ID: 1125882901

View in Genome Browser
Species Human (GRCh38)
Location 15:43209156-43209178
Sequence AGATGGGGAAATGCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125882896_1125882901 3 Left 1125882896 15:43209130-43209152 CCTGGGACAACTACTTCTGTGTG 0: 1
1: 0
2: 2
3: 11
4: 137
Right 1125882901 15:43209156-43209178 AGATGGGGAAATGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125882901 Original CRISPR AGATGGGGAAATGCGGCCGC AGG Intronic
901069847 1:6511644-6511666 AGATGGGGGACTGAGGCAGCAGG + Intronic
901919381 1:12525535-12525557 GGATTGGGAAATGAGGCCACTGG + Intergenic
902521512 1:17020351-17020373 AGATGGGGAAATTGAGCCCCAGG - Intronic
903594402 1:24483090-24483112 AGATGGGACAATGCAGCCGTGGG - Intergenic
903605972 1:24575456-24575478 AGATGAGGAAATGAGGCTCCTGG + Intronic
904804402 1:33120574-33120596 TGATGGGGAAATCCTGCCCCAGG - Intergenic
916521517 1:165567746-165567768 AAATGGGGAAATGTGGCAGGTGG - Intergenic
922579399 1:226685843-226685865 AGCTGGGGAAATGAAGCGGCTGG + Intronic
1063805428 10:9634261-9634283 AGATGGAGAAATGCTGGCGTGGG + Intergenic
1065968265 10:30785737-30785759 AGCTGGGGAAATAAGGCCGCAGG - Intergenic
1067187860 10:44045242-44045264 AAATGAGGAAACGCGGCAGCTGG - Intergenic
1069608922 10:69759410-69759432 AGATGGGGAAATGGAGGCTCAGG + Intergenic
1069830492 10:71279630-71279652 AGATGGGAAACTGAGGCCGCAGG + Intronic
1070452985 10:76580557-76580579 AGATGAGGAAATGCTGCTTCTGG - Intergenic
1071472268 10:85992068-85992090 AGATGGGGCAATGAGCCAGCTGG + Intronic
1072433883 10:95398049-95398071 AGATGAGGAAATGGGGACTCAGG - Intronic
1073183966 10:101604074-101604096 AGGTGGGGAAGTGTGGCCTCTGG + Intronic
1076404052 10:130200845-130200867 AAAGGGGGACATGTGGCCGCAGG + Intergenic
1077032362 11:474287-474309 AGATGGGGCTATGAGGCCGGGGG + Intronic
1083885649 11:65572382-65572404 AGATGGAAAAATGCGGCGGAGGG - Intronic
1084604101 11:70162470-70162492 GGGTGTGGAAATGCGGCTGCTGG + Intronic
1085483139 11:76839010-76839032 AGAGGGGGAAATGCAGGGGCCGG + Intergenic
1085518914 11:77126971-77126993 GGATGGGGAAATGAGACCCCGGG - Intergenic
1086070428 11:82793313-82793335 AGAGGGGAAAATGAGGACGCTGG + Intergenic
1086538913 11:87884416-87884438 AGATGGGGAAATGCCTCACCTGG + Intergenic
1088223614 11:107594050-107594072 ACATGGGGAAATGGGGCAGGGGG + Intronic
1091368409 11:135040114-135040136 TGATGGGGAAATGCCGACTCAGG - Intergenic
1091368477 11:135040466-135040488 TGATGGGGAAATGCCGACTCAGG - Intergenic
1091368665 11:135041434-135041456 TGATGGGGAAATGCCGACTCAGG - Intergenic
1091368781 11:135042028-135042050 TGATGGGGAAATGCCGACTCAGG - Intergenic
1091368872 11:135042479-135042501 TGATGGGGAAATGCCGACTCAGG - Intergenic
1094062974 12:26334363-26334385 AGCTGTGGAAATGTGGCCACAGG - Intergenic
1099191699 12:79568013-79568035 AGATGGGGAAATAAGGCTGAGGG - Intergenic
1100355005 12:93820622-93820644 CGATGGGGAAATCTGGCCCCTGG - Intronic
1101971282 12:109314628-109314650 AGATGGGGAAGTGAGGATGCAGG - Intergenic
1104678997 12:130736373-130736395 AGATGGGTAAATGTGGCTGCAGG - Intergenic
1119903516 14:78281749-78281771 AGATGGAGAAAAGCTGCTGCAGG + Intronic
1121024118 14:90601869-90601891 AGATGAGGAAATGAGGCCCAGGG + Intronic
1122129093 14:99594729-99594751 AGATGGGAAAATGAGGGCCCAGG + Intronic
1125208411 15:37182093-37182115 AGATGAGGAAATAGGTCCGCAGG + Intergenic
1125260767 15:37822289-37822311 AGAAGGTGAAATGTGGCCCCTGG + Intergenic
1125731361 15:41894312-41894334 AGATTGGGAAGTGCGTCCACAGG - Intergenic
1125882901 15:43209156-43209178 AGATGGGGAAATGCGGCCGCAGG + Intronic
1126108199 15:45160866-45160888 AGATGTGGAAACGGGGCAGCTGG - Exonic
1126377665 15:48012475-48012497 GGATGGGGAAATGCTGCCTATGG + Intergenic
1126697420 15:51338148-51338170 AGGTGGGGAAATGGGGAGGCTGG + Intronic
1128742773 15:70095560-70095582 TGATGGTGAGATGCGGCCGCGGG - Exonic
1131108297 15:89749308-89749330 AGATGGGAAAATGCCGGCGGAGG + Exonic
1136341743 16:29648505-29648527 GGATGGGGAAAGGCGGCCCCCGG + Intergenic
1139884202 16:70197178-70197200 AGAAGGGGACATGGGGCTGCAGG - Intergenic
1140368313 16:74398318-74398340 AGAAGGGGACATGGGGCTGCAGG + Intergenic
1142217447 16:88836799-88836821 AGATGGGGGAATGGGGCTGAGGG + Intronic
1142986243 17:3696813-3696835 AGATGGGGAACTGAGGCCAGGGG + Intergenic
1143130962 17:4676624-4676646 AGATGGGACAATGAGGCCGAAGG + Intronic
1144707763 17:17380745-17380767 AGATGGGGAAATGGAGGCGCAGG - Intergenic
1144948075 17:18979990-18980012 AGCTTGGGAAATGCTGCCGTGGG + Intronic
1145963654 17:28902185-28902207 AGATGGGCAAATGAGGGGGCTGG - Intronic
1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG + Intronic
1148078718 17:44955567-44955589 AGCTGGGGTAGTGCGGCCTCTGG + Intergenic
1148212059 17:45814610-45814632 AGCTGGGGGCATGTGGCCGCGGG - Intronic
1151557038 17:74851884-74851906 AGGTGGGGTAATGTGGCCCCAGG + Intronic
1152325500 17:79633536-79633558 AGATGGGCAGATGCCTCCGCAGG + Intergenic
1152599198 17:81253026-81253048 GGATGGGGAAGGGCGGCCCCGGG - Intronic
1153682351 18:7512573-7512595 AGATGGGGAAAAGCTGCCTGTGG - Intergenic
1157406236 18:47424600-47424622 AGACAGGGAAATGTGGCAGCAGG + Intergenic
1158049541 18:53200222-53200244 AGATGGGGAAAAGTGCCCACAGG + Intronic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1161795378 19:6383393-6383415 AGAAGGAGAAACGTGGCCGCAGG - Exonic
1162937091 19:13986760-13986782 AGATGGGGAAGTGCGGGGCCCGG - Intronic
1163178598 19:15583398-15583420 AGACTGGGGAATGCAGCCGCAGG - Intergenic
1163655134 19:18541607-18541629 AGATGGGGAAATGAGGCTCAGGG + Intronic
1165778781 19:38420278-38420300 AGATGGTGAGATGAGGCCGGGGG + Intronic
1167678673 19:50906261-50906283 AGATAGGGAAATGCGACCCATGG + Intergenic
925678002 2:6386541-6386563 AGTTGGGGAATTGAGGCTGCTGG - Intergenic
926335245 2:11857917-11857939 AGAAGAGGAAATGCAGCCACTGG - Intergenic
927695684 2:25238232-25238254 AGATGGGGCATTGGGGCAGCTGG - Intronic
929576580 2:43056243-43056265 AGATGGGCAAATGGGGGCCCTGG + Intergenic
929921013 2:46171623-46171645 AGATGGGGAAATGGGCTCGGAGG - Intronic
937047329 2:118858757-118858779 ACAAGGGGAGATGCGGCCTCCGG - Intergenic
939075510 2:137598057-137598079 AGATGGGGAAATGGGGAGACAGG - Intronic
943060666 2:183038532-183038554 GGACGGGGAACTGCGGCCGACGG + Exonic
945748931 2:213755921-213755943 AGATGGTTAAATGCAGCCACAGG - Intronic
946016028 2:216604765-216604787 AGATGGGAAACTGAGGCCCCAGG + Intergenic
946301771 2:218828325-218828347 AGATGGGGAAATTGAGCCCCAGG + Intronic
1172947700 20:38701765-38701787 AAATGGGGAAATGAGGCCAATGG + Intergenic
1173315171 20:41936653-41936675 AGATGGTGAAAATGGGCCGCTGG + Intergenic
1179160468 21:38892489-38892511 AGATGGGGAAAGACTGCCGATGG - Intergenic
1182010328 22:26995319-26995341 AGGTGAGGAAATGAGGCCCCCGG - Intergenic
1182703889 22:32262475-32262497 AGGTGGGTAAATGCAGCCTCAGG + Intergenic
1184466020 22:44669175-44669197 AGATGGGGACACGGGGCGGCTGG - Intronic
950422306 3:12906306-12906328 AGGTGGGGCCATGCTGCCGCTGG + Intronic
950706229 3:14784228-14784250 AGATAGGGAGATGCTGCTGCTGG - Intergenic
950893452 3:16426099-16426121 TGATGGGAAACTGCAGCCGCCGG - Intronic
953621492 3:44536547-44536569 AGATGTGGAGATGTGGCCGAAGG - Intergenic
953874670 3:46659838-46659860 ATATGGGGAAATGCCCCTGCAGG + Intergenic
955337956 3:58102598-58102620 AGTTGGGGAAATGCTGCTGTTGG + Intronic
955403690 3:58611560-58611582 AGGTGGGGAAATGCTGCTTCAGG + Intronic
955805010 3:62724731-62724753 AGTTGGGGAAATGAGGATGCTGG - Intronic
962208515 3:133455984-133456006 GGATGGAGAAATGAGGCCTCTGG - Intronic
965414411 3:168374410-168374432 AGATTGGGAAATGCTGCCTATGG + Intergenic
969324378 4:6432441-6432463 AGAGGGGGAAACGAGGCAGCAGG - Intronic
976321441 4:83721244-83721266 AGATGGAGAAATGGGGCTGAGGG - Intergenic
985039726 4:185878416-185878438 AGATGGGGAAATAAGGCGGAGGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985722216 5:1495370-1495392 AGATGGGGAAGTTCGCACGCAGG - Intronic
988473126 5:31559065-31559087 AGATGGGGCAATGCTGCAGAGGG - Intergenic
997368368 5:133340142-133340164 AGATGAGGAAATGAGGCCCAGGG - Intronic
1001487621 5:172130704-172130726 AGATGGGGAAATGGAGGCTCAGG - Intronic
1002546047 5:179945964-179945986 AGCTGGGCAGATGCGGCCGTGGG - Intronic
1007609376 6:43139358-43139380 AGACGAGGAATTGGGGCCGCTGG - Intronic
1007835244 6:44668797-44668819 AGAGGGGGAAATGCGGGTACGGG - Intergenic
1008809557 6:55479209-55479231 AGATGTGGAAAGGCTGCCACAGG - Intronic
1012857653 6:104521665-104521687 AGGTGGGGAAATGCATCCGCTGG + Intergenic
1018951884 6:168384629-168384651 AGCTGGGGAAACGGGGCCACAGG + Intergenic
1019156178 6:170040247-170040269 AGGTGGGGAAGGGTGGCCGCCGG + Intergenic
1023012282 7:35934992-35935014 AGATGGGAAAATGCGGCTGGGGG + Intergenic
1023991857 7:45133296-45133318 TGATGGGGAAATGAGGCCCCGGG + Intergenic
1024078847 7:45838861-45838883 AGATGGGAAAATGTGGCTGCAGG - Intergenic
1025125937 7:56345082-56345104 AGATGGGAAAATGCGGCTGGGGG + Intergenic
1029556625 7:101274572-101274594 AGATGGGAAAATGGGGCTGGGGG + Intergenic
1030392589 7:108945817-108945839 AGAAGGAGAAATGTGGACGCTGG - Intergenic
1031804415 7:126291356-126291378 AGATGGGAAAATGAGACTGCTGG + Intergenic
1040285988 8:46100673-46100695 ACATGCGAAAATGGGGCCGCAGG - Intergenic
1040329419 8:46378332-46378354 ACAAGGGAAAATGGGGCCGCAGG + Intergenic
1048296878 8:133220982-133221004 AGATGGGGAAATAGGGTCTCAGG - Intronic
1048928539 8:139292214-139292236 GGATGGGGAGATGCAGCAGCTGG - Intergenic
1049010199 8:139882298-139882320 AGATGGGGAAATGGAGGCTCAGG + Intronic
1049010470 8:139884006-139884028 AGATGGGGAAATGGAGGCTCAGG - Intronic
1053383450 9:37667891-37667913 AGATGGGGAAATGACGCCACAGG - Intronic
1056711792 9:88997616-88997638 AGCTGGGGAAAAGGGGCCTCAGG + Exonic
1057184969 9:93052389-93052411 TGATGGGGAAATGTGTCTGCAGG - Intergenic
1059443399 9:114323545-114323567 AGATGGGGAGATGAGGCCCCTGG - Intronic
1059444588 9:114330316-114330338 AGATGGGGAGATGAGGCCCCTGG - Intronic
1060524323 9:124312021-124312043 AGATGGGGAACGGCTGCCCCAGG + Intronic
1060806265 9:126579193-126579215 AGATGGGGAAATGGGGGCTGGGG - Intergenic
1061451369 9:130668657-130668679 AGATGGGGAGAGGCGGCCCAGGG + Intronic
1062103938 9:134742489-134742511 AGCTGGGGCAATGTGCCCGCAGG + Intronic
1192195644 X:69026032-69026054 AGATGGGGCAATGCTGCTGCAGG + Intergenic
1192584997 X:72312539-72312561 AGATGGGGAAATGGAGGCACAGG - Intergenic
1199721043 X:150542952-150542974 AGATGGGGAAGTGAGGAGGCAGG + Intergenic