064271480 10:13870158-13870180 GAGCAGCCCTTGGGCAGATCTGG + Intronic
1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG + Intergenic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1071523507 10:86345362-86345384 CACCAGGCCTTGGGCAAATTTGG + Intronic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1084509117 11:69592157-69592179 CTGCAGTCACTGGGCAATTGGGG - Intergenic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1086054418 11:82630191-82630213 CTGCACTCTTTGGGCAGATAGGG - Intergenic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1090657964 11:128860201-128860223 ATGCAGTGCTTGGGAGAATCCGG + Intronic
1091636844 12:2203573-2203595 CTGCAGTCCTATGGCCAAGCCGG + Intronic
1092288472 12:7143766-7143788 TGGCAGTCCTAGGCCAAATCTGG + Intronic
1092836930 12:12499245-12499267 ATGCATTCCTAGGGCAAAGCTGG - Intronic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1096599482 12:52719130-52719152 ATGCAGGCCTTGGGCTAAACTGG - Intergenic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1100608324 12:96170002-96170024 CTCCAGCCCTTGGCCACATCTGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102175648 12:110872307-110872329 CTCCAGCCCTTGGTCAAATCTGG - Intronic
1106135237 13:26968623-26968645 CTGCAGTCCTTGGGGACTCCTGG - Intergenic
1106958668 13:34973074-34973096 CTGCAGTCCTTAGTCATTTCGGG + Intronic
1108609406 13:52069501-52069523 CTGAAGGCCTGGGGCATATCAGG - Intronic
1110514072 13:76387771-76387793 GTGCAGACATTGGGCAATTCTGG - Intergenic
1110644944 13:77871762-77871784 CTGGAGTACCTGTGCAAATCAGG - Intergenic
1113121162 13:106924942-106924964 CTGCAGTCCTTGGCCACCCCAGG - Intergenic
1114246328 14:20917956-20917978 CTGGAGTCCTTAGGTAAATGTGG - Intergenic
1116257041 14:42570411-42570433 CTTCAGTCCTTTGGCAAATTTGG + Intergenic
1121113790 14:91330040-91330062 TGGCAGTCCCTGGGCAAACCCGG - Intronic
1122027127 14:98886188-98886210 CTGCAGTGCATGGGCAGAGCAGG - Intergenic
1125215827 15:37273264-37273286 ATGCAGTTCTTAGGCATATCTGG + Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126639665 15:50812076-50812098 CTGCAGTCCCTGGGCAATGAGGG + Intergenic
1127802367 15:62488296-62488318 CTGTACTCCTTCGGCAGATCAGG - Intronic
1131798738 15:96047552-96047574 CTGGAATCCGTGGGCAATTCTGG + Intergenic
1133841425 16:9413260-9413282 ATGCAATGCTTGGGCAACTCCGG - Intergenic
1134487482 16:14669977-14669999 CCCCAGTCCCTGAGCAAATCTGG - Intergenic
1135530004 16:23245216-23245238 CTCCATCCCTTGGGCAAATTGGG + Intergenic
1140468127 16:75198295-75198317 CTGCAGTCCTGGAGGGAATCTGG + Intergenic
1141667957 16:85475597-85475619 CTGCAGTGCCTGGGCAATTCTGG + Intergenic
1142102650 16:88283831-88283853 CTGCAGACCTTGGGCACACTGGG - Intergenic
1142134136 16:88443931-88443953 CTGCAGTCTTGGGGCAAACTGGG - Intergenic
1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG + Intronic
1143198062 17:5091786-5091808 CTGCAGTCCCAGCCCAAATCTGG + Exonic
1145102094 17:20085984-20086006 CTTCACTCCTTGGGGACATCAGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145311755 17:21704684-21704706 CTGCAGTCCCTGGGCAAGCAGGG + Intergenic
1148047054 17:44750699-44750721 CTGGAGCCCTTGGGCAAGGCCGG - Exonic
1151153976 17:72111517-72111539 CTGCAGTCCCTGGGGCCATCTGG + Intergenic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1155184743 18:23377223-23377245 CTGCAGTCCTGGGCCATAGCAGG - Intronic
1159963920 18:74577914-74577936 CTGCAGATCTTGGGCAAAGAGGG + Intronic
1165001597 19:32767870-32767892 CTGCAGCCATGGGCCAAATCTGG + Intronic
1166981006 19:46631961-46631983 CTCCAGCCCTTGGGCCAACCAGG + Intergenic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
1168423065 19:56217724-56217746 CTGCAGTCCTTGGGGAAGCGGGG + Intergenic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
929994821 2:46818653-46818675 CTTCAGGCCCTGGGCAAATGTGG + Intronic
931254751 2:60560619-60560641 GTACAGTCCTTGGGTAACTCAGG - Intergenic
931416213 2:62083443-62083465 CTTCAGCCCATGGGCAAGTCTGG - Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
934649872 2:96084700-96084722 CTGCACTGCTTTGGCTAATCCGG + Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941448943 2:165635462-165635484 CTACAGTCTCTGGGCTAATCAGG + Intronic
941946720 2:171106956-171106978 CTCCAGTCCAGGTGCAAATCAGG + Intronic
944594334 2:201247430-201247452 CTGCAGCCCCTGGGGAAATGTGG - Intronic
945901318 2:215540761-215540783 CTTCAGTCCTTGCCCAAATATGG + Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
1171053430 20:21883128-21883150 CTGCACTCCTTGGGCAATGGTGG + Intergenic
1173255484 20:41391900-41391922 CTGCAGCCCTTGGGCAGATGTGG + Intergenic
1173836217 20:46127990-46128012 CCGCGGTCCTTGGGGAAATGTGG - Intronic
1177009607 21:15716095-15716117 CTGCAGTCCTTGGGGATGTATGG + Intergenic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1179614618 21:42573872-42573894 CAGCAGTCCTTGGGCATTTAGGG + Intronic
1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG + Intergenic
1184366185 22:44052992-44053014 CTGCAGCCAGTGAGCAAATCTGG - Intronic
949202463 3:1395350-1395372 GTGCAGCCCTTGAGCACATCTGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG + Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG + Intronic
966552338 3:181219225-181219247 GTCCAGGCCTTGGGCAAATCTGG + Intergenic
969210106 4:5680905-5680927 CTGCAGGCTTTGGGAAGATCTGG + Intronic
971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG + Intergenic
973729020 4:53805249-53805271 CTCAAGTCCATGGGCAAGTCTGG - Intronic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
976152472 4:82105974-82105996 CTGGAGAACTTGTGCAAATCAGG + Intergenic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
978671866 4:111257630-111257652 CTGCCTTTCTTGGACAAATCAGG + Intergenic
982798080 4:159669034-159669056 CTACAGTCTTTGGGCAATCCTGG - Intergenic
982932604 4:161428301-161428323 CTGCAATTCTTGGGCACATCTGG + Intronic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
986033601 5:3916816-3916838 CTGCAGACCATGGGCAAAGTAGG + Intergenic
986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG + Intergenic
986815617 5:11406275-11406297 TGACAGTCCTTGGGCACATCTGG + Intronic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
998767481 5:145504035-145504057 CTCCAGCACTTGGGCAAATTGGG - Intronic
999378853 5:151105959-151105981 CTGAAAGCCTTGCGCAAATCAGG + Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1003017809 6:2482065-2482087 CTGCACCCCTTGAGCACATCGGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1005949812 6:30623566-30623588 CTACAGTCACAGGGCAAATCTGG + Intronic
1007939044 6:45759543-45759565 TAGCAGTCCTTGGGGACATCAGG - Intergenic
1008686400 6:53930310-53930332 CAGCAGTCCTTGGGAAACCCAGG + Intronic
1009000898 6:57713181-57713203 CTGTAGTGCTTGGGTAAAGCTGG - Intergenic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018668416 6:166160671-166160693 CTGCAATCCCTGGGCATAGCTGG + Intronic
1022422704 7:30238983-30239005 CTACATTTCTTGGGCAAATAAGG - Intergenic
1022952743 7:35354061-35354083 CTGCTTTCCTTTTGCAAATCAGG - Intergenic
1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG + Intergenic
1024119066 7:46219231-46219253 CTCCAGTCAATGGGCAATTCTGG - Intergenic
1025607183 7:63047769-63047791 CAGCAGGCCTGGGGCAAAGCAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026373061 7:69721201-69721223 CTGCAGTACTTGAGCAGATCAGG - Intronic
1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG + Intergenic
1028033562 7:85950016-85950038 CTACAGTCCTTGGGCAAGTATGG - Intergenic
1029315182 7:99705482-99705504 CAGAAGTCCTTAGGGAAATCAGG + Exonic
1029974507 7:104820483-104820505 CTGAAGCCCTTGGCAAAATCAGG + Intronic
1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG + Intronic
1032796132 7:135277518-135277540 CTGCAGCCCATGGTGAAATCTGG + Intergenic
1034622333 7:152464990-152465012 CTGCAGGCGTTGGACAGATCCGG - Intergenic
1037776353 8:21838421-21838443 CTGCAGGCCTTGGACACATGGGG + Intergenic
1040589593 8:48778245-48778267 CTGCAGTGCCTGGGCAGCTCTGG + Intergenic
1040999029 8:53431465-53431487 CTGGAGTGCTTGGGAAAATGTGG - Intergenic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052701573 9:31943602-31943624 CTGCAGAACATGGGAAAATCTGG - Intergenic
1053363982 9:37509826-37509848 CTACATTCACTGGGCAAATCAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057196836 9:93120138-93120160 CTGCAGGCCATGGCCAAATCAGG + Intergenic
1059256493 9:112935804-112935826 CTGCATTTGGTGGGCAAATCTGG - Intergenic
1059703883 9:116801894-116801916 CTCCCCTCCATGGGCAAATCAGG + Intronic
1185743025 X:2549144-2549166 CAGCAGTCCTGGGGCTACTCTGG - Intergenic
1187493782 X:19777174-19777196 CTGCAGTCCTTAGTGAAATGGGG - Intronic
1188280001 X:28255462-28255484 CTGCAATCCTGGTGGAAATCTGG - Intergenic
1192571172 X:72206758-72206780 CTGCAGTCTTTGGGGATAGCTGG - Exonic
1194466512 X:94240497-94240519 CTGTAGTTCTTGGACAGATCTGG - Intergenic
1195825014 X:108990305-108990327 CTGTAGTTTTTGGGCAAGTCTGG - Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic