ID: 1125880004

View in Genome Browser
Species Human (GRCh38)
Location 15:43185555-43185577
Sequence GCAGCTCCGGCACTTGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125879999_1125880004 -5 Left 1125879999 15:43185537-43185559 CCTGGCTTCGCCTTTGGAGCAGC 0: 1
1: 0
2: 1
3: 40
4: 577
Right 1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1125879996_1125880004 0 Left 1125879996 15:43185532-43185554 CCCACCCTGGCTTCGCCTTTGGA 0: 1
1: 0
2: 2
3: 12
4: 137
Right 1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1125879991_1125880004 15 Left 1125879991 15:43185517-43185539 CCTGCAGCCGCAGTCCCCACCCT 0: 1
1: 0
2: 4
3: 62
4: 520
Right 1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1125879997_1125880004 -1 Left 1125879997 15:43185533-43185555 CCACCCTGGCTTCGCCTTTGGAG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1125879994_1125880004 1 Left 1125879994 15:43185531-43185553 CCCCACCCTGGCTTCGCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 232
Right 1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1125879993_1125880004 8 Left 1125879993 15:43185524-43185546 CCGCAGTCCCCACCCTGGCTTCG 0: 1
1: 0
2: 1
3: 37
4: 447
Right 1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1125879998_1125880004 -4 Left 1125879998 15:43185536-43185558 CCCTGGCTTCGCCTTTGGAGCAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125880004 Original CRISPR GCAGCTCCGGCACTTGGCGG AGG Exonic
900175903 1:1291244-1291266 GCAGCTGCGGCACCTGCGGGTGG - Exonic
903685039 1:25125131-25125153 GACGTTCAGGCACTTGGCGGTGG + Intergenic
906380825 1:45331419-45331441 GCACCTCCGGCACCTTGGGGAGG - Exonic
907278055 1:53327819-53327841 GCAGCTCCAGCATCTTGCGGCGG - Exonic
910825844 1:91406177-91406199 GCAGATCCGGTATTTGGCGAGGG - Intergenic
911167291 1:94735358-94735380 GCAGCTCGGGCTCCTGGTGGAGG - Intergenic
923429399 1:233905592-233905614 GCAGCTCAAGTACTTGGTGGTGG + Exonic
924754734 1:246931318-246931340 GGAGCGGCGGCACATGGCGGCGG - Exonic
1064436899 10:15318560-15318582 CCAGCTCCGGCATTTGGTAGGGG - Intronic
1067732532 10:48822391-48822413 GCAGCTTCTGCACTTGGCTGAGG - Exonic
1069914034 10:71776214-71776236 GCAGCTCTGGATCTTGGGGGTGG - Intronic
1072443159 10:95475184-95475206 GCAGATCTGGCACATGGTGGTGG + Intronic
1072542723 10:96410529-96410551 GCAGCTCCCGCACGGGGCAGCGG + Intronic
1076998143 11:309065-309087 GATGTTCAGGCACTTGGCGGTGG - Exonic
1076999365 11:314974-314996 GATGTTCAGGCACTTGGCGGTGG - Exonic
1077000502 11:319916-319938 GATGTTCAGGCACTTGGCGGTGG + Exonic
1083606703 11:63983110-63983132 GCAGCACAGGCACTTGGTTGAGG - Intronic
1083775853 11:64894079-64894101 CCAGCTCCAGCACTTGGAGGGGG - Intergenic
1084155298 11:67309876-67309898 GGAGCTCCTGCACGTGGCGCAGG - Exonic
1084462448 11:69303484-69303506 GATGTTCAGGCACTTGGCGGTGG + Intronic
1088606880 11:111541106-111541128 GCAGCTCCGGGAACTGGCGTGGG - Intronic
1100853622 12:98739106-98739128 CCAGCTCCACCACTTGGCTGTGG - Intronic
1102201792 12:111062549-111062571 GCATCTCCGGCACGTGGCCTGGG - Intronic
1102341546 12:112125762-112125784 GCATCTCAGGCACCTGGAGGAGG + Exonic
1102470823 12:113158939-113158961 GCAGCTCCTGGACGCGGCGGCGG + Exonic
1102737583 12:115176843-115176865 GCAGCTCCTGCTCTTGGAGAGGG + Intergenic
1104976495 12:132554265-132554287 TCACCCCCGGCACTTGGAGGAGG + Intronic
1110346888 13:74458987-74459009 GTAACCCCAGCACTTGGCGGGGG + Intergenic
1111667835 13:91292064-91292086 CCAGCTCTGCCACTTGGTGGTGG - Intergenic
1113798048 13:113070140-113070162 GCAGCTCCGGCACTTTGAGCAGG + Exonic
1114675269 14:24436123-24436145 CCAGTTCCGGGACCTGGCGGAGG + Exonic
1114721411 14:24886292-24886314 GCAGCTCAGGCACTTGTAGCTGG - Intronic
1118590307 14:67395949-67395971 CCAGCTCTGCCACTTGGCTGTGG + Intronic
1119959199 14:78835325-78835347 GCTGCTCCTGCAGTTGGTGGTGG + Intronic
1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG + Intronic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1123124619 14:105937597-105937619 GCAGCTCCCAAACTTGGCTGAGG - Intergenic
1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG + Exonic
1129743964 15:78005161-78005183 GCTGCTCGGGTGCTTGGCGGAGG + Intronic
1132703803 16:1232583-1232605 GCATCTCCGGCACTCGGCCGAGG - Intergenic
1132707715 16:1253812-1253834 GCATCTCCGGCACTCGGCCGAGG + Intergenic
1134055213 16:11165775-11165797 GCATCTCCGGGACCTGGAGGTGG - Intronic
1134208100 16:12253877-12253899 GGAGCTCAGGCACAAGGCGGTGG + Intronic
1138557025 16:57776804-57776826 GCAGCTCCTGCCTTTGGTGGAGG - Intronic
1141346829 16:83254225-83254247 GCAGCTCCGTGACTTCGCTGTGG - Intronic
1142159515 16:88549837-88549859 GCAGCTCAGGCACCCAGCGGGGG + Intergenic
1142605293 17:1078046-1078068 GCAGCTCCCGCAGCTGGCTGGGG - Intronic
1142733564 17:1879862-1879884 GGAGCTCCAGGAGTTGGCGGAGG + Intronic
1142881485 17:2885531-2885553 GCAGCTGCGAGACTTGGTGGGGG - Intronic
1143014718 17:3885536-3885558 GCAGCTCTGGCCCGTGGTGGGGG + Exonic
1147717560 17:42518676-42518698 CCAGCTCCAGCACTTGGCAAAGG - Intronic
1148551317 17:48552185-48552207 GTAGGTGCGGCACTGGGCGGGGG + Exonic
1152191717 17:78892167-78892189 CCAGCTCCAGCGCTTGGCTGAGG - Exonic
1152236922 17:79143641-79143663 GGAGCTCCTGCACGTGGCGTTGG - Intronic
1152572515 17:81127017-81127039 GCAGCTCCTGCACTGAGCCGAGG - Intronic
1153248908 18:3100752-3100774 GCAGGTTCTGCCCTTGGCGGGGG - Intronic
1153820442 18:8827150-8827172 GCTGCTCCCGCAGATGGCGGGGG + Intronic
1157526998 18:48391167-48391189 GCTGCTGCGTCACATGGCGGCGG - Intronic
1158601906 18:58863415-58863437 GGAGCTCCGGGACCGGGCGGCGG - Intronic
1158983205 18:62785876-62785898 GCAGGTCAGGCACTTGGCTATGG - Intronic
1160410546 18:78672997-78673019 GCTGCTCCGGTAGTTGGCGTCGG - Intergenic
1161356368 19:3821380-3821402 GAAGCAGCGGCACCTGGCGGAGG - Exonic
1161667482 19:5586036-5586058 GCAGAACCGGCAGTTGGAGGAGG + Intergenic
1162416978 19:10544110-10544132 GCTGCTCCGGTACTGCGCGGCGG - Exonic
1162461966 19:10818669-10818691 GCTGCTCCTGAACTTGGAGGCGG + Intronic
1163595785 19:18220420-18220442 GCAGACCCGGCACTCGGTGGGGG - Exonic
1165091350 19:33389807-33389829 GCAGCTGCGCCACTGGGCTGAGG - Intronic
1167236390 19:48318551-48318573 GGAGATCCGGCGCTTGGAGGAGG - Exonic
1167483450 19:49746616-49746638 GCAGCCCTGGGACGTGGCGGCGG + Exonic
929974284 2:46616897-46616919 GCTGCTTCGGCAATTCGCGGGGG + Intronic
932585986 2:73029212-73029234 GCAACTCAGGGACTTGGCAGAGG - Intronic
937428481 2:121818671-121818693 GCAGCTCTGGCCCTTGGCTGGGG - Intergenic
939178693 2:138780502-138780524 CGAGCTCCGGCACGCGGCGGGGG + Intergenic
942965934 2:181892143-181892165 GGAGCTGCGGCACTTGGCCCAGG - Exonic
944069964 2:195657440-195657462 GCAGCTGCTGCAGTCGGCGGCGG + Intronic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
948949860 2:241242465-241242487 GCAGCTCCTGCATCTGGCGGAGG - Exonic
1169230965 20:3888869-3888891 GCAGCTGCGGAACTAGGCCGAGG + Intronic
1174342378 20:49906024-49906046 GCAGCTTTGGCACTTGGAGAGGG + Exonic
1174448974 20:50608522-50608544 GCAACTCCGTCACCTGGGGGTGG + Exonic
1174824174 20:53754510-53754532 GCAGCTCCTGCCCTGGGCTGTGG - Intergenic
1175882650 20:62269844-62269866 GCAGCCCCGGCACATGGGTGTGG - Intronic
1178585240 21:33865919-33865941 GCAGCTCTGGGACTTGGCCTTGG + Intronic
1179171577 21:38976985-38977007 GCTGCTCCCACACTTGGGGGAGG + Intergenic
1180570947 22:16718173-16718195 GCAGCTCCTGCGCCTGGAGGAGG - Intergenic
1185107723 22:48883749-48883771 CCAGCTCCGTCACTGGGCAGTGG + Intergenic
950237595 3:11337032-11337054 ACAGCTCTGGCACCTGGTGGAGG + Intronic
953955366 3:47227756-47227778 GCAGCTTGGGCCCTTGGTGGTGG - Intergenic
954136928 3:48586181-48586203 GCAGCTGCGTCGCTTGGCGCCGG - Exonic
956004497 3:64763931-64763953 CCAGCTCAGGCACTTGACTGAGG + Intergenic
967104147 3:186242044-186242066 GCAGCTCCGGGACTTGGACCAGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969113527 4:4857974-4857996 GCAACTCAGGCACTGGGCAGTGG - Intergenic
974747506 4:66094424-66094446 GATGTTCAGGCACTTGGCGGTGG - Intergenic
975461222 4:74655666-74655688 GCAGCTCCAGCTCTTGGAGGAGG + Intergenic
975650253 4:76586043-76586065 GCAGCTCCTGCAAGTGGCGGCGG + Intronic
991679016 5:69119576-69119598 GCAGCTCTGGCTCTTGCTGGTGG + Intronic
995052735 5:107724766-107724788 GCAGCCCCGGCCCCCGGCGGCGG + Intergenic
997529795 5:134574951-134574973 ACATCTCAGGCACTTGGCTGTGG + Intronic
997965438 5:138352724-138352746 GCGGATCGGGCGCTTGGCGGCGG + Exonic
997979167 5:138458455-138458477 GCAGCCCCGGCGCTGGGCGGTGG + Intergenic
1001412096 5:171519204-171519226 GCAGCTCAGGCAGGTGGGGGTGG + Intergenic
1002948755 6:1787904-1787926 GCACCTCCAGCACCAGGCGGAGG - Intronic
1004298704 6:14437572-14437594 GCAGATTGGGCACTTGGCAGTGG - Intergenic
1006522022 6:34576333-34576355 GATGTTCAGGCACTTGGCGGTGG + Intergenic
1007636842 6:43304820-43304842 GCAACTCCGGCCCTAGGCAGAGG - Exonic
1007917967 6:45578621-45578643 GCAGCTCCTCCACATGGAGGAGG - Intronic
1011281053 6:85678434-85678456 GCCGCTCAGGCACATGCCGGAGG + Intergenic
1012472671 6:99589202-99589224 GCTGCTCCGGCACCCGGCGCGGG - Intergenic
1019541479 7:1553621-1553643 GCAGCTCAGGGAGTTGGGGGAGG + Intronic
1019722002 7:2578283-2578305 GAAGCTCCGGCGCCTGGAGGAGG + Exonic
1024293683 7:47826183-47826205 GCAGCTACGGAACATGGTGGCGG - Intronic
1024581126 7:50801970-50801992 GCAGCTCCAGAAATGGGCGGTGG + Intergenic
1025105018 7:56163439-56163461 GATGTTCAGGCACTTGGCGGTGG - Intergenic
1029557907 7:101283100-101283122 GCAGCTCTGGCACCTGGTGCTGG - Intergenic
1032530426 7:132615388-132615410 GCAGCCCCCGCCCCTGGCGGAGG + Intronic
1035034743 7:155887347-155887369 GGAGCTTCTGCACTTGGCTGTGG + Intergenic
1038459396 8:27703268-27703290 GCAGCACCTGCACCTGGCAGAGG + Intergenic
1044559126 8:93595573-93595595 GCACCTCCGACATTTGGTGGGGG - Intergenic
1045571369 8:103371776-103371798 GCAGCTCCGGCAGAGGGAGGTGG + Exonic
1047399327 8:124532759-124532781 GCAGATCGGGCAGTTGGCTGGGG + Intronic
1048886615 8:138914429-138914451 GCAGCTGCGGCACTAGTCGGTGG - Intergenic
1049706495 8:144045584-144045606 GCTGCTCCAACACTTGGGGGAGG - Intronic
1052969874 9:34370889-34370911 GTAGCTGCGCCACTTGCCGGCGG + Exonic
1053071616 9:35105362-35105384 GGAGCTCCGGAACCTGGAGGAGG + Exonic
1059301420 9:113316769-113316791 GCAGTTCCAGCCCTTGGCTGTGG + Exonic
1060344221 9:122802654-122802676 GCAGCTCTGGGACTGGGCGGTGG - Intronic
1060480624 9:124015042-124015064 GCAGCAGCGGCACCTGGAGGAGG + Intronic
1185747627 X:2584667-2584689 GGGGCTGCGGCACTGGGCGGGGG + Intergenic
1187476308 X:19614120-19614142 GCAGCTCACACACTTGGAGGGGG + Intronic
1189712337 X:43826454-43826476 GCATCTCCAGCACTTGGCTCAGG - Intronic
1192705555 X:73526130-73526152 GCAGCTCCGAGACTGAGCGGCGG - Intergenic
1196762753 X:119214364-119214386 GAAACTCCAGCACTTGGTGGTGG + Intergenic
1197537393 X:127707392-127707414 GCAGATTGGGCACTTGGTGGTGG - Intergenic
1199258437 X:145744040-145744062 GCATCTCTGGGACTTGGGGGAGG + Intergenic