ID: 1125884382

View in Genome Browser
Species Human (GRCh38)
Location 15:43217752-43217774
Sequence GTCTAAAGGACCTTGCTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125884382_1125884385 4 Left 1125884382 15:43217752-43217774 CCTGATAGCAAGGTCCTTTAGAC 0: 1
1: 0
2: 0
3: 10
4: 63
Right 1125884385 15:43217779-43217801 AGACGGATCTTGTCAAATTCAGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125884382 Original CRISPR GTCTAAAGGACCTTGCTATC AGG (reversed) Intronic
907610201 1:55861419-55861441 GTGTTCAGGACCTTGCTCTCAGG - Intergenic
912313988 1:108650096-108650118 GTGTAAATGACCTTGCTTTGTGG - Intronic
916081503 1:161236045-161236067 GTCTAAAAGACCTGGGAATCTGG + Intronic
917103191 1:171466262-171466284 TTCAAAAGGACCTTGTGATCTGG - Intergenic
920713132 1:208314415-208314437 TTTTAAAAGAGCTTGCTATCTGG + Intergenic
923329816 1:232912552-232912574 GTTTACATGACCTTGCTATCTGG - Intergenic
1063190109 10:3685717-3685739 GTCTTCATGGCCTTGCTATCTGG + Intergenic
1063958409 10:11285918-11285940 TCCTAAAGGAACTTGGTATCTGG + Intronic
1066978503 10:42390609-42390631 TTCTAATGGGCCTTGATATCTGG + Intergenic
1067391003 10:45864125-45864147 GACTAAAGCATCTTTCTATCTGG - Intergenic
1067540353 10:47146420-47146442 CTCAAAAGGACCTTGCTGTCAGG - Intergenic
1067872277 10:49971979-49972001 GACTAAAGCATCTTTCTATCTGG + Intronic
1070138190 10:73714348-73714370 GACTAAAGCATCTTTCTATCTGG - Intergenic
1072423445 10:95309076-95309098 GGCAAAAGGACCTTCCTATTTGG - Intergenic
1079963161 11:26948744-26948766 GTTTAAAGGAGCTGCCTATCAGG - Intergenic
1091555611 12:1571064-1571086 GGCTGAAGGACCATGCAATCAGG - Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1108093317 13:46874340-46874362 GTAAAAATGACTTTGCTATCAGG + Intronic
1109160886 13:58972509-58972531 ATCTAAAGGACATTGCTTTATGG + Intergenic
1110109917 13:71733050-71733072 TTTTTAAGGACCTTGCTATATGG - Intronic
1111147394 13:84201972-84201994 GTCTCTAGAACATTGCTATCAGG + Intergenic
1111316217 13:86563583-86563605 GTCGAAAGGACCTTGTCTTCAGG + Intergenic
1114340361 14:21736640-21736662 GTCTAACTTACCTTGCTTTCAGG + Intergenic
1115359874 14:32488727-32488749 GAGTGAAGGACCGTGCTATCTGG - Intronic
1115748332 14:36461378-36461400 ATCCAAAGCACCCTGCTATCTGG + Intergenic
1120900971 14:89575260-89575282 CCTTGAAGGACCTTGCTATCTGG + Intronic
1121896683 14:97655234-97655256 GTCTACAAGACCATGCTATCAGG - Intergenic
1123981320 15:25607224-25607246 CTTTCAAGGAGCTTGCTATCTGG + Intergenic
1125117269 15:36109361-36109383 GTTTCAAGGACCTTGCAACCAGG + Intergenic
1125884382 15:43217752-43217774 GTCTAAAGGACCTTGCTATCAGG - Intronic
1126286558 15:47019218-47019240 GTCTACAGGACCTTGGTCTGTGG - Intergenic
1134579309 16:15358158-15358180 GTCCAAGGGGCCTTCCTATCTGG + Intergenic
1134723273 16:16399396-16399418 GTCCAAGGGGCCTTCCTATCTGG - Intergenic
1134944155 16:18312474-18312496 GTCCAAGGGGCCTTCCTATCTGG + Intergenic
1149593878 17:57851860-57851882 GTCTAAAAGACCTTGCTCTGGGG + Intergenic
1153747994 18:8200114-8200136 GTCCCAAGGACACTGCTATCAGG - Intronic
1166405637 19:42519995-42520017 GTCTTCATGACCTTACTATCTGG + Intronic
926505423 2:13708855-13708877 GTCTACAGGACCCAGATATCTGG + Intergenic
928499488 2:31875541-31875563 GTCAAAAGGACTTTGCTAATGGG - Intronic
928508151 2:31975317-31975339 GTCTAAAGGAGCTTTGTCTCAGG - Intronic
929191692 2:39146277-39146299 GCCTCAAGGACCTTCCTATTAGG + Intergenic
933995230 2:87663282-87663304 CACTCAAGGACCTTGCAATCAGG + Intergenic
935871932 2:107460371-107460393 GCCTTAATGACCTTGATATCAGG - Intergenic
936298630 2:111287631-111287653 CACTCAAGGACCTTGCAATCAGG - Intergenic
1170420830 20:16191382-16191404 GTGTAAAGCACCTTGGTACCAGG + Intergenic
1172956560 20:38763810-38763832 ATCTAAAGAACCTTGCTCTCAGG - Intronic
1182120879 22:27785891-27785913 GTCTAATGGACATTGGTGTCTGG - Intronic
950578345 3:13846661-13846683 GTGAGAAGGAACTTGCTATCAGG - Intronic
950868548 3:16209397-16209419 GTCTCAAGGGCCTGGCTGTCTGG - Intronic
951795590 3:26534477-26534499 GTGGAAAGGACCCTGCTATTTGG - Intergenic
952733254 3:36662192-36662214 GTCTAAAGTGCCTTCCTATTGGG - Intergenic
954751319 3:52815665-52815687 ATCTAAAATTCCTTGCTATCTGG - Intronic
963196234 3:142533439-142533461 GTCCAAAGGACCTTTCTGTGAGG - Intronic
966756058 3:183372459-183372481 TTCTAAAGGACTTTTCTATACGG - Intronic
980197175 4:129604386-129604408 TTCTCAAGGAACTTGCAATCAGG - Intergenic
980832345 4:138147077-138147099 GTCTTAAGGACCTAGGTATATGG + Intergenic
981217664 4:142190155-142190177 GTCTAAAAGACTTGGCTATCTGG + Intronic
985583852 5:716278-716300 GGCTAAAGGAATTTGCTATCAGG - Intronic
985597358 5:800577-800599 GGCTAAAGGAATTTGCTATCAGG - Intronic
1004421419 6:15473559-15473581 CTCTTAAGGACCTTGGTATATGG - Intronic
1011805484 6:91068182-91068204 GTCGAAAGGATCTTGTTATTAGG + Intergenic
1016259124 6:142146836-142146858 TTCTAAAGGACACTGCTATATGG + Intergenic
1018727231 6:166622848-166622870 GTCAAAAGAAGCTTGCTATCAGG - Intronic
1021151508 7:17156877-17156899 GTTTAAAGTACATTTCTATCAGG + Intergenic
1031083020 7:117276581-117276603 GTCTAAATGACCTTACTGTATGG + Intergenic
1035159429 7:156940447-156940469 GCCTGCAGGACCTTGCAATCCGG - Intergenic
1040513854 8:48118747-48118769 GTATAAAGGGACTTGCTATCTGG - Intergenic
1045232774 8:100320624-100320646 GCCTAAAGGACCTTGATGTATGG - Intronic
1047451702 8:124970944-124970966 TTCTCATGGAGCTTGCTATCTGG + Intergenic
1056897977 9:90568707-90568729 GTTTCAAGGACCTAGCTTTCTGG - Intergenic
1060801820 9:126549859-126549881 GTCTCAAAGTCCCTGCTATCAGG + Intergenic
1192929065 X:75785502-75785524 GCTTAAAGCACCATGCTATCAGG + Intergenic
1195565849 X:106338591-106338613 TTATATAGGATCTTGCTATCTGG - Intergenic
1197290561 X:124651971-124651993 GGATCAAGGACCTTGGTATCTGG - Exonic