ID: 1125887672

View in Genome Browser
Species Human (GRCh38)
Location 15:43240731-43240753
Sequence GGGGTGTGGAGGAGGTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1593
Summary {0: 1, 1: 1, 2: 19, 3: 179, 4: 1393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125887659_1125887672 8 Left 1125887659 15:43240700-43240722 CCTTGGTGGGGGGTGGGTGGGGG 0: 3
1: 1
2: 32
3: 241
4: 1452
Right 1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG 0: 1
1: 1
2: 19
3: 179
4: 1393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125887672 Original CRISPR GGGGTGTGGAGGAGGTGAAG GGG Intronic
900659170 1:3774332-3774354 TGGGGGTGGAGGAGTTGGAGGGG - Intronic
900725918 1:4216312-4216334 GAGGTGAGGTGGAAGTGAAGAGG - Intergenic
900865508 1:5266101-5266123 GGGCTGTGGGGGATGTGCAGGGG + Intergenic
901128063 1:6943199-6943221 GAGGAGGGGAGGAGGAGAAGAGG - Intronic
901452904 1:9346695-9346717 GGGAAGAGGAGGAGGTGAGGAGG - Intronic
901638350 1:10680655-10680677 AGCGGGTGGAGAAGGTGAAGGGG + Intronic
901653730 1:10757386-10757408 TGGGTGAGGAGGAGGTGGACAGG - Intronic
901802369 1:11715677-11715699 GGGGCACGGAGGAGTTGAAGAGG - Intronic
901896857 1:12320995-12321017 AGGTGGTGGAGGGGGTGAAGAGG + Intronic
902249480 1:15144601-15144623 TGGGTGTGGGGGAGGCGGAGCGG + Intergenic
902308947 1:15565757-15565779 GGCGGGTGGAGGTGGTGGAGGGG - Intronic
902385335 1:16072868-16072890 GGGGTGGGGAGGAGGATTAGGGG + Intronic
902525293 1:17053536-17053558 GGGGTGTGAAGGATGGGAATTGG - Intronic
902592390 1:17484377-17484399 GTGATGGGGAGGAGATGAAGAGG + Intergenic
902596989 1:17516353-17516375 GGGGTGTGGGTGGGGTGAAGAGG + Intergenic
902625082 1:17671721-17671743 GGTGTATGTAGGAGGTGAAATGG - Intronic
902770461 1:18642850-18642872 GGGGTGGGGGAGAGGTGAGGCGG + Intronic
902825891 1:18974050-18974072 GGGGTAGGGTGGAGGTGAGGAGG - Intergenic
902897389 1:19488366-19488388 GGGGTGGGGAGGGGCTGAGGTGG - Intergenic
902936700 1:19769737-19769759 GGGGTGGGGAGGAGCTCAGGAGG + Intronic
902960584 1:19960521-19960543 GGGGTGGGGGGGGGGTGGAGGGG - Intergenic
903015997 1:20362192-20362214 GGAGTTTGGAGGAGGAGGAGTGG - Intergenic
903066791 1:20704154-20704176 GGGGTGTGGTGGGGGTGGGGGGG + Intronic
903229169 1:21911466-21911488 GGGGTGTGGAGGGGGTGGGCGGG + Intronic
903551330 1:24159015-24159037 GGGGTGTGCAGCAGGTGGGGAGG - Intronic
903866592 1:26403162-26403184 TGGGAGTGGAGGAGGTGGAGTGG + Intergenic
903906073 1:26687797-26687819 TGTGTGTGGTGGAGGTGAGGGGG + Intergenic
903946567 1:26967773-26967795 GGGGTGTGGAGGTGAGGAAGGGG - Intergenic
904015718 1:27418773-27418795 GGGGTGTGGTGGAGCTAAAAAGG + Intronic
904491685 1:30864396-30864418 GGGGTGGGGAGGAGGTGAAGGGG + Intergenic
904539623 1:31224127-31224149 GGGGTGAGTAGGAGCTGAATGGG + Intronic
904569897 1:31455509-31455531 AGGGGGTGGAGGAGGTGAGGCGG + Intergenic
904639413 1:31912630-31912652 GGGGAGTGGAGGAGGGGGACTGG + Intronic
904663347 1:32101516-32101538 GGGGTGAGCAGGAAGTGAAGGGG - Intronic
904774768 1:32900067-32900089 GGTGGGTGGAGGGGGTGAGGTGG - Intronic
904832611 1:33314744-33314766 GGGTTGTGGAGGAAGTGACCAGG - Intronic
905269316 1:36776738-36776760 GGGCTGTGGAGATGGAGAAGAGG + Intergenic
905276613 1:36822654-36822676 GGAGTGTGGAGGAGGAGACAGGG + Intronic
905473768 1:38211679-38211701 TGGGAGTGGGGGAGGTGATGGGG - Intergenic
905637299 1:39563186-39563208 AGTGTGTGTAGGAGGTGAAGGGG - Intronic
905811626 1:40917368-40917390 GGGGGCAGGAGGAGGGGAAGGGG - Intergenic
905836627 1:41129349-41129371 TGAGGGAGGAGGAGGTGAAGAGG - Intronic
906018897 1:42609174-42609196 AGGTTGAGGAGGAGGAGAAGAGG - Intronic
906103289 1:43276754-43276776 GGGGGTTGGGGGTGGTGAAGAGG - Intergenic
906279476 1:44543326-44543348 GGGGAGGGGAGGGGGTGATGGGG + Intronic
906524996 1:46488818-46488840 GGGGTGTGGGGTAGGTGGGGAGG - Intergenic
906820201 1:48921162-48921184 GGGGAGAGGGGGAGGGGAAGTGG + Intronic
907091521 1:51729808-51729830 GGGGGGTGAAGGGGGTGAAGGGG + Intronic
907294275 1:53439586-53439608 GGGGCGTGCTGGAGGGGAAGGGG - Intergenic
908035388 1:60046206-60046228 GGGAGGAGGAGGAGGAGAAGGGG - Intronic
908354920 1:63319720-63319742 GGGGCGGGAAGGAGGCGAAGCGG - Intergenic
908764962 1:67546389-67546411 GGAGTGCAGAGGAGGTGAAAGGG - Intergenic
908816543 1:68041377-68041399 AGGCTGTGGAGGAAGAGAAGAGG - Intergenic
909318069 1:74248279-74248301 GAGGTGTGGAGGGAGTGGAGTGG - Intronic
909547138 1:76860421-76860443 GGAGAGAGGAGGAGGTGGAGGGG + Intergenic
909768651 1:79391283-79391305 GGAGGGTGGAGGATGGGAAGAGG - Intergenic
909894276 1:81046866-81046888 AGGGAGTGGAAGAGGTGGAGGGG + Intergenic
909999970 1:82330396-82330418 GAGGTGTGGAGCTGGTAAAGTGG - Intergenic
910256487 1:85253392-85253414 GGTGGGTGGAGAAGGTGATGGGG - Intronic
910636013 1:89408742-89408764 GTGGAGAGGAGGAGGAGAAGGGG - Intergenic
910783820 1:90971772-90971794 GGGGAGGGGATGAGGAGAAGAGG + Intronic
910875748 1:91876098-91876120 GGGGTGTGGTGGGGGTGTGGTGG + Intronic
911590935 1:99746897-99746919 GGTGGGTGGAGGAGGTGGAAGGG - Intronic
912313699 1:108647525-108647547 CTGGTGGGGAGGAGGTGAGGTGG + Intergenic
912386204 1:109272422-109272444 GGAGGGTGGAGGAGGGGAGGAGG + Intronic
912435994 1:109661404-109661426 GGGGTTTAGGGGAAGTGAAGAGG - Exonic
912459060 1:109819128-109819150 AGGGTGTGGACGAGGTGCATAGG + Intergenic
912464495 1:109861982-109862004 GGGGTGGGGTGCAGGTGGAGGGG + Intergenic
912705737 1:111910623-111910645 GGTGTGCGGAGAAAGTGAAGGGG - Intronic
912879013 1:113390644-113390666 GGGGGGGCGGGGAGGTGAAGGGG - Intergenic
913190215 1:116407051-116407073 GAGGGGTCGAGCAGGTGAAGAGG - Intronic
913223869 1:116681393-116681415 GGGGTGGGGATGAGATGGAGTGG + Intergenic
913481546 1:119293942-119293964 GGGGTGGGGAGGAGGGACAGAGG - Intergenic
914719323 1:150276418-150276440 GCTGGGTGGAGGTGGTGAAGGGG + Intronic
914747133 1:150509103-150509125 GGTGGGTGGAGGAGGTGGATTGG + Intronic
915088051 1:153401767-153401789 GCGGTGAGGTGGTGGTGAAGAGG + Intergenic
915121688 1:153633511-153633533 GGGGAGGGGAGGAAGTGAGGAGG + Intronic
915135547 1:153728691-153728713 GGGAGGTGGAGGAGGAGGAGCGG + Exonic
915271351 1:154755940-154755962 GGGGAGGGGAGGAGGAGGAGGGG + Intronic
915313878 1:155017502-155017524 GAGATGGGGAGGAGGAGAAGAGG - Exonic
915341257 1:155178054-155178076 GGGCTGTGCTGGAGGAGAAGCGG + Exonic
915441164 1:155946328-155946350 GGGCTGTGGGGGAGGGGAGGAGG - Intergenic
915473494 1:156139151-156139173 GGGGTGGGCATGAGGTGAGGAGG - Exonic
915512310 1:156392917-156392939 GGGCGGTGGAGGTGGTGAGGAGG + Intergenic
915522804 1:156457619-156457641 GCGGGGTGGAGGGGGTGACGGGG + Intergenic
915579693 1:156805960-156805982 CGGTTGCAGAGGAGGTGAAGGGG + Intergenic
915921638 1:159980313-159980335 GGGATGTGGCAGAGGGGAAGAGG - Intergenic
916208468 1:162338251-162338273 GGGGAGTGGAGGAGGGGACAGGG + Intronic
916773572 1:167936849-167936871 GGGGAGGGGAGGAGGGGGAGGGG - Exonic
917072762 1:171170230-171170252 GGGGTGTGGAGGTGGGGCAAAGG - Intergenic
917591464 1:176480753-176480775 GGGGTGGGGAGAGGGAGAAGGGG - Intronic
917674565 1:177306361-177306383 GGGCTGGGGTGGAGGAGAAGAGG + Intergenic
917694549 1:177508540-177508562 GGGGTGTGTAGGTGGTGATGAGG - Intergenic
917719108 1:177769174-177769196 GGGGAGTGGAGTAGGAGATGAGG - Intergenic
917734592 1:177908944-177908966 GGGGTTTGGGGAAAGTGAAGGGG - Intergenic
918034235 1:180851351-180851373 GGGGTGTGGTGGAGGAGTAGAGG + Intronic
918114552 1:181485053-181485075 GGGGTGGTGAGGCAGTGAAGGGG + Intronic
918222179 1:182444989-182445011 GGGTTGTGGGGGAGCTGAGGCGG - Intergenic
919041039 1:192388526-192388548 GAGGTGTGGAGGAGGTGGATGGG + Intergenic
919823066 1:201484918-201484940 GGGGTGCTGTGGAGGTGAGGGGG - Intronic
920203561 1:204275541-204275563 GGGGTGGGGGGTAGGTGCAGAGG + Intronic
920214328 1:204351194-204351216 GGGGTGTGGCGGGGGGGAGGTGG + Intronic
920251120 1:204623155-204623177 GAGGGCTGGAGGAGGTGGAGAGG + Intronic
920291563 1:204927231-204927253 TGGGGGTGGAGGTGGGGAAGAGG - Intronic
920312027 1:205054217-205054239 GGGGTGTGGGGTAGGGGAGGTGG - Intronic
920441117 1:205980876-205980898 GGGAAGCGGAGGAGGTGAAGGGG - Intronic
921023852 1:211259771-211259793 GGGGGCTGGGGGAGGGGAAGAGG - Intronic
921133886 1:212243084-212243106 GGGGTCTGGGGGAGGTGTGGGGG - Intergenic
922070868 1:222192033-222192055 TGATTGTGGAGCAGGTGAAGAGG - Intergenic
922196134 1:223362698-223362720 GGGGCGTGGAGGAGGTGCAGAGG - Intronic
922272052 1:224043556-224043578 GGGGTGTGCTGGAGGGGAGGGGG - Intergenic
922427697 1:225514785-225514807 TGGGAGTGGAGGAGGTGGAGGGG + Exonic
922455531 1:225770882-225770904 AGGGAGGGGAGGAGGGGAAGGGG + Intergenic
922574917 1:226655065-226655087 GAGGTGGGGAGGAGGGGAGGAGG + Intronic
922618746 1:226978168-226978190 GGTGTGTGGAGGATGTAAAAAGG - Intronic
923040050 1:230313207-230313229 GGAATGTGGGGGAGGGGAAGAGG + Intergenic
923090612 1:230737887-230737909 GGGCTGGGGATGGGGTGAAGTGG - Intergenic
923126451 1:231038992-231039014 GGGATTGGGAGGAGGTGATGGGG + Intronic
923246903 1:232141068-232141090 GGGCTGTGGAGAGGGGGAAGAGG + Intergenic
923342094 1:233016362-233016384 GGGCAGGGGAGGAGGAGAAGGGG - Intronic
923592172 1:235328504-235328526 GGGGCGGGGGGGAGGTGAAAGGG + Intronic
924178685 1:241419148-241419170 CGGGGGTGGCGGAGGGGAAGAGG + Intergenic
924320963 1:242849797-242849819 TCGGTGTGGATGTGGTGAAGAGG - Intergenic
924612812 1:245588069-245588091 GGGCTGTGGAGGAGGCTGAGGGG - Intronic
924814693 1:247431462-247431484 GGGGTGAGGACGAGGAAAAGTGG - Intronic
1062790518 10:301396-301418 GGGGTCTGGGGAAGGTGGAGGGG + Intronic
1062860780 10:807617-807639 GGGGTCAGGAGGTTGTGAAGAGG - Exonic
1063070010 10:2651958-2651980 TTGGTGTGGATGTGGTGAAGAGG - Intergenic
1063117156 10:3079658-3079680 GGGGTGGGGGGGGGGGGAAGAGG + Intronic
1063152684 10:3351066-3351088 GGGGTTGGGGGGAGGAGAAGAGG - Intergenic
1063167144 10:3473752-3473774 GGGGTGAGTAGGAGGTGAGGAGG - Intergenic
1063167925 10:3480628-3480650 GGGGGGTGGAGGAGGTTCAGGGG - Intergenic
1063235606 10:4112424-4112446 TGGGGGTGGAGGAGGTGGTGAGG - Intergenic
1063538697 10:6910640-6910662 GGAGTCTGGAGGAGCTGGAGAGG - Intergenic
1063872403 10:10432429-10432451 GGGGTGTGGGGGAAGTCACGTGG + Intergenic
1064074027 10:12254716-12254738 GGGGAGGGGAGGCGGTGCAGTGG - Intergenic
1064247992 10:13684477-13684499 TGGGTGTGGAGGAGCGGATGTGG + Intronic
1065099684 10:22321140-22321162 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1065141323 10:22720950-22720972 GGGGAGTGGAGAAGGTGGGGTGG - Intergenic
1065416955 10:25498760-25498782 GGGCTGTGTGGGAGGTGAATAGG + Intronic
1065438667 10:25727102-25727124 GGAGTGTTGTAGAGGTGAAGAGG + Intergenic
1065751321 10:28890443-28890465 GGGGTTTGGATGAGGGGAATGGG + Intergenic
1066340609 10:34529282-34529304 GTGGTTTGGAGGAAGGGAAGAGG - Intronic
1066346419 10:34591137-34591159 GGGATGGGGAGGGGGTGATGGGG - Intronic
1066698995 10:38106430-38106452 GGAGTGTGTTGGAGGAGAAGAGG - Intronic
1067087495 10:43250624-43250646 GGGGTGTGCCGAAGGGGAAGGGG + Intronic
1067089886 10:43261208-43261230 GGGGAGTGGTGGTGGTGGAGAGG - Intronic
1067228816 10:44392724-44392746 CTGGTGTGGAGGGGGTGAAGGGG - Intergenic
1067345090 10:45432030-45432052 GGGGTGTGGTGGTGGTGAAGAGG + Intronic
1067522709 10:47020313-47020335 GGTGAGGAGAGGAGGTGAAGGGG + Intergenic
1067570082 10:47365177-47365199 GGTGTGAGGAGGAGATGGAGGGG - Intergenic
1067720603 10:48725040-48725062 GTGGGGTGGAGGAAGTGGAGAGG + Intronic
1067748697 10:48956093-48956115 GGGGTTTGGAGGAGGCAGAGAGG - Intronic
1067852908 10:49766449-49766471 GGGTTAAGGAGGAGGTGATGTGG - Intergenic
1067988892 10:51186577-51186599 AGGGAGTGGAGTAGGAGAAGAGG + Intronic
1068544044 10:58326898-58326920 GGGGTGTGGAGGCGGGGGTGGGG - Intergenic
1068875990 10:61997409-61997431 GGGATATGAAGGAAGTGAAGTGG + Intronic
1068924505 10:62521309-62521331 TTGGTGTGGATGAGGTGAAAAGG - Intronic
1069619691 10:69829242-69829264 AGGGTTTGGAGGAGGTCAGGTGG - Intronic
1069666320 10:70162485-70162507 GGGGAGGGGAGGAGGGGAAGGGG + Intronic
1069721878 10:70554960-70554982 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1069777850 10:70937228-70937250 GGGGAGAGGAGGAGGAGGAGAGG + Intergenic
1069856632 10:71444641-71444663 GAGGTGGGGAGGAGGAAAAGAGG + Intronic
1070329725 10:75408642-75408664 GGGGCGTGGGGGTGGTGAACCGG + Intergenic
1070408513 10:76117823-76117845 GTAGTGTGGTGGTGGTGAAGTGG + Intronic
1070414751 10:76179240-76179262 GGGGGGTGGTGGAGGAGTAGAGG + Intronic
1070418274 10:76210269-76210291 AGGGGGTGGAGGTGGGGAAGAGG + Intronic
1070533025 10:77353976-77353998 GGGGGGTGGTGGGGGTGGAGGGG + Intronic
1070544641 10:77442776-77442798 TGGGTGTGAAGGAGGAGGAGGGG - Intronic
1070754481 10:78983269-78983291 GCGGTGTGGAGGGGATGGAGAGG - Intergenic
1070814687 10:79315278-79315300 AGGGTGTGAGGGAGGTGCAGAGG + Exonic
1071273557 10:84031279-84031301 AGGGTGGGGAGGAGGTGAGAGGG - Intergenic
1071283731 10:84125560-84125582 GGGGTGGGGAGGGGGCGAGGAGG - Intergenic
1071492414 10:86144724-86144746 AGCGTGTGAAGGAGGAGAAGGGG - Intronic
1071525385 10:86355268-86355290 GGGGTGTCCAGGAGCTGAAGAGG - Intronic
1072578542 10:96720778-96720800 GGTGTGGGGAGGAGGCGGAGGGG + Intergenic
1073002692 10:100297264-100297286 GGGGTGGAGAGGAGAGGAAGTGG - Intronic
1073115960 10:101091727-101091749 GGGGATTGGAGGTGGTGAAGTGG + Intronic
1073214523 10:101829266-101829288 GGGGCGGGGAGGGGGTGAATGGG - Intronic
1073257153 10:102160057-102160079 TGGGTCTGGAGGAGGGGATGAGG + Intronic
1073429319 10:103476207-103476229 GGGGTGAGGGGGTGGTGAGGAGG - Intronic
1073592142 10:104767659-104767681 AGGGAGTGGAGAAGGGGAAGGGG - Intronic
1073803891 10:107074188-107074210 GGGGAGTGCAGGAGATGAATAGG - Intronic
1074326295 10:112455159-112455181 GGGGAGGGGAGGAGGGGAGGAGG - Intronic
1074350054 10:112727978-112728000 TGGGTATGGGGGTGGTGAAGAGG - Intronic
1074480429 10:113815396-113815418 GGGGTCTTGAGGAGGTGATTCGG + Intergenic
1074618531 10:115093634-115093656 CCGGTGAGGAGGAGGAGAAGCGG + Exonic
1075002190 10:118806948-118806970 TGGGGCTGGAGGAGGGGAAGTGG + Intergenic
1075062693 10:119267835-119267857 GGAGTGTGGAGGAGCTGGGGTGG - Intronic
1075112187 10:119596523-119596545 GGGGTGGGGAGGAAGGGGAGGGG + Intronic
1075324970 10:121524262-121524284 GGGGAGTGGAGGTGGTTAAGAGG - Intronic
1075419750 10:122291881-122291903 GGTGTGGGGAGGAGGTGGTGGGG + Intronic
1075575200 10:123572760-123572782 GGGGAGGGGAGGAGGAGGAGAGG + Intergenic
1075627312 10:123972474-123972496 GGGGAGGGGAGGAGGTGAAAGGG + Intergenic
1076364024 10:129910666-129910688 GGGCTCTGGGGGAGGTGATGGGG - Intronic
1076377186 10:129999021-129999043 GGGGAGTGGAGATGGTGAATGGG + Intergenic
1076422657 10:130342050-130342072 GGGGTGTAGAGGGGATGAAATGG + Intergenic
1076676403 10:132149651-132149673 GGGGTGGGGCGGGGGTGGAGAGG - Intronic
1076762214 10:132611451-132611473 GGAGGGTGGAGGAAGTGAGGTGG + Intronic
1076762355 10:132611856-132611878 GGAGGGTGTGGGAGGTGAAGTGG + Intronic
1076828261 10:132981342-132981364 GGGGTGCTCAGGGGGTGAAGGGG + Intergenic
1076847231 10:133075318-133075340 GTGCTGTGTGGGAGGTGAAGGGG - Intronic
1076858291 10:133127976-133127998 GGGGCCAGGAAGAGGTGAAGTGG - Intronic
1076921440 10:133456581-133456603 GGGCTGAGGAGGAGGAGGAGTGG + Intergenic
1076989898 11:267450-267472 GGGGCGAGGAGGAGGGGGAGGGG + Intergenic
1077025197 11:436918-436940 GGGGTGAGCAGGAGGTGAGCAGG + Intronic
1077200862 11:1306834-1306856 GGGGTCTGGAGGTGGAGAGGAGG - Intronic
1077308464 11:1878202-1878224 AGAGTGTTGAGGAGGTGGAGGGG - Intronic
1077416752 11:2427516-2427538 GCCGTGTGGAGCAGGTGAGGTGG - Intergenic
1077792808 11:5460238-5460260 GGAGGGTGAAGGATGTGAAGAGG + Intronic
1078591041 11:12641026-12641048 GGGATGTGGAGGTGGTGGGGGGG - Intergenic
1078591066 11:12641086-12641108 GGGATGTGGAGGTGGTGGGGGGG - Intergenic
1078591075 11:12641106-12641128 GGGATGTGGAGGTGGTGGGGGGG - Intergenic
1078591123 11:12641227-12641249 GGGATGTGGAGGTGGTGGGGGGG - Intergenic
1078726145 11:13933181-13933203 GGGGTGGGGGGAGGGTGAAGGGG - Intergenic
1078737132 11:14030465-14030487 GGATTGTGGGGGAGGTGACGTGG - Intronic
1079010809 11:16826569-16826591 GGGATATGGAGAAGGTGGAGCGG - Exonic
1079130557 11:17744657-17744679 GGGGTCTGGAGCAGGGGCAGTGG + Intronic
1079346102 11:19653879-19653901 GGGGAGTGTGGGAGGTGGAGTGG - Intronic
1079591782 11:22191778-22191800 GGGGTGGGCAGGAAGTGGAGGGG + Intergenic
1080061605 11:27962292-27962314 AGGGAGTGGAGGAGGGGAATGGG + Intergenic
1080321877 11:31019488-31019510 GGGGTGGGGAGGTGGTGCAGTGG + Intronic
1080407123 11:31989048-31989070 GGGGTGAAGAGAAAGTGAAGGGG + Intronic
1080649220 11:34209590-34209612 GGGGTGAGGGGGAGGGGTAGGGG + Intronic
1080718265 11:34824881-34824903 AGGGTGGGGTGGGGGTGAAGAGG - Intergenic
1080861485 11:36153986-36154008 GGGGTGTGGGGGAGTTGGAGAGG + Intronic
1080872359 11:36248074-36248096 GGGAGGAGGAGGAGGAGAAGAGG - Intergenic
1081586678 11:44389730-44389752 GGGGAGTTCAGGAGGTGCAGTGG + Intergenic
1081612505 11:44571010-44571032 GGGGTGGGGCGGCGGAGAAGAGG - Intronic
1081861561 11:46335940-46335962 GGCATGTGGAGGATGTGAAAAGG - Intronic
1081949438 11:47030664-47030686 GGAGGGTGGAGGATGGGAAGAGG - Intronic
1082193890 11:49278650-49278672 GGGGCGGGGAGGAGAAGAAGGGG + Intergenic
1082223894 11:49677678-49677700 GGGGAGAGGAGGAGGAGAGGAGG - Intergenic
1082255063 11:50025000-50025022 TTGGTGTGGATGAGGTGAAAAGG - Intergenic
1083160741 11:60852678-60852700 GGGCGGTGGAGGAGGTGCGGCGG + Exonic
1083161587 11:60857771-60857793 GGGGTGGGGTGGTGGGGAAGGGG - Intergenic
1083253962 11:61485263-61485285 GGCGTGTGGCGGCGGTGGAGTGG - Intronic
1083277045 11:61602802-61602824 GGAGTGTGGACGGGGTGCAGTGG - Intergenic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083648395 11:64186257-64186279 GCGCTATGGAGCAGGTGAAGGGG + Intronic
1083854751 11:65387133-65387155 AGGGTGTGGAAGAGGAGATGCGG - Intronic
1084426566 11:69087264-69087286 GGGGGGTGGAGGGGTTGAGGCGG + Intronic
1084447436 11:69212090-69212112 GGGGGACGGAGGAGGGGAAGAGG - Intergenic
1084471739 11:69365686-69365708 GAGGGGTGGAGGAGGAGAAGCGG + Intronic
1084498059 11:69516942-69516964 AGGTGGTGCAGGAGGTGAAGTGG - Intergenic
1084958610 11:72704340-72704362 GGGGTGTGCAGGAGGTCAGACGG + Intronic
1085203342 11:74715000-74715022 GGGGTGTTGAGAAGACGAAGTGG - Intronic
1085251689 11:75148156-75148178 GGGGTGTGGGCGGGGTGAAAAGG - Intronic
1085452495 11:76643441-76643463 GGCCTGTGGAGGAGGGGTAGGGG - Intergenic
1085463062 11:76706809-76706831 GGGGTGTGGAGGACGGGGAGGGG + Intergenic
1085470143 11:76752546-76752568 GGTGTGTGGAGGAGGTGGGGTGG + Intergenic
1085561250 11:77474184-77474206 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1085563691 11:77493717-77493739 GGGGTGTTGTGGAGGTTAAATGG - Intergenic
1085592591 11:77778106-77778128 GGGGAGGGGAGGAGGGGGAGAGG + Intronic
1086107166 11:83158053-83158075 TGGGTTGGAAGGAGGTGAAGGGG + Intronic
1086672255 11:89562409-89562431 GGGGCGGGGAGGAGAAGAAGGGG - Intergenic
1087270329 11:96104808-96104830 GGGGAGAGGAAGAAGTGAAGAGG + Intronic
1087617630 11:100506585-100506607 AGGCTGAAGAGGAGGTGAAGGGG - Intergenic
1088484887 11:110330935-110330957 GAGTTGTGGGGGAGGTGCAGAGG + Intergenic
1088774977 11:113073744-113073766 GTGGTGTGGAGGTGGTGGTGGGG + Intronic
1088880890 11:113972483-113972505 GGGATCTGGAGAAGGAGAAGAGG - Intergenic
1088990311 11:114948045-114948067 GTGGTGGGGAGGGGGTGAAGGGG - Intergenic
1089098485 11:115939715-115939737 GGAGAGGGGAGGAGGGGAAGTGG + Intergenic
1089202156 11:116731152-116731174 GGTGTGTGGAGAGGGGGAAGGGG - Intergenic
1089528955 11:119114174-119114196 TGGGTCTGAGGGAGGTGAAGAGG - Exonic
1089533768 11:119148919-119148941 GGGGGCCGGAGGAGGTGCAGGGG - Intergenic
1089622247 11:119728795-119728817 GGAGAGCGGAGGAGGCGAAGGGG - Exonic
1089663648 11:120002473-120002495 ATGGTGTGGGGGAGGTGAAGGGG + Intergenic
1089673879 11:120075969-120075991 GGGGTGGGGAGGAGGGGAGGTGG + Intergenic
1089772756 11:120815265-120815287 CGGGTGTGCAGAAGGTGAGGGGG + Intronic
1089792142 11:120953035-120953057 GGGGTGGGGAGGAGGAGAGGGGG + Intronic
1090070257 11:123538172-123538194 TGGGAGAGGAGGATGTGAAGAGG - Intronic
1090076113 11:123581027-123581049 GGGGTGTGGAGGAGGTAGGGGGG - Intronic
1090177589 11:124664866-124664888 GGGGTGGGGGGGAAGTGAACAGG - Intronic
1090178521 11:124673435-124673457 GGGGGGTGGAGAAAGTGGAGAGG + Intronic
1090206669 11:124887967-124887989 GGGGTGTGGAGGGGATTCAGGGG - Intronic
1090397395 11:126428160-126428182 GGGCTGTGGTGAGGGTGAAGTGG - Intronic
1090527310 11:127551422-127551444 GGGGAGAGGAGGAGGAGAAAAGG - Intergenic
1090640038 11:128722273-128722295 AGGGTATGGAGGAGAGGAAGGGG + Intronic
1091070498 11:132558371-132558393 GGAGAGGGGAGGAGGGGAAGAGG - Intronic
1091124349 11:133082383-133082405 GGGGTGCGGGGGAGGGGAAGAGG - Intronic
1091323888 11:134669899-134669921 GGGGGGAGGAGGAGGGGCAGCGG + Intergenic
1091328558 11:134712546-134712568 TGTCTGTGGAGGAGGAGAAGAGG - Intergenic
1091668538 12:2436369-2436391 GGGGTGAGGAGGCGGAGAAGAGG - Intronic
1091738226 12:2940870-2940892 GGGGGGTGGTGGTGGTGACGAGG - Exonic
1091858871 12:3760865-3760887 GGGATGTGCAGGAGGGGAGGAGG - Intronic
1091891408 12:4057603-4057625 GGGGAGGAGAGGAGGTGCAGAGG + Intergenic
1091983213 12:4883477-4883499 GGTCTGTGTAGGAGGTGGAGAGG + Intergenic
1092079562 12:5704126-5704148 TGGGTGTGGGGGTGGGGAAGAGG + Intronic
1092103185 12:5902701-5902723 GGGGAGGGGAGGAGGGGGAGGGG + Intronic
1092256017 12:6927444-6927466 GGTCTGTGGCAGAGGTGAAGTGG - Intronic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1093016549 12:14161163-14161185 GGAGGGGGGAGGAGGAGAAGAGG + Intergenic
1093081909 12:14822010-14822032 GGGGTGGGGAGTAGGGGATGGGG + Intronic
1094023787 12:25941553-25941575 AGGGAGTGGAGGAGGTGGACAGG - Intergenic
1094042577 12:26133294-26133316 GGGGAGTGAGGGAGATGAAGGGG - Intronic
1094293976 12:28882731-28882753 GGTGTGTATAGGAGGGGAAGTGG - Intergenic
1094426615 12:30322874-30322896 GGAGTTGGGAGTAGGTGAAGAGG - Intergenic
1096230460 12:49894002-49894024 GGGGTCTGGAGGAAGGGCAGAGG + Intronic
1096463588 12:51836328-51836350 GGGGTGTTGAGCAGCTGATGGGG - Intergenic
1096672496 12:53208630-53208652 AAGGGGTGGAGGAGGTGAACTGG + Intergenic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1097023694 12:56038210-56038232 GAAGAGAGGAGGAGGTGAAGGGG - Exonic
1097087294 12:56477872-56477894 GGGGTGGGGATAAGGAGAAGGGG + Exonic
1097166418 12:57088853-57088875 GGGGTGTGGAGCAGGAGGCGGGG - Intergenic
1097273755 12:57796544-57796566 TGAATGTGGAGAAGGTGAAGAGG + Exonic
1097333968 12:58361597-58361619 GGGGAGTAGAGAAGGAGAAGAGG + Intergenic
1097385924 12:58950155-58950177 CGGGTGGGGAGGAGGTGCAATGG + Intergenic
1097730917 12:63127105-63127127 AAGGGGTGGAGGAGGTGAAAGGG - Intergenic
1097820173 12:64120667-64120689 AGGGTGGGGAGGAGGGGAAGAGG + Intronic
1097970508 12:65628227-65628249 GGGATGTGGAGGTGGAGAAAGGG - Intergenic
1100089854 12:90955353-90955375 AGCGTTTGGGGGAGGTGAAGAGG + Intergenic
1100827830 12:98491334-98491356 AAGGTGGGGAGGAGGTGAGGAGG - Intronic
1101245998 12:102885049-102885071 AAGGTGTGGTGGTGGTGAAGGGG + Intronic
1101604687 12:106239360-106239382 GTGACGTGGAGGAGCTGAAGAGG - Exonic
1101673291 12:106896598-106896620 GGGGAGGGGAGGAGAGGAAGGGG + Intergenic
1101728866 12:107410326-107410348 GGTGTGTTTAGGAGCTGAAGTGG + Intronic
1101764335 12:107684221-107684243 GGGGTGTGGAAGTGGAGAAGTGG + Intergenic
1101868138 12:108538356-108538378 GGGGAGTGGAGGAGAAGGAGAGG + Intronic
1102753875 12:115320974-115320996 GGAGTTTGGAGGAGGTGGTGGGG + Intergenic
1102792311 12:115657767-115657789 AGGATGAGGAGGAGGGGAAGAGG - Intergenic
1102819235 12:115893896-115893918 GGGGCGAGGGGGAGGTCAAGTGG + Intergenic
1103074046 12:117968271-117968293 GGGAGGAGGAGGAGGGGAAGGGG - Intronic
1103080946 12:118023484-118023506 GGGAGGTGGAGGAGGAGAGGTGG + Intronic
1103136594 12:118513060-118513082 GGGGTGTGTAGCAGATGAATTGG - Intergenic
1103425473 12:120830323-120830345 GGGGTGGGGGGGAGGTGGAAAGG + Intronic
1103567979 12:121826652-121826674 GTGGTGTGGAGCTGGTGCAGGGG + Intronic
1103623190 12:122201027-122201049 GGGATGGGGAGGAGGTGGTGGGG + Intronic
1103856427 12:123973432-123973454 GGGGTGGGAAGGAGGTGGAGTGG + Exonic
1103927679 12:124432867-124432889 GGGGGGTGGGGGCGGGGAAGGGG + Intronic
1103948848 12:124541026-124541048 GGGATGGGGTGGAGATGAAGGGG + Intronic
1103965611 12:124637631-124637653 GGGGTGGTGAGGAGGTCAGGTGG - Intergenic
1103984816 12:124760247-124760269 GGGGAGGGGAGGAAGTGAGGAGG + Intergenic
1104626273 12:130358206-130358228 TGGGTGTGTGGGAGGTGCAGAGG + Intronic
1104676614 12:130715750-130715772 GCGGGGTGGAGGGGGGGAAGGGG - Intronic
1104678106 12:130729452-130729474 GGGGTGGGGAGGAGGGGTGGGGG - Intergenic
1104720048 12:131040159-131040181 GGAGTCTGGAGGAGATGAATGGG + Intronic
1104749939 12:131231915-131231937 GAGGTGAGGAGGAGGAGGAGGGG - Intergenic
1104842014 12:131829951-131829973 AGGGTCTTGAGGAGGTGGAGGGG - Intronic
1104878872 12:132055522-132055544 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104878880 12:132055563-132055585 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104878888 12:132055599-132055621 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104878896 12:132055640-132055662 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104994523 12:132645227-132645249 GGGGTCTGGGAGAGCTGAAGAGG + Intronic
1105278685 13:18950762-18950784 GGGCTGTGGAGCAGGTGACAGGG + Intergenic
1105415635 13:20208988-20209010 GGGGTCTTGCGGAGGTGAAGGGG + Intergenic
1105441436 13:20418315-20418337 GGGGTGGGGATGGGGAGAAGAGG + Intronic
1105486251 13:20835786-20835808 CAGAAGTGGAGGAGGTGAAGGGG - Intronic
1106097470 13:26660626-26660648 AGGGTGAGGAGCAGGGGAAGAGG + Intronic
1106229311 13:27809566-27809588 CAGGTGTGGAGGAGTTGAGGAGG + Intergenic
1106356636 13:28989712-28989734 GGGGTGAGGATGGGGTGAACAGG + Intronic
1106830696 13:33579008-33579030 TTGGTGTGGATGTGGTGAAGAGG + Intergenic
1107016269 13:35710072-35710094 GGTGGGTGCAGGAAGTGAAGGGG + Intergenic
1107758492 13:43651261-43651283 GGGGAGGGAAGGAGGAGAAGAGG + Intronic
1108034777 13:46278688-46278710 GGGATGGGGAGGAGGGGAGGAGG + Intergenic
1108702547 13:52955944-52955966 TGGGGGTGGAGGAGGTGAGTTGG + Intergenic
1108772178 13:53717154-53717176 TGGATGTGGAGGAGGTGAGATGG + Intergenic
1109370835 13:61417096-61417118 GGGGTGGGGAGGAGGTGGAGTGG - Intronic
1110515878 13:76411525-76411547 GGGGGGAGGAGGAGGAGAAGGGG + Intergenic
1110515890 13:76411555-76411577 AGGGGGAGGAGGAGGAGAAGGGG + Intergenic
1110515896 13:76411576-76411598 GGGAGGAGGAGGAGGAGAAGTGG + Intergenic
1110836324 13:80087957-80087979 GGGGTGGGGATGAGGGGCAGGGG - Intergenic
1111225124 13:85260880-85260902 GGGGAGTGGAAGTGGAGAAGAGG - Intergenic
1111230806 13:85341559-85341581 GAGGGGTGGAGGAGGGGGAGGGG + Intergenic
1111658735 13:91182650-91182672 CGGGTATGGAGGACCTGAAGTGG + Intergenic
1112452379 13:99524292-99524314 AGGGTGAGGGGGTGGTGAAGAGG + Intronic
1112505261 13:99971175-99971197 GGGAGGGGGAGGGGGTGAAGGGG + Exonic
1113120490 13:106919137-106919159 GGGGTTTGGAGGAACTGAGGTGG + Intergenic
1113811101 13:113143172-113143194 GGGGTGTGGGGGAGCAGGAGAGG - Intronic
1113909718 13:113836333-113836355 GGGGAGGGGAGGAGGGGAGGAGG + Intronic
1113909923 13:113836849-113836871 GGGGGGAGGAGGAGGGGGAGTGG + Intronic
1113909932 13:113836870-113836892 GGGGAGAGGAGGAGGGGGAGTGG + Intronic
1113927964 13:113951673-113951695 GGGGCCTGGAGGAGGAGCAGGGG - Intergenic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1114265704 14:21071407-21071429 AGGGAGTGGAGGAGGGGCAGGGG + Intronic
1114483577 14:23049564-23049586 GGGTGGAGGAGGAGGAGAAGGGG + Intronic
1114747309 14:25163581-25163603 GAGGTTAGGGGGAGGTGAAGGGG - Intergenic
1114891410 14:26928653-26928675 GGGGTGGGTGGGAGGGGAAGTGG + Intergenic
1115370978 14:32614707-32614729 GGTGTGTGGTCCAGGTGAAGTGG + Intronic
1115566640 14:34630193-34630215 GGGGCGGGGCGGAGGCGAAGGGG + Intergenic
1116430739 14:44842541-44842563 GGGGTGTGGAGATGGGAAAGAGG - Intergenic
1116747293 14:48836887-48836909 GGGGAGGGGAGGGAGTGAAGAGG - Intergenic
1117114131 14:52492557-52492579 GGAGCGTGGAGGAGGGGCAGAGG - Intronic
1117513271 14:56473782-56473804 GGGGTAGGGAGGGGGTGGAGAGG - Intergenic
1117548859 14:56814029-56814051 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1117846777 14:59920073-59920095 CGGGTGGGGAGGAGGAGAAAAGG - Intronic
1118089613 14:62458843-62458865 GGGGAGTGGAGAAGGGGAATGGG - Intergenic
1118171674 14:63395369-63395391 AGGGGGAGGAGGAGGAGAAGAGG + Intronic
1118223267 14:63875507-63875529 TTGGGGTGGAGGAGGTGCAGTGG + Intronic
1118366683 14:65102377-65102399 GGGGAGGGGAAGGGGTGAAGGGG + Exonic
1118458553 14:65966942-65966964 AGGGGGTGGTGGTGGTGAAGAGG + Intronic
1118503407 14:66385471-66385493 TGGGTGTGGGGGCGGTGGAGTGG - Intergenic
1118715505 14:68556868-68556890 GGTGTGTGGAGAAGGTGGGGTGG - Intronic
1118979592 14:70705751-70705773 GGGGTGGGCAGGAGATGAAGTGG - Intergenic
1119180370 14:72601003-72601025 GGGGAGAGGAGGAGGAGGAGGGG + Intergenic
1119260236 14:73233877-73233899 GCGGGGAGGAGGAGGTGCAGGGG + Intergenic
1119266338 14:73265042-73265064 GGGGTGTGGAGGACCGGAGGGGG + Intronic
1119319162 14:73719223-73719245 GGGGTGGGGTGGAGGGGAGGGGG - Exonic
1119410437 14:74426694-74426716 GGGGAGGGGAAGAGGGGAAGAGG - Intergenic
1119923777 14:78472229-78472251 GGGATGTGGAGGTGGTGTGGGGG + Intronic
1120283710 14:82470641-82470663 GGTATGAGGAGGAGGTGAGGAGG + Intergenic
1120731992 14:88013810-88013832 GGGGTGAGGGGGAAGTGATGTGG + Exonic
1120865248 14:89290896-89290918 GGGCCCTGGAGGAGGTGAGGAGG + Intronic
1121183663 14:91948001-91948023 GGGGTGGGGTGGGGGGGAAGAGG + Intergenic
1121310301 14:92932151-92932173 GGGGTGAGGATGAGGGGAAGAGG + Intronic
1121330048 14:93044095-93044117 GGGTTGGGGGGGAGGTGAGGAGG + Intronic
1121347657 14:93147944-93147966 AGGGTGTGGGGGCGGGGAAGTGG + Intergenic
1121438139 14:93932335-93932357 GGGGTGAGTGGGAGGTGTAGGGG - Intergenic
1121485714 14:94312832-94312854 GAGCTGGGGAGGAGGGGAAGGGG + Intronic
1121705261 14:95988461-95988483 GGGGTATGGAGAAGGTGGTGGGG - Intergenic
1121779677 14:96614233-96614255 GGTGTGTGGGGGATGTGGAGAGG - Intergenic
1121821849 14:96976057-96976079 GGGAAGTGGAAGAGGTAAAGAGG - Intergenic
1121887285 14:97555289-97555311 GGGCAGTGGGGGAGATGAAGAGG - Intergenic
1122000378 14:98646008-98646030 GGGATGTGGAGGAGGAGACAGGG - Intergenic
1122030448 14:98908074-98908096 GGGGGCTGGAGGAGGGGCAGGGG - Intergenic
1122367599 14:101203372-101203394 GGAGCTTGGAGGAGGTGAGGTGG - Intergenic
1122611259 14:102984982-102985004 GGGGTGGAGTGGAGGTGAGGAGG + Intronic
1122611272 14:102985033-102985055 GGGGTGGTGTGGAGGTGAGGAGG + Intronic
1122611285 14:102985084-102985106 GGGGTGGTGTGGAGGTGAGGAGG + Intronic
1122611321 14:102985237-102985259 GGGGTGGTGTGGAGGTGAGGAGG + Intronic
1122800886 14:104228977-104228999 GGGCTGTGGAGGGGGAGCAGCGG + Intergenic
1202863992 14_GL000225v1_random:103945-103967 GGGGTGTGGCGGTGGGGAGGGGG + Intergenic
1123696904 15:22884969-22884991 GGGGTGGGGAGGTGGGGGAGGGG + Intronic
1123828405 15:24106873-24106895 TTGGTGTGGATGAGGTGAAAAGG - Intergenic
1123843313 15:24270454-24270476 TTGGTGTGGATGAGGTGAAAAGG - Intergenic
1123863023 15:24487136-24487158 TTGGTGTGGATGAGGTGAAAAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124439170 15:29674725-29674747 GGGGTGTGGAGGAGGGAAGGAGG + Intergenic
1124682034 15:31740158-31740180 AGGATGTGGAGGAGGTGAGCTGG + Intronic
1124900338 15:33816829-33816851 GGGGTGAGAGGGAGGTCAAGAGG - Intronic
1125137193 15:36357532-36357554 GGAGAGTGGAGGAGGGGAGGAGG - Intergenic
1125180486 15:36877614-36877636 GAGGTGTGGAGGGGGCTAAGAGG + Intergenic
1125547271 15:40515274-40515296 AGGGTGGGGAGGAGGAGAAGGGG - Intergenic
1125553496 15:40565333-40565355 AAGTTGTGGAGGAGGTGAACTGG - Intergenic
1125591550 15:40857442-40857464 TGGGTGAAGAGGAGGGGAAGAGG + Exonic
1125677296 15:41509263-41509285 TGGGAGTGAAGGAGGTGAGGAGG + Intronic
1125800903 15:42445937-42445959 GGAGTGTGGAGGTGGGGCAGCGG + Intronic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1125991553 15:44113690-44113712 GAAGTGGGGAGGAGGGGAAGCGG - Intronic
1126197747 15:45950743-45950765 GGGGAGGGCAGGAGGTGAGGCGG - Intergenic
1126950272 15:53873103-53873125 GGTGTGTTGAGGAGGAGAAGGGG + Intergenic
1127165648 15:56243370-56243392 GGGGAGAGGAGGAGGGGGAGGGG + Intergenic
1127559161 15:60118587-60118609 GGGCTGTGGTGGAGGTGATTTGG - Intergenic
1127638568 15:60893953-60893975 GGGCTGTGAAGAAGATGAAGGGG - Intronic
1127658720 15:61080183-61080205 GGGGTTTGGAGGTAGGGAAGTGG - Intronic
1128114193 15:65095082-65095104 GGGGTGTGGGGTAGGCAAAGAGG + Intronic
1128223027 15:65982151-65982173 GGAGGGTAGAGGAGGTGGAGGGG - Intronic
1128386188 15:67150310-67150332 GGGGTTGGGGAGAGGTGAAGAGG - Intronic
1128454646 15:67825720-67825742 GGGGCTTGGGGGAGGAGAAGGGG - Intronic
1128512840 15:68324193-68324215 GGGGTGTGGAGGGGCTGTGGGGG + Intronic
1128517805 15:68354095-68354117 CGGGAGTGGAGCAGGTGCAGAGG - Intronic
1128530449 15:68441558-68441580 GTGGTGTGGAGGAGGGGTGGAGG + Intergenic
1128554690 15:68623476-68623498 GGGGTGGGGTGGGGGTGAGGAGG - Intronic
1128622312 15:69160910-69160932 GGGGCGAGGAGGCGGTGCAGTGG + Intronic
1128758419 15:70198546-70198568 AGGGTGGGGAGGAGGTGGGGTGG + Intergenic
1128914205 15:71544996-71545018 GGGGCTTGGAGGAGGGGAAATGG + Intronic
1129219900 15:74126090-74126112 AGGGGGTGGTGGTGGTGAAGAGG + Intronic
1129382799 15:75178527-75178549 GGGGTTGGGGGGAGGTGCAGGGG + Intergenic
1129454026 15:75667013-75667035 GGGGTGTGAAGGGGTGGAAGAGG + Intergenic
1129539081 15:76336643-76336665 GGGATGCGGGGGAGGTGATGGGG - Intergenic
1129596424 15:76967792-76967814 GGGGTGAGGAGGGGGTGAGGAGG - Intergenic
1129596429 15:76967803-76967825 GGGGTGGGGAGGGGGTGAGGAGG - Intergenic
1129685156 15:77681776-77681798 GGGGAGTGGAGGAGGGAAAGTGG + Intronic
1129976995 15:79830915-79830937 TGGGTATGGAGGGGGAGAAGGGG + Intergenic
1130229610 15:82086716-82086738 GGGGTGGGGAGTAGGAGAGGAGG + Intergenic
1130402964 15:83574308-83574330 GGGGTGTGCAGGTGGGGAATGGG - Intronic
1130770086 15:86915630-86915652 GCGGTGGGGGGGAGGTGAAGAGG - Intronic
1131229015 15:90646978-90647000 GGGGTGTGCAGGAGGAGGAGAGG - Intergenic
1131229147 15:90647414-90647436 GGGGTGTGGTGGAGGAGAAGGGG - Intergenic
1131229174 15:90647492-90647514 GGGGTGTGGAGGATGAGGAGGGG - Intergenic
1131229223 15:90647627-90647649 GGGGTGTGGAGGATGAGGAGGGG - Intergenic
1132107145 15:99071199-99071221 GGGGTGTGGAGCAGGTGAGGAGG + Intergenic
1132256565 15:100381676-100381698 GGCAGGTGAAGGAGGTGAAGGGG - Intergenic
1132433571 15:101779207-101779229 GAGGAGTGGAGTAGGGGAAGAGG + Intergenic
1132523091 16:400449-400471 GGGGTGGGGCAGAGGTGAACAGG - Exonic
1132613428 16:828853-828875 GGGGTGAGGACGGGGTGAAGAGG + Intergenic
1132663746 16:1072668-1072690 CGGGAGTCGAGCAGGTGAAGCGG + Intergenic
1132695032 16:1198289-1198311 GGGGTGTGGAGGGGCAGGAGTGG - Intronic
1132745484 16:1434558-1434580 GGGGTGGGGCGGGGGTGCAGGGG - Intronic
1133034401 16:3026981-3027003 GGGGAGGGGAGGAGGGAAAGAGG - Intronic
1133280840 16:4664346-4664368 GGGGGCTGGAGGAGGGGATGGGG + Intronic
1133301194 16:4783869-4783891 GGGGCAGGGAGGAGGAGAAGGGG - Intronic
1133301989 16:4788029-4788051 GGAGTGTGTATGGGGTGAAGTGG + Intronic
1133520262 16:6549470-6549492 GGAGGGAGGAGGAGGGGAAGAGG + Intronic
1133984106 16:10654928-10654950 GGGGGGTGGGGGAGGGGAGGGGG - Intronic
1134066600 16:11232469-11232491 GGGGGGAGGAGGAGGGGGAGGGG + Intergenic
1134235005 16:12458753-12458775 GGCGTGTGCAGGAAGAGAAGGGG - Intronic
1134241575 16:12510717-12510739 GGGGGGTGGGGGAGGAGAGGAGG - Intronic
1134587918 16:15428060-15428082 GGGGGGGTGAGGGGGTGAAGGGG + Intronic
1134663042 16:15998472-15998494 GGGCTGTGATGGAGGTGATGTGG + Intronic
1134800176 16:17077007-17077029 GGGGGGTGGAGAAGGTAAAGGGG - Intergenic
1134802034 16:17093617-17093639 GGGGTGGGCAGGGGGTGATGTGG + Intergenic
1135516648 16:23141195-23141217 GCGGGATGGAGGAGGTGGAGAGG - Intronic
1135728676 16:24876568-24876590 GGGGTGAGGGGGAGCAGAAGGGG + Intronic
1135901633 16:26465156-26465178 GGGGTGTGGGGGAGGTGGGGGGG - Intergenic
1136036412 16:27543925-27543947 GGAGTGAAGGGGAGGTGAAGAGG + Intronic
1136085215 16:27880142-27880164 GGGGCTTGGAGGGGGTGGAGAGG - Intronic
1136106781 16:28035861-28035883 GGGGTCTGGAAGCAGTGAAGTGG - Intronic
1136169864 16:28482434-28482456 GGGGTGTGGAGGTGGCGATTGGG - Intronic
1136271049 16:29148502-29148524 TGGGTGTGGAGGAGCAGGAGGGG - Intergenic
1136419499 16:30123111-30123133 GGGAGGTGGAGATGGTGAAGGGG - Exonic
1137084222 16:36101325-36101347 GGTCTGTGGAGGGGGTGACGCGG - Intergenic
1137230391 16:46560197-46560219 GTGGTGAGGTGGAGGAGAAGGGG - Intergenic
1137267412 16:46880660-46880682 AGGGTGTGGGGGATGGGAAGTGG - Intergenic
1137520347 16:49189864-49189886 GAGATGGGGAAGAGGTGAAGAGG - Intergenic
1138144246 16:54594943-54594965 GGGGTGGGGAGGGGGGGAGGTGG - Intergenic
1138360273 16:56422472-56422494 GGGAGGTTGAGAAGGTGAAGAGG - Intronic
1138399435 16:56733444-56733466 TGAGTGTTGAGGAGGTGAAAGGG + Intronic
1138438040 16:57017206-57017228 GGGGAAAAGAGGAGGTGAAGGGG - Intronic
1138449668 16:57086123-57086145 GGCATGTGAAGGAGGCGAAGGGG - Intergenic
1139438725 16:66952961-66952983 GGGGACTTCAGGAGGTGAAGGGG - Intergenic
1139701387 16:68710110-68710132 GGGGCGGGAAGGAGGGGAAGTGG + Intronic
1139946264 16:70644691-70644713 AGGGTGAGGAGGAGGAGGAGGGG + Intronic
1140188729 16:72796532-72796554 TGGGGGTGGAGGGGGTGGAGGGG + Exonic
1140222532 16:73054350-73054372 CGGGTGTGGGGGAGGGGAACCGG - Intronic
1141027387 16:80561096-80561118 GAGGGTTGGAGGAGGTGTAGGGG - Intergenic
1141038483 16:80650975-80650997 GGGGGGCGGGGGAGATGAAGTGG + Intronic
1141155504 16:81594020-81594042 AGGGGGAGGAGGAGGAGAAGGGG - Intronic
1141181223 16:81754362-81754384 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181234 16:81754383-81754405 GGGGAGGGGAGGAGGTGGGGAGG - Intronic
1141181245 16:81754404-81754426 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181256 16:81754425-81754447 GAGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181261 16:81754436-81754458 GTGGTGGGGAGGAGGTGGGGAGG - Intronic
1141266148 16:82499156-82499178 GGGGTGGGGGGGAGGGGGAGGGG - Intergenic
1141466368 16:84208427-84208449 GGGGTGTGGAGGGGAGGAAGAGG + Intergenic
1141512277 16:84520142-84520164 CAGGTCTGGAGGAGGTGGAGAGG - Intronic
1141584135 16:85021795-85021817 GGGGAGGGGAGGAGGAGGAGAGG + Intergenic
1141610631 16:85179156-85179178 GGTGGGTGGAGGAGGCGACGGGG - Intronic
1141620613 16:85235078-85235100 GGGGTGAGGTGGAGGGGCAGGGG + Intergenic
1141632269 16:85294675-85294697 GGGGTGGGGAGGGAGGGAAGGGG - Intergenic
1141703589 16:85653216-85653238 GGGGGGAGGAGGAGGAGGAGGGG - Intronic
1141788755 16:86218756-86218778 GGGGTGGGGTGGGGCTGAAGAGG - Intergenic
1142074663 16:88110507-88110529 TGGGTGTGGAGGAGCAGGAGGGG - Intronic
1142137843 16:88459772-88459794 AGGGGGAGGAGGAGGGGAAGGGG - Intronic
1142240356 16:88941854-88941876 GGGGTGTGGGGGGGGTGGGGAGG + Intronic
1142254431 16:89006960-89006982 GGAGTGGGGAGGAGATGGAGGGG - Intergenic
1142254459 16:89007038-89007060 GGAGTGGGGAGGAGATGGAGGGG - Intergenic
1142254497 16:89007151-89007173 GGAGTGGGGAGGAGATGGAGGGG - Intergenic
1142348832 16:89570720-89570742 GGGGATTGGAGGAGGTGAGCGGG + Intergenic
1142743594 17:1943838-1943860 GGGGTGTGCAGGATGGGCAGGGG + Intronic
1142883173 17:2896673-2896695 GGGCTGTGGAGGGGCTGCAGAGG + Intronic
1143109419 17:4545004-4545026 GGTGAGTGGGGGAGGTGGAGGGG - Exonic
1143117686 17:4589891-4589913 GGGTTGAGGAAAAGGTGAAGAGG - Intronic
1143128400 17:4659870-4659892 CGGGTGTGTAGGAGGTAAAAGGG - Intergenic
1143178398 17:4969343-4969365 GGGGTGGGGAGGAGGGACAGGGG + Intronic
1143431946 17:6894191-6894213 GGGGAGAGGTGGAGGTGAGGAGG - Intronic
1143614079 17:8039318-8039340 TGGATGGGGTGGAGGTGAAGGGG + Intronic
1143635546 17:8162294-8162316 GAGGTTTGGAGGGGGTGCAGGGG + Exonic
1143706134 17:8698826-8698848 GGGGAGAGGAGGAGTGGAAGTGG + Intergenic
1143863692 17:9908935-9908957 GGGGTATGGAGAAGGTGGCGGGG + Intergenic
1144110590 17:12027772-12027794 GGGTTGTGGCAGAGGTGTAGAGG + Intronic
1144353510 17:14422438-14422460 GGGGTGTGGAGTGGGGGGAGTGG - Intergenic
1144465675 17:15495043-15495065 GGGGGGTGGAGGAGAGGAGGAGG + Intronic
1144579572 17:16450769-16450791 GGGGTGGACAGGAGGTGGAGAGG + Intronic
1144623485 17:16832714-16832736 TGGATCTGGAGGAGGTGAACTGG + Intergenic
1144690576 17:17260079-17260101 GGTATTTGGAGCAGGTGAAGAGG - Intronic
1144736990 17:17560828-17560850 GGGGTGAGGTGGAGGTGGGGAGG - Intronic
1144746804 17:17621449-17621471 AGGGGGAGGAGGAGGAGAAGGGG + Intergenic
1144851061 17:18244186-18244208 GGTGTGTGGAGGGGGGGAGGTGG - Exonic
1144882946 17:18440002-18440024 TGGATCTGGAGGAGGTGAACTGG - Intergenic
1145149285 17:20504384-20504406 TGGATCTGGAGGAGGTGAACTGG + Intergenic
1146271961 17:31490411-31490433 TGGGTAAGGAGGGGGTGAAGGGG + Intronic
1146519338 17:33514371-33514393 GGGGTGTGGAAGAGAGGATGGGG - Intronic
1146537612 17:33666646-33666668 GGTGGGTGGAGGAGGTGGACTGG - Intronic
1146594484 17:34157113-34157135 GGGGCCTGGAGGAGGAGGAGAGG - Intronic
1146624739 17:34426651-34426673 AGGGTGGGGAGGAGGTGAGAAGG - Intergenic
1146659040 17:34652434-34652456 GGGGAAGGGAGGAGGTGATGGGG - Intergenic
1146836909 17:36118292-36118314 GGGGTGTGGTGCAGCTGAAAAGG + Intergenic
1146928447 17:36761572-36761594 AGGGTGGGGAGGAGGGGACGAGG - Intergenic
1147455670 17:40536662-40536684 GTGGGGAGGAGGAGGTGAGGAGG + Intergenic
1147457764 17:40549020-40549042 GGTGTGTGGAGGAGGGCAGGTGG + Intergenic
1147460318 17:40564099-40564121 GGGTGGTGGAGGGGGTGCAGGGG + Intronic
1147568551 17:41552662-41552684 AGGGTGAGGAGGGGCTGAAGAGG - Intergenic
1147766910 17:42843138-42843160 AGGGTGAGGAGGAGGGGCAGTGG - Exonic
1147791009 17:43014306-43014328 GGGGTGGGGAGGATGAGAAGGGG - Exonic
1147892189 17:43725207-43725229 AGAGTGTGTAGGAAGTGAAGGGG + Intergenic
1147961569 17:44170807-44170829 GCAGCATGGAGGAGGTGAAGGGG - Exonic
1148111477 17:45147042-45147064 GGTGTGTGGCGAAGGAGAAGTGG + Intergenic
1148127934 17:45246477-45246499 TGGGGGTGGGGCAGGTGAAGGGG - Intronic
1148218772 17:45848387-45848409 GGGGTTTGGAGGGGTGGAAGAGG - Intergenic
1148800046 17:50219082-50219104 GGGGTGGTGAGGAGCTGAGGTGG + Intergenic
1148864621 17:50622161-50622183 GGGGTGGGGAGGAGGGGAACAGG - Intronic
1148905835 17:50911624-50911646 GGGGTGAGGAGGAGGGGACAGGG - Intergenic
1148964430 17:51422764-51422786 GAGGTGTGGAGGAGGATTAGGGG + Intergenic
1149445267 17:56708363-56708385 GGGCTTTGGAGGAGGGGAAGGGG - Intergenic
1149469669 17:56905833-56905855 GGAGAGTGGGGGTGGTGAAGGGG + Intronic
1149591670 17:57834474-57834496 GGTGAGTGGAGGAGGGGATGGGG - Intergenic
1149659789 17:58328192-58328214 GGGGTAGGGAGGATGTGCAGAGG + Intronic
1149983453 17:61329742-61329764 AGGGTGAGGAGGAGGAAAAGGGG + Intronic
1150001842 17:61445188-61445210 GGGGTGTGGGGTAGGAGAAGAGG + Intergenic
1150580898 17:66473065-66473087 GGGGAGTGGAGGAGGAGAGGTGG - Intronic
1150582957 17:66491967-66491989 GGGGTGTTGGGGAGGAGAGGGGG + Intronic
1150633952 17:66899466-66899488 AGTGTGAGGAGGAGGTGAAGAGG + Intergenic
1150765127 17:67996259-67996281 GGGGTGTGGAGAAGGGGTTGGGG - Intergenic
1150993158 17:70284419-70284441 GGGGTGAGGAGGAAGGGAATAGG - Intergenic
1151133303 17:71920949-71920971 AGGGAGTGCAGGAGGAGAAGTGG + Intergenic
1151159284 17:72151073-72151095 GGGGAGGGGAGGTGGGGAAGGGG + Intergenic
1151221665 17:72617166-72617188 GGGCTGTGGAGGAGTTGGGGAGG + Intergenic
1151251034 17:72835396-72835418 GGGAAGAGGAGGAGGTGGAGGGG + Intronic
1151353128 17:73543224-73543246 GGGGAGGGGAGGAGGAGGAGAGG + Intronic
1151452031 17:74203801-74203823 AGGGTGTCGGGGAGGAGAAGGGG + Intronic
1151627692 17:75287787-75287809 GGTGTGTGCAGGAGGGGAAAGGG - Intronic
1151850044 17:76684782-76684804 GGGGTGTGGAGGGGGTGGGGGGG + Intronic
1151935203 17:77257128-77257150 TGGGGATGGAGGAGGTGATGGGG - Intergenic
1151935217 17:77257172-77257194 TGGGGATGGAGGAGGTGATGGGG - Intergenic
1151935242 17:77257267-77257289 TGGGAATGGAGGAGGTGATGGGG - Intergenic
1151935263 17:77257338-77257360 TGGGAATGGAGGAGGTGATGAGG - Intergenic
1151999922 17:77638783-77638805 GGGGTGGGGTGGGGGGGAAGCGG + Intergenic
1152317627 17:79590117-79590139 GGGGTGGGGAGGCGGTGTTGGGG - Intergenic
1152336050 17:79700727-79700749 GGGGCGTTTAGGAGGTGATGAGG + Intergenic
1152772905 17:82181082-82181104 GGAGTTTGGAGAAGCTGAAGTGG + Intronic
1152795606 17:82304653-82304675 GGGGTGGGGAGCAGGGGGAGGGG - Intergenic
1152853103 17:82648837-82648859 GGGGCGGGGAGGAGGGGGAGGGG + Intergenic
1152925091 17:83083633-83083655 GGGGTGGGGAGAGGGTGAGGAGG + Intronic
1153661748 18:7331909-7331931 GGGGTGTGGAGGAAGGGGAGGGG - Intergenic
1153715205 18:7840072-7840094 GGGGTGGGGTGGAGGTGGGGGGG + Intronic
1153759018 18:8312288-8312310 GGGGTTTGGGGGAGGTGAGCTGG - Intronic
1153805185 18:8704956-8704978 GGGAAGAGGCGGAGGTGAAGTGG - Intergenic
1153972492 18:10239166-10239188 GCGGTGGGGAGGAGGAGGAGAGG + Intergenic
1154316797 18:13310613-13310635 GGGAGGAAGAGGAGGTGAAGGGG - Intronic
1154447831 18:14449637-14449659 GGGGGGGGGGGGGGGTGAAGGGG - Intergenic
1155270490 18:24137082-24137104 GGGGTGTGGGAGAGGGGCAGTGG + Intergenic
1155457304 18:26031823-26031845 TGGGTGTGAAGGAAGTGTAGTGG + Intronic
1155545114 18:26906811-26906833 GAAGTGTTGGGGAGGTGAAGGGG + Exonic
1156036836 18:32773574-32773596 GGGGTGGGGGGGAGGTGTGGGGG - Exonic
1156193974 18:34752210-34752232 GTCATATGGAGGAGGTGAAGAGG - Intronic
1156265296 18:35482594-35482616 GTGGAGAGGATGAGGTGAAGGGG - Intronic
1156875185 18:42001986-42002008 ATGGTGTGCAGGAGGTGTAGAGG + Intronic
1157046684 18:44108593-44108615 AGGATGTGGAGGAGGTGAAAGGG - Intergenic
1157239682 18:45997647-45997669 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1157334967 18:46731472-46731494 GGGGCGAGAGGGAGGTGAAGGGG - Intronic
1157358965 18:46961297-46961319 GGGGTGGGTAGCAGGAGAAGTGG + Intronic
1157414536 18:47490851-47490873 TGGGGGTGGAGGATGTCAAGGGG - Intergenic
1157475524 18:48021162-48021184 GAGGAGAGGAGGAGGAGAAGGGG - Intergenic
1157570199 18:48707105-48707127 GGGGAGTGCAGGAGGTGGAGGGG + Intronic
1158003069 18:52641723-52641745 GTGGTGTGGATGTGGTGAACGGG + Intronic
1158358960 18:56650678-56650700 GGGACGTGAAGTAGGTGAAGTGG - Intronic
1158413548 18:57229851-57229873 GGGGAGTGGGGGAGCTGGAGAGG + Intergenic
1158433980 18:57420371-57420393 TGGCTGTGGTGAAGGTGAAGGGG - Intergenic
1158610362 18:58935094-58935116 GGAGTGGGGAGGAGGAGGAGTGG - Intronic
1158610368 18:58935110-58935132 GGAGTGGGGAGGAGGAGGAGTGG - Intronic
1158610374 18:58935126-58935148 GGAGTGGGGAGGAGGAGGAGTGG - Intronic
1158610380 18:58935142-58935164 GGAGTGGGGAGGAGGAGGAGTGG - Intronic
1158610386 18:58935158-58935180 GGAGTGGGGAGGAGGAGGAGTGG - Intronic
1159258482 18:65979442-65979464 GGGAGGTGGGAGAGGTGAAGTGG + Intergenic
1160063418 18:75552059-75552081 AGGGGGTGGTGGAGGAGAAGGGG + Intergenic
1160158251 18:76450334-76450356 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1160254404 18:77235599-77235621 TGGGTGGGGAGGAGACGAAGAGG - Intergenic
1160293517 18:77617019-77617041 GGGGTGTGCAGGAGGCCATGGGG + Intergenic
1160394910 18:78564055-78564077 GGGGGGTGTGGGAGGTGAGGGGG - Intergenic
1160409554 18:78666670-78666692 GGGGTGTGCAGGAGAGGAAGGGG + Intergenic
1160478472 18:79216381-79216403 GGAGGGTGGAGAGGGTGAAGAGG - Intronic
1160600449 18:80008638-80008660 GGGGTGGGGTGGAGGAGAACGGG - Intronic
1160679041 19:404693-404715 GGGGTGTGGAGGGGGGAACGGGG + Intergenic
1160688230 19:447296-447318 GGGATGGGGAGGGGGTGGAGGGG + Intronic
1160853499 19:1205920-1205942 CGCGTGTGGAGGAGGCGGAGCGG - Intronic
1160872079 19:1282216-1282238 GGGGGGAGGAGGGTGTGAAGGGG + Intergenic
1160904090 19:1444364-1444386 GGGGTGTCCAGGAGGTGGGGTGG + Intergenic
1160969891 19:1762872-1762894 GGGAGGTGGAGGAGGGGAGGAGG - Intronic
1161271025 19:3389351-3389373 GGGGAGTGGAGGGTGGGAAGGGG + Intronic
1161409870 19:4111123-4111145 GGGGGCTGGAGGAGGGGATGGGG + Intronic
1161415725 19:4145431-4145453 GAGGTGGGGAGGAGGGGAAGAGG + Intergenic
1161451763 19:4350270-4350292 GAGGTGGGGAGGATGGGAAGGGG + Intronic
1161642866 19:5435340-5435362 GGGTTGTGGGGGAGGTGGATCGG - Intergenic
1161649878 19:5477937-5477959 GGGGAGAGGAGGGGGTGAGGAGG - Intergenic
1162024277 19:7884704-7884726 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1162087111 19:8255587-8255609 GGGCTGGGGAGGGGGTGATGAGG - Exonic
1162292857 19:9792408-9792430 GGGGTGGGGATTAGGTGATGGGG - Intronic
1162315665 19:9936614-9936636 GGGGGGTGGGGGCGGGGAAGTGG + Intergenic
1162433441 19:10642978-10643000 GGAGTGCGGAGGAGGGGAAGCGG + Intronic
1162529838 19:11229421-11229443 TTAGTGTGGATGAGGTGAAGGGG + Intronic
1162784185 19:13023924-13023946 GGGGGGAGGAGGAGGAGCAGGGG - Intronic
1162792055 19:13068281-13068303 GGGGTGCTGAAGAGGTGAGGGGG + Intronic
1162792772 19:13071678-13071700 GGGATGGGGTGGAGGGGAAGTGG + Intronic
1163166137 19:15499481-15499503 TGTGTGTGGAGGAGGGGAGGGGG + Intergenic
1163250735 19:16125044-16125066 GGGGTGAGCAAGGGGTGAAGAGG + Intronic
1163398227 19:17076259-17076281 GGGGTGCGGTTGAGGGGAAGGGG + Intronic
1163454661 19:17399380-17399402 GGTGAGTGGAGGAGGTCACGTGG + Intergenic
1163520375 19:17788235-17788257 GGGGTGGGGAGGAGGGGTACGGG - Intronic
1163554700 19:17985244-17985266 GGGGTGTGATGGAGGCAAAGGGG + Intronic
1163637823 19:18445541-18445563 GGGGTGGGGAGGGGGTGGGGGGG + Intronic
1163698099 19:18774165-18774187 GGGGTGTGGAGGCGAGGAGGGGG - Intronic
1163759914 19:19130569-19130591 GGGATGTGAAGTAGGTGAGGTGG - Intronic
1164292543 19:23880908-23880930 GAGGAGTAGAGGAGGAGAAGAGG + Intergenic
1164292670 19:23881705-23881727 GAGGTGAGGAGGAGGAGAAAAGG + Intergenic
1164528939 19:29032724-29032746 GGGGTGTGGAGGTGGAGAAAAGG + Intergenic
1164581391 19:29437568-29437590 GGGGTGAGGGAGAGGTGAGGTGG - Intergenic
1164845924 19:31432540-31432562 GGGGTGTGAAGGAAGTGCTGTGG - Intergenic
1164946163 19:32294940-32294962 GGGGTGGGCAGGAGGTCAAGAGG + Intergenic
1165078965 19:33296905-33296927 GGGGCGTGGGGGAGGGGGAGAGG + Intergenic
1165420651 19:35720576-35720598 GAGGGGTGGAGGAGGTGAAGGGG - Exonic
1165434332 19:35788122-35788144 GGGGTGGGCAGGAGGGGAAGAGG - Exonic
1165435642 19:35793269-35793291 GGGCTGTGGAGGATGGGAATTGG - Intergenic
1165712783 19:38024021-38024043 GGGGGGTGGACGAGGTAAAGGGG + Intronic
1165831623 19:38733477-38733499 GGGGTGGGGAGGACATGAAAGGG - Intronic
1165993213 19:39827472-39827494 GGGGTGTGCTGGAGGTGGAGGGG - Intronic
1166012270 19:39951262-39951284 GGGTTGTTGAGGAGTAGAAGGGG + Intergenic
1166110089 19:40616862-40616884 AGAGTGTGGAGGAGATGAAAGGG - Intronic
1166273603 19:41734815-41734837 GTGGGGTGGAGGAGCTGAAAAGG + Intronic
1166300441 19:41909486-41909508 GTGGTGTTGGGGAGGTGCAGGGG + Intronic
1166347665 19:42176616-42176638 GGGACGGAGAGGAGGTGAAGAGG - Intronic
1166367055 19:42283217-42283239 GGGGTGTGGAGTGTGTGTAGTGG + Intronic
1166547094 19:43640015-43640037 GGGGTGAGGAGGGCGGGAAGGGG + Intergenic
1166646131 19:44533079-44533101 TGGATGGGGAGGAGGGGAAGAGG - Intergenic
1166807334 19:45495068-45495090 GTGGTGGGGAGCATGTGAAGGGG - Intronic
1166855901 19:45782519-45782541 GGGGTGGGGAGAAGGGGAGGAGG - Intronic
1166867948 19:45852436-45852458 GGGGTGTGGTGTAGGGGAAAGGG - Intronic
1166975355 19:46602184-46602206 GGGTCGTGGAGGTGGTGAAAAGG + Intronic
1166983855 19:46648592-46648614 TGGGGGTGGAGCAGGTGCAGGGG - Exonic
1167037508 19:47002883-47002905 GGAGTGTGGAGGGGGTGGTGAGG + Exonic
1167130485 19:47582157-47582179 GGGGGGAGGAGGAGGAGAGGAGG - Intergenic
1167145079 19:47676533-47676555 GGGGGGAGGAAAAGGTGAAGGGG - Intronic
1167374553 19:49103881-49103903 GGGGTGTGGAGGGCGAGATGGGG + Intronic
1167465874 19:49651003-49651025 TGGGGGTGGGGGAGGGGAAGGGG - Exonic
1167566679 19:50261409-50261431 GGGGAGTGGGGGTGGTGAGGAGG - Intronic
1167620194 19:50556261-50556283 GGGGTGGGGGTGAGGTGCAGTGG + Intronic
1167698784 19:51030243-51030265 GGGGAATGGAGGAGGGGGAGGGG - Intronic
1167703508 19:51065104-51065126 GGCCTGAGGAGAAGGTGAAGGGG + Exonic
1167762190 19:51456974-51456996 GGTGTGTGGAGGAGTCTAAGGGG + Intronic
1167768310 19:51498979-51499001 TGTGTGTGGAGGAGTTCAAGGGG + Intronic
1168038634 19:53740252-53740274 GGGGTCAGGTAGAGGTGAAGGGG + Intergenic
1168063798 19:53908485-53908507 GGGGTGTCGCGGCGGTGATGAGG - Intergenic
1168287706 19:55342701-55342723 GGGGTGAGGAGGCGGGGCAGGGG - Intronic
1168317638 19:55490980-55491002 GGGGTGTGGAGGAGGAGAACAGG + Exonic
1168336679 19:55600882-55600904 GGGGTGTAACGGAGGGGAAGGGG - Intronic
1168338142 19:55608153-55608175 AAGATGGGGAGGAGGTGAAGGGG + Intronic
1168338397 19:55609966-55609988 AGGGTGTGGAGATGCTGAAGGGG - Intronic
1168471300 19:56643055-56643077 CGGGGGTGGAGGAGGGGAGGAGG + Intergenic
1168726533 19:58585723-58585745 GGGGAGGGGAGGAGGGGAAGAGG - Intergenic
924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG + Intergenic
925418469 2:3690420-3690442 GGGGAGGGGGGGAGGGGAAGGGG - Intronic
925420138 2:3704351-3704373 GGGGTGTGGAGGAGGGCGTGGGG + Intronic
925420227 2:3704549-3704571 CGGGTGTGGAGGAGGGCATGGGG + Intronic
925691160 2:6524929-6524951 GGGGTGTGGGGGATCTGAAAGGG - Intergenic
925755399 2:7128100-7128122 GGGGAGGGGAGGAGGGAAAGGGG - Intergenic
925902090 2:8515950-8515972 GGGAGGTGGAGGAGGGGAAGGGG - Intergenic
925918681 2:8624888-8624910 GGGGTGCGAAGCAGCTGAAGTGG - Intergenic
926063629 2:9820359-9820381 GGGGCGGGGAGCAGGTGCAGGGG + Intergenic
926173455 2:10568811-10568833 GGGATCTGGAGCAGGGGAAGGGG + Intergenic
926334997 2:11856399-11856421 CGGAAGGGGAGGAGGTGAAGGGG + Intergenic
926337632 2:11876185-11876207 GTGGTGTGGAGGTGGTGAGTAGG + Intergenic
926451165 2:13005943-13005965 GGGCTGTGGAGGAGGAACAGAGG - Intergenic
927555054 2:24025298-24025320 TGGGAGGGGAGGAGTTGAAGAGG + Intronic
927650114 2:24907463-24907485 GTGTTGTGGAGGAGAGGAAGGGG + Intronic
927661953 2:25000893-25000915 GGGAGGTGGAGAAGGTGGAGAGG + Intergenic
927863374 2:26574159-26574181 GGGATGTAGAGGAGGTGATGGGG + Intronic
927875641 2:26653611-26653633 GGGGTGTGGCTGGGGTGCAGTGG - Intergenic
928022625 2:27716039-27716061 GGGGAGGGGAGGAAGGGAAGGGG - Intergenic
929067988 2:37999634-37999656 GGGAAGTGGAGGAGATGAAAGGG + Intronic
929083430 2:38144798-38144820 CAGGTTTGGAGGAGGTGATGAGG - Intergenic
929150501 2:38743460-38743482 AAGGTGTGGAGGAGGGGTAGGGG - Intergenic
929580936 2:43081451-43081473 GGGGTGTGGCGGGGGTGTGGTGG - Intergenic
929582110 2:43087951-43087973 GGGGTGAGCAGCAGGTGAGGAGG + Intergenic
929889997 2:45910937-45910959 TGGGTGTGTAGGAGGAGAATGGG + Intronic
930136271 2:47906230-47906252 GGGGTGTGGGGGGGAGGAAGAGG - Intergenic
930267554 2:49217608-49217630 GGGGTGGGGTGGAGCTGGAGTGG + Intergenic
930474604 2:51865362-51865384 TTGGTGTGGACGAGGTGAAAAGG - Intergenic
931149930 2:59561530-59561552 GGGTTGGTGAGGATGTGAAGAGG - Intergenic
931197248 2:60064340-60064362 GAGGGGTGGAGGAGGAGAGGAGG + Intergenic
931724175 2:65092928-65092950 AGAGTGTGAAGGAAGTGAAGGGG - Intronic
931834295 2:66082678-66082700 GGGATGTAGAGGGAGTGAAGAGG + Intergenic
931869333 2:66441947-66441969 GGAGTCTGGAGGAGGTGGTGGGG + Intronic
931996571 2:67844399-67844421 GGGAGGTGGAGGAGAGGAAGAGG - Intergenic
932338802 2:70946736-70946758 AGAGTGTGGTGGAGGTGGAGAGG - Intronic
932347035 2:71002177-71002199 GGGGTGGGGCGGGGGTGAAGGGG + Intergenic
932429936 2:71668074-71668096 GGGTTTTGGAAGAGGAGAAGGGG + Intronic
932816480 2:74866021-74866043 GGGTTCTGGAGCAGGTGATGTGG + Intronic
933439010 2:82286064-82286086 GGGGTGATGTGGAGGGGAAGGGG - Intergenic
934475166 2:94588654-94588676 GTGGGGAGGAGGAGGTCAAGGGG - Intronic
934609671 2:95725545-95725567 GGGATGAGGAGGAGAAGAAGAGG - Intergenic
934651862 2:96097054-96097076 GGGGCTTGGGGGAGGGGAAGTGG + Intergenic
934851850 2:97706893-97706915 GGGGTGTGGAGGGGGAGCACTGG + Intergenic
934953662 2:98597862-98597884 GAGGGGTGGTGGGGGTGAAGGGG + Intergenic
935708833 2:105879755-105879777 TGAGTGGGCAGGAGGTGAAGAGG - Intronic
936327720 2:111520079-111520101 GGGGCGGGGAGGAGGGGAGGTGG + Intergenic
936524567 2:113234017-113234039 GGAGGGTGTGGGAGGTGAAGAGG + Intronic
936529332 2:113264708-113264730 AGGGAGTGGAGCAGGTGCAGTGG + Intronic
936614682 2:114036207-114036229 TTGGTGTGGATGAGGTGAAAAGG - Intergenic
937083337 2:119155989-119156011 GGGGTTGGGAGGAGGGGAGGAGG - Intergenic
937122241 2:119448918-119448940 GGGGTGGGGAGGGGATGGAGAGG - Intronic
937602266 2:123752934-123752956 GGGAAGTGGGGGAGATGAAGTGG + Intergenic
937668809 2:124517260-124517282 GAGGTGTGGTGGTGGTGATGAGG + Intronic
937682329 2:124657392-124657414 GGGGAATGGAGATGGTGAAGAGG - Intronic
937688912 2:124731542-124731564 GGGGAGAGGAGGAGGAGAAAGGG + Intronic
937943428 2:127309033-127309055 GGGGTGAAGAGGAGGAGAAAGGG + Intronic
937969109 2:127536034-127536056 GGGCTGAGGAGGAGGAGGAGGGG + Intronic
938072444 2:128315866-128315888 AGGGAGTGGAGGCGGAGAAGAGG + Intronic
938688324 2:133762676-133762698 GGGGTGGGGAGGGGGTGAGTGGG + Intergenic
939369716 2:141283428-141283450 GAGGTGGGGAGGTGGTGAGGTGG + Intronic
939787692 2:146537443-146537465 AGGGGGAGGAGGAGGGGAAGGGG + Intergenic
940160586 2:150708346-150708368 GGGGAGGGGAGGAGGGTAAGTGG + Intergenic
941038256 2:160590659-160590681 GGGGAAGGGAGGAGGGGAAGGGG - Intergenic
941038271 2:160590691-160590713 GGGGAAGGGAGGAGGGGAAGGGG - Intergenic
941038280 2:160590710-160590732 GGGGAAGGGAGGAGGGGAAGGGG - Intergenic
941178934 2:162235146-162235168 GCGGTGCGGAGGGGGTGACGGGG - Intronic
941508393 2:166376008-166376030 GAGGAGTGGAGGAGGCAAAGCGG - Intergenic
941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG + Intronic
941819312 2:169828217-169828239 GGGGTGGGGAGGAGAAGGAGGGG + Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
942241095 2:173964659-173964681 GGCGGGTGGGGGAGGGGAAGGGG - Intronic
942487702 2:176456607-176456629 TGGGTGGGGGGGAGGTGAAATGG + Intergenic
942789923 2:179749366-179749388 GGAGTTTGGAGGAGGTGGAAGGG - Intronic
943033216 2:182710505-182710527 GGGATGTGGTGGAGGGGAAAAGG - Intergenic
943105758 2:183544040-183544062 GGGGTGGGGGGGTGGTGGAGAGG + Intergenic
943682879 2:190786387-190786409 GGGGTGGGGAGGAGGGGCGGGGG - Intergenic
943843124 2:192604637-192604659 GGTGTGTGGAGGAGGAGAAGGGG + Intergenic
944154861 2:196598210-196598232 GGGGAAGGGAGGAGGGGAAGGGG + Intergenic
944154901 2:196598291-196598313 GGGGAAGGGAGGAGGGGAAGGGG + Intergenic
944154942 2:196598372-196598394 GGGGAGGGGAGGAGGGGAAGGGG + Intergenic
944154967 2:196598421-196598443 GGGGAGGGGAGGAGGGGAAGGGG + Intergenic
944395714 2:199263695-199263717 GGCATGTGGAGGAGTTGAATCGG + Intergenic
944822051 2:203441033-203441055 TGGGGGTGGAGGAGGGGGAGGGG + Exonic
944989981 2:205224515-205224537 GGGGAGTGGCGGTGGGGAAGTGG - Intronic
945206392 2:207337263-207337285 GGGGGTGGGAGGAGGTGAATAGG - Intergenic
945206479 2:207338066-207338088 GGGGTGTGTCTGAGGTGAATGGG - Intergenic
945219982 2:207473607-207473629 GGGGGGCTGAGGAAGTGAAGGGG + Intergenic
945259791 2:207832790-207832812 CTGGTGTGGGGGAGGTGCAGGGG - Intronic
945483376 2:210367317-210367339 AGGGTGTGCATGAGGTGAGGAGG + Intergenic
945690341 2:213026221-213026243 GGGATGTGGAGGATTTCAAGAGG - Intronic
945823984 2:214698075-214698097 GGGGTGAGGAGTAGGAGGAGAGG - Intergenic
945839287 2:214868785-214868807 GGGGTCTTGGGGAGGTGAACTGG + Intergenic
945906296 2:215597308-215597330 GGGGTGTGGAGGAAGGGCAGAGG - Intergenic
945975153 2:216264632-216264654 GGGGTGTGGAGAGAGAGAAGTGG + Intronic
946073428 2:217053801-217053823 GTGGTGAGGAAGAGGTGAGGGGG - Intergenic
946079973 2:217109476-217109498 GGGGAGTGGAGGTGGTGATGGGG + Intergenic
946117097 2:217472719-217472741 GTGGGGAGGTGGAGGTGAAGGGG - Intronic
946280513 2:218662689-218662711 GGGTTCTGGAGGAAGTGGAGTGG + Intronic
946301802 2:218828472-218828494 GGGAGATGGAGGAGGTGAGGGGG - Intronic
946471966 2:219968993-219969015 GGGGCGTGTGGGAGGTGAGGGGG - Intergenic
946683222 2:222239729-222239751 GGGGTGAGGGGTAGGTAAAGGGG + Intronic
946750452 2:222890260-222890282 GGGGAGTGGAGGAAGAGAAAAGG + Intronic
946889887 2:224264376-224264398 GGCGTATGGAGGAGGGGGAGGGG + Intergenic
947253646 2:228137001-228137023 GGTGTGTGGGAGAGGAGAAGTGG - Intronic
948313420 2:237007799-237007821 GGGGTGGAGAGGGGGTGTAGCGG + Intergenic
948842316 2:240658738-240658760 CTGGTGTGGATGTGGTGAAGAGG + Intergenic
948856313 2:240732122-240732144 GGGGAGGGGAGGAGGGGATGAGG + Intronic
948902658 2:240964229-240964251 GAGGTGAGGAGGGGCTGAAGAGG + Intronic
949062666 2:241970091-241970113 GGGGTGTGGAGTTGATGACGGGG + Intergenic
949062690 2:241970171-241970193 GGGGTGTGGGGTTGATGAAGGGG + Intergenic
1168846557 20:949095-949117 AGCGTGTGAAGGAGGTGAAGGGG + Intergenic
1168878337 20:1185805-1185827 GGGGTGGGGGGAAGGGGAAGTGG - Intronic
1168939258 20:1695039-1695061 GGAGTTTGGAGAAGGTGATGGGG - Intergenic
1169522878 20:6391959-6391981 GGGGTGGGGAGGAGTGGAAGGGG + Intergenic
1169539136 20:6580902-6580924 GGGGTGGGGTTGAGGTAAAGTGG - Intergenic
1169940615 20:10933315-10933337 GGGGTGGGGGGGTGGTAAAGGGG + Intergenic
1170649741 20:18228496-18228518 GGGGTGGGGGGGTGGGGAAGAGG - Intergenic
1170737881 20:19026817-19026839 GGACTGTGGAGGGGGTCAAGAGG - Intergenic
1171216616 20:23356929-23356951 TGGGGGTGGAGGAGATGACGGGG + Intergenic
1172026913 20:31954826-31954848 GAAGTGTGGAGGAGATGAGGGGG + Intergenic
1172269982 20:33649494-33649516 GGGCTGTGGAGGGGGAGGAGGGG - Exonic
1172293057 20:33789861-33789883 GAGGTGTGGACGAGGTGTGGAGG + Intronic
1172446866 20:34997754-34997776 GGGTTGTGTACCAGGTGAAGAGG - Intronic
1172482445 20:35278787-35278809 CGTGTGTGGAGGTGGTGAACTGG + Intergenic
1172502804 20:35439009-35439031 GGGGTAGGGAGGGGGTGTAGTGG - Intronic
1172599102 20:36171442-36171464 TGGGTGGGGAGGAGGTGATGGGG + Intronic
1172900041 20:38328050-38328072 GGGGTGAGAAGAAGTTGAAGCGG - Intronic
1173159050 20:40638962-40638984 GGGGAGAGGAGGTGGTAAAGGGG - Intergenic
1173351096 20:42246301-42246323 GGGGAGGGTAGGAGGAGAAGAGG - Intronic
1173454246 20:43190300-43190322 GGGGTGGGGAACAGGTGAATGGG + Intergenic
1173988178 20:47279045-47279067 TGGGTGTGGAGCAGGTCAGGGGG - Intronic
1174063619 20:47849365-47849387 GGGGTGAGGAGGAGGTGGGGAGG + Intergenic
1174216498 20:48920614-48920636 GGTGTAGGAAGGAGGTGAAGGGG - Intergenic
1174309188 20:49637242-49637264 GGGGTGGGGAGTAGGAGAAGGGG + Intronic
1174491221 20:50897429-50897451 GGGGTGTGGATGAGGACAACAGG - Intronic
1174691408 20:52510254-52510276 GGGGTGTGGGGGTGGTGAGGAGG - Intergenic
1175016159 20:55792931-55792953 ATGGTGTGGATGAGGTGAAAAGG + Intergenic
1175124269 20:56739804-56739826 GGCGTGTGCAGCAGGTGAAGGGG + Intergenic
1175160347 20:57003558-57003580 GAGGTTTGGAGGAGGGGAGGAGG + Intergenic
1175298825 20:57928566-57928588 GGGGGGGGGAGGAGAAGAAGGGG - Intergenic
1175339933 20:58222229-58222251 AGAGTGTGGAGGAGGAGGAGCGG + Intronic
1175402972 20:58711089-58711111 GGGGGGAGGAGGAGGAGGAGAGG - Intronic
1175402987 20:58711120-58711142 GGCGTGGGGAGGAGGAGGAGAGG - Intronic
1175412053 20:58776922-58776944 GAGGCTTGGAGGAGATGAAGTGG - Intergenic
1175491593 20:59384066-59384088 GTGATGGGGAGGAGGTGAATGGG + Intergenic
1175491661 20:59384326-59384348 GTGATGGGGAGGAGGTGAGGGGG + Intergenic
1175498908 20:59435478-59435500 GGGTGGGGAAGGAGGTGAAGAGG - Intergenic
1175578716 20:60082023-60082045 GGTGGGTGGAGGAGGAGGAGGGG + Intergenic
1175633066 20:60558261-60558283 GGGGTGTTGAAAAGGAGAAGAGG - Intergenic
1175755699 20:61528409-61528431 GGGGGGTGGAGGGGGAGAGGAGG + Intronic
1175772550 20:61632819-61632841 GGGGAGAGGAGGAGAGGAAGAGG - Intronic
1175787827 20:61723291-61723313 GGGGTCCGGAGGAGGTGCAGGGG - Intronic
1175825829 20:61936263-61936285 GGGGTGTGGGAGAGGGCAAGGGG - Intronic
1175825871 20:61936365-61936387 GGGGTGTGGGGGAAGGGGAGGGG - Intronic
1175825880 20:61936379-61936401 GGGGTGTGGGGGAGGGGGTGTGG - Intronic
1175829781 20:61956987-61957009 TTGGTGTGGAGGTGGTGAAAGGG + Intronic
1176041923 20:63070243-63070265 GGGGTGGGGAGGAGGAGCAGGGG - Intergenic
1176103728 20:63376046-63376068 GGGGTGTGGGGGTGGTGGGGTGG - Intronic
1176125539 20:63472996-63473018 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1176200029 20:63855911-63855933 GGGGAGGGGAGAAGGTGCAGGGG + Intergenic
1176728673 21:10467435-10467457 GGGGGGTGGAGGCGGGGATGGGG - Intergenic
1177571632 21:22894740-22894762 GGGGTGGGGAGAAGGGGGAGGGG - Intergenic
1177581682 21:23031369-23031391 GGGGGGTGGGGGTGGTGTAGAGG - Intergenic
1178172963 21:30062385-30062407 TGGGTGGGGAGGGGGTGGAGGGG - Intergenic
1178261403 21:31103145-31103167 GGGATGTGGCAGTGGTGAAGAGG - Intergenic
1178584719 21:33862475-33862497 GGGGTTGGGAGAAGGAGAAGAGG + Intronic
1179065678 21:38022578-38022600 GGGCTGTGGGGGTGGTGATGGGG + Intronic
1179093431 21:38289791-38289813 TGAGTGTGGAGGGGGTGAGGAGG - Intronic
1179714342 21:43279980-43280002 GAGGTGAGGTGGAGGTGGAGGGG + Intergenic
1179714372 21:43280061-43280083 GAGGGGAGGAGGAGGTGGAGGGG + Intergenic
1179901196 21:44395691-44395713 GGGCTGTGGAGGATGTGGAGGGG + Intronic
1179901208 21:44395730-44395752 GGGATGTGGAGGCTGTGGAGGGG + Intronic
1179901221 21:44395769-44395791 GGGCTGTGGAGGATGTGGAGGGG + Intronic
1179901233 21:44395808-44395830 GGGATGTGGAGGCTGTGGAGGGG + Intronic
1179901246 21:44395847-44395869 GGGCTGTGGAGGATGTGGAGGGG + Intronic
1179901258 21:44395886-44395908 GGGGTGTGGAGACTGTGGAGGGG + Intronic
1179901264 21:44395905-44395927 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901269 21:44395924-44395946 GGGGTGTGGAAGCTGTGGAGGGG + Intronic
1179901282 21:44395963-44395985 GGGCTGTGGAGGATGTGGAGGGG + Intronic
1179901303 21:44396031-44396053 GGGCTGTGGAGGCTGTGGAGGGG + Intronic
1179901315 21:44396070-44396092 GGGATGTGGAGGCTGTGGAGGGG + Intronic
1179901327 21:44396109-44396131 GGGGTGTGGAGACTGTGGAGGGG + Intronic
1179901333 21:44396128-44396150 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901339 21:44396147-44396169 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901345 21:44396166-44396188 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901351 21:44396185-44396207 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901357 21:44396204-44396226 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901387 21:44396293-44396315 GGGCTGTGGAGGCTGTGGAGGGG + Intronic
1179901393 21:44396312-44396334 GGGGTGTGGAGGATGTGGAGGGG + Intronic
1179901431 21:44396431-44396453 GGGATGTGGAGGCTGTGGAGGGG + Intronic
1179901454 21:44396508-44396530 AGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901460 21:44396527-44396549 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901465 21:44396546-44396568 GGGGTGTGGAGGCTGTGAAGGGG + Intronic
1179901471 21:44396565-44396587 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901482 21:44396604-44396626 GGGTTGTGGAGGCTGTGGAGGGG + Intronic
1179901499 21:44396653-44396675 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901516 21:44396702-44396724 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901540 21:44396771-44396793 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179901557 21:44396820-44396842 GGGGTGTGGAGGCTGTGGAGGGG + Intronic
1179928490 21:44551462-44551484 GGAGTGGGGAGGAGGTGAGCTGG + Exonic
1179929651 21:44558719-44558741 GGGGTGGGGAGGAGGTGAGCTGG + Exonic
1179937988 21:44617109-44617131 GGGGTGTGGAGGAGGTGAGCTGG - Intronic
1179939153 21:44627146-44627168 GGGGTGGGGAGGAGGTGAGCTGG - Exonic
1179939918 21:44630618-44630640 GGGGAGGGCAGGAAGTGAAGGGG + Intronic
1179939924 21:44630637-44630659 GGGGAGGGCAGGAAGTGAAGGGG + Intronic
1179942000 21:44646433-44646455 GGGGTGGGGAGGAGGTGAGCTGG - Exonic
1180053760 21:45346173-45346195 GGGGTGTGTAGCAGGATAAGAGG + Intergenic
1180177531 21:46097939-46097961 GGAGGCTGGAGGAGGTGGAGAGG - Intergenic
1180653638 22:17400363-17400385 GGTGTGTGGAGTAGATGAGGAGG + Intronic
1180872517 22:19154611-19154633 AGGGTGAGGGGGAGGTGAGGGGG - Intergenic
1180875026 22:19171222-19171244 GCGGTGGGGAGCAGGTGAGGCGG + Intergenic
1181333916 22:22115555-22115577 GGGGTGACCAGGAGGAGAAGAGG - Intergenic
1181496370 22:23289432-23289454 GGTGTGTGGTGGAGGTCCAGTGG + Intronic
1181509096 22:23380994-23381016 GTGGTGTGGAAGCGGTGATGGGG + Intergenic
1181711864 22:24696187-24696209 AGGGGGTGGAGGAGGAGAAAGGG - Intergenic
1181792507 22:25278662-25278684 GGGGTGAGGGGGAGGGGGAGAGG + Intergenic
1181792514 22:25278676-25278698 GGGGAGAGGGGGAGGGGAAGAGG + Intergenic
1182148145 22:28010122-28010144 GTTGTGTGGAGAATGTGAAGGGG - Intronic
1182248506 22:28980218-28980240 GGTGGGTGGAGGGGGGGAAGGGG + Intronic
1182386210 22:29943762-29943784 GGGGTTTGGGGGTGGGGAAGGGG - Intronic
1182863763 22:33584275-33584297 GCTTTGAGGAGGAGGTGAAGAGG - Intronic
1183007552 22:34916110-34916132 GGGGTTTGGGGGAGGTGATTAGG + Intergenic
1183335512 22:37243904-37243926 GGGGTGGGGTGGGGCTGAAGAGG + Intronic
1183385413 22:37511394-37511416 GGGGTGAGGAGGAGGAGGGGAGG + Intronic
1183463873 22:37969130-37969152 GGGCTGGGGAGGAGGGGAATTGG + Exonic
1183508031 22:38220207-38220229 GAGGTGTGGAGGGGGAGAGGAGG + Exonic
1183674477 22:39291885-39291907 GGAGAGTGAAGGAGGTGAATTGG + Intergenic
1183700526 22:39448515-39448537 TGGGTGTGGAGGAGAGGAGGAGG + Intergenic
1183747171 22:39698601-39698623 GAGGTGATGGGGAGGTGAAGGGG - Intergenic
1183747194 22:39698670-39698692 GAGGTGAAGGGGAGGTGAAGGGG - Intergenic
1183747198 22:39698681-39698703 GAGGTGATGGGGAGGTGAAGGGG - Intergenic
1183747275 22:39698943-39698965 GAGGTGATGGGGAGGTGAAGGGG - Intergenic
1184100742 22:42340776-42340798 GGCGTGTGGAAGAGATGATGAGG - Intronic
1184159990 22:42692372-42692394 GGGGGGTGGGGGAGGTCAACAGG - Exonic
1184355940 22:43979652-43979674 GCAGTGTGGAGAAGGGGAAGGGG - Intronic
1184404741 22:44293414-44293436 GTGGTGGGGAGGAGGTGCACCGG + Intronic
1184422825 22:44391734-44391756 AGGGAGTGGAGGAGAGGAAGGGG - Intergenic
1184521114 22:44994737-44994759 GGAGTGTTGATGAGATGAAGTGG - Intronic
1184667588 22:45996931-45996953 GGGGTGTGCAGGCGATGGAGGGG + Intergenic
1184766104 22:46573363-46573385 GGGGTGGCGACGAGGTGATGTGG + Intergenic
1184946982 22:47810791-47810813 GGGGAGTGGAGGAGGGAAAAGGG - Intergenic
1184989892 22:48160239-48160261 AGGGGGAGGAGGAGGAGAAGAGG + Intergenic
1185058284 22:48592403-48592425 AGGCTGTGGTGCAGGTGAAGTGG + Intronic
1185102758 22:48850417-48850439 GAGGTGAGGAGGAGCTGCAGAGG + Intronic
1185249012 22:49789841-49789863 GAGGTGTGGAGGAGGGGTTGTGG - Intronic
1203298249 22_KI270736v1_random:59012-59034 GAGGTGGAGAGGAGCTGAAGGGG + Intergenic
949533920 3:4980734-4980756 GGGGAGTGGTAGAGGGGAAGGGG - Intronic
949543949 3:5055916-5055938 GGGGTGTGGCGGTGGAGATGGGG + Intergenic
949549890 3:5104127-5104149 GGGGGGAGGAGGAGGTTAGGGGG - Intergenic
950395290 3:12729390-12729412 GGGGTGAGGAGGAGGTTATGTGG - Intergenic
950466934 3:13161286-13161308 GGGGAGTGCGGGAGGAGAAGCGG + Intergenic
950526719 3:13528744-13528766 GGGGTGGGGAGGGGGGAAAGGGG - Intergenic
950840306 3:15962091-15962113 TTGGTGTGGATGTGGTGAAGAGG - Intergenic
951912403 3:27765234-27765256 GGGGTGGGGAGGAGAGGATGGGG - Intergenic
952107559 3:30087629-30087651 GGGAGGAGGAGGAGGTGGAGGGG - Intergenic
952167656 3:30768562-30768584 GGGGTGGGGAGGGGGAGGAGAGG + Intronic
952412637 3:33063426-33063448 GGGGAGAGGAGGAGGAGGAGGGG + Intronic
952739957 3:36725327-36725349 GGGGGGTGGGGCAGGTGCAGTGG + Intronic
953194338 3:40718178-40718200 GGGGTGGGGAGGAGATGGGGAGG + Intergenic
953561404 3:43995919-43995941 GGGGCGCGGAGGGGGCGAAGAGG + Intergenic
953693999 3:45143826-45143848 GGGATGTGGGGGAGGAGATGGGG + Intronic
954149560 3:48650642-48650664 GGGGGGTGGTGGAGGGGCAGTGG - Intronic
954196074 3:48998004-48998026 GGAGTGAGGAGGGGGTGGAGGGG + Intronic
954296017 3:49674775-49674797 GGTGTGTGGAGGGGGGGAGGGGG + Intronic
954428050 3:50453984-50454006 CGGGTGTGGAGGGGGAGATGGGG - Intronic
954521638 3:51232509-51232531 TGGGTGTGGATGTGGTGAAAAGG - Intronic
954752454 3:52821320-52821342 GGGATGAGAAGGAGGTGAAAAGG + Intronic
954967447 3:54624001-54624023 AGGGTGTGGAGGAGGAGAAGAGG + Intronic
955366571 3:58315368-58315390 GGGGTGAGGAGTAGGGGAGGAGG + Intronic
955407417 3:58634184-58634206 GGGCTGAGGAGGAGGAGCAGGGG - Exonic
955916553 3:63912946-63912968 GGGGTCGCGAGGGGGTGAAGGGG - Intronic
955961473 3:64345352-64345374 GGGGTGGGGTGGAGAGGAAGAGG - Intronic
956330651 3:68103153-68103175 GAGGTGAGGATGAGGGGAAGTGG + Intronic
956430105 3:69177920-69177942 GGGGTGTGGATTGGGGGAAGAGG + Intronic
956440908 3:69279703-69279725 GAGGGGAGGAGGAGGGGAAGAGG - Intronic
956440919 3:69279734-69279756 GAGGGGAGGAGGAGGGGAAGAGG - Intronic
956658869 3:71581064-71581086 GGGGTGGGGAGGTAGGGAAGAGG + Intronic
956839376 3:73123186-73123208 GGGGTAGGGAGGAGGGGATGGGG + Intergenic
956965898 3:74459677-74459699 TGGGTGAGTAGGAGGTGAGGAGG - Intronic
958154605 3:89740373-89740395 GGGGGGAGGAGGAGGAGGAGGGG + Intergenic
958431197 3:94043610-94043632 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
958444455 3:94197858-94197880 ATGGTGTGGATGTGGTGAAGGGG - Intergenic
958498440 3:94875012-94875034 GGGGGGCTGAGGAGGTGATGAGG - Intergenic
958562904 3:95770557-95770579 GGGGGTTGGGGGAGGTGAAGGGG + Intergenic
959006837 3:101029136-101029158 GGAGTGTGGAGGGTGGGAAGAGG - Intergenic
959021338 3:101190764-101190786 GAGGTTTGGAGGAGGTAAAGAGG + Intergenic
959747400 3:109792700-109792722 GGGGAGTGGAGTAGGGGAAAGGG + Intergenic
960213119 3:114995908-114995930 GGGGTTGGGAGAAGGTAAAGGGG - Intronic
960266214 3:115624033-115624055 GGGGTGTGGGGGAGATGATGTGG + Intronic
960465849 3:117996503-117996525 GAGGGGGGGAGGAGGAGAAGAGG - Intergenic
960571761 3:119191595-119191617 GGGGTGTGGAGTAGGAGCAGGGG - Intronic
960798568 3:121514473-121514495 GGGGAGTGGAAGGGGTGATGAGG - Intronic
960807022 3:121593809-121593831 GGGAAGTGGAGGAGGTGGTGAGG + Intronic
960947306 3:122975409-122975431 GGGGTGGTGGGGAGGAGAAGTGG - Intronic
961190590 3:124957981-124958003 GGGGTATTTAGGAGGTGGAGTGG + Intergenic
961481514 3:127183745-127183767 GGGAGGTGGAGGAGGGGGAGAGG - Intergenic
961485950 3:127216619-127216641 GTGGTGTGGAGGTGGTGGTGAGG - Intergenic
961709045 3:128812875-128812897 AGTGTGTGCACGAGGTGAAGTGG - Intronic
961716477 3:128861106-128861128 GTGGGGTGCAGGAGGTGAAGGGG + Intergenic
961795854 3:129408482-129408504 GGGGCGTGGAGGAGAAGAGGAGG - Intronic
962960604 3:140308034-140308056 GGGGTGGGGAGGAGGTGCTGTGG - Intronic
963199919 3:142575595-142575617 GGGATGTGGAGGAGGTTCTGAGG - Intronic
963308329 3:143679037-143679059 GGGGTGGGAAAGAGGTGAGGGGG + Intronic
963512652 3:146268180-146268202 GGAGTGGGGAGGAGGGGACGTGG + Intergenic
963964233 3:151347678-151347700 TGGGTGTGGGGGATGTGCAGAGG + Intronic
964092642 3:152894394-152894416 GGGGTTTGGAGGAGGTGATTTGG + Intergenic
964854646 3:161133718-161133740 AGGGTTTGGAAGAGGTCAAGGGG - Intronic
965459978 3:168950416-168950438 GGGGTGTGCTGGTGGTGAAATGG + Intergenic
965513628 3:169596998-169597020 GGGGTTGGAAGGAGGTGAAGAGG + Intronic
965520204 3:169662980-169663002 GGGGTGGGGGGGAAGAGAAGAGG - Intronic
965537256 3:169836229-169836251 AGTGTGTGGAGGTGGAGAAGTGG + Intronic
965770720 3:172178861-172178883 GGTATGTGGAGGCGCTGAAGGGG - Intronic
966187779 3:177243778-177243800 GGGGTGTGGAAGAAGTGGTGTGG + Intergenic
966276912 3:178184135-178184157 GGGGTGTGAAAGAGGAGAAAGGG - Intergenic
966594284 3:181712258-181712280 GGGGAGAGGAGGAGGGGAGGCGG - Exonic
966595643 3:181722895-181722917 GGGGTGTGGAGGAAAACAAGAGG + Intergenic
966631057 3:182075563-182075585 GGGGGTTGGGGGAGATGAAGGGG - Intergenic
966929886 3:184669497-184669519 GGTGTGGGGAGGGGCTGAAGGGG + Intronic
967221211 3:187249537-187249559 GGGGTGGTGGTGAGGTGAAGGGG + Intronic
967289101 3:187902065-187902087 GTGGAGTGGCGGCGGTGAAGTGG - Intergenic
967489169 3:190069475-190069497 TGGCTGGAGAGGAGGTGAAGAGG - Intronic
967553811 3:190831463-190831485 GGGGAATGGAGGCGGTGGAGGGG - Intergenic
968452344 4:681504-681526 GGGGTCTGGGGGAGGTGCGGGGG - Intronic
968518244 4:1023719-1023741 GGGGTGAGCAGGGGGTGACGGGG + Exonic
968862124 4:3180826-3180848 GGGGTGTGGTGGAGTTGGGGAGG + Intronic
968889323 4:3359255-3359277 AGGGAGAGGAGGAGGTGGAGGGG - Intronic
968942918 4:3648460-3648482 AGGGTGGGGAGCAGGTGAGGAGG - Intergenic
968948584 4:3678569-3678591 GAGGAGTTGAGGAGGTGAGGAGG + Intergenic
968949593 4:3683692-3683714 GGCGGGTGGAGGAGGTGGGGCGG - Intergenic
969038449 4:4274955-4274977 GGGGTGTGGACTGGGGGAAGTGG - Intronic
969049694 4:4363924-4363946 GAGGAGTGGGGGAGGTGACGAGG - Intronic
969310152 4:6348267-6348289 GGGGTGGGGTGCAGGTGAGGGGG - Intronic
969424353 4:7115580-7115602 GAGGTGAGGAGGAGGTGAGGTGG + Intergenic
969424356 4:7115591-7115613 GAGGTGAGGTGGAGGTGAGGAGG + Intergenic
969424359 4:7115602-7115624 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424362 4:7115613-7115635 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424364 4:7115624-7115646 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424370 4:7115646-7115668 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424373 4:7115657-7115679 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424375 4:7115668-7115690 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424381 4:7115690-7115712 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424384 4:7115701-7115723 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424386 4:7115712-7115734 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424392 4:7115734-7115756 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969442822 4:7227447-7227469 AGGCTGTGGAGGACGTGATGAGG - Intronic
969443902 4:7233388-7233410 AGGCTGTGGAGGACGTGATGAGG - Intronic
969690376 4:8700902-8700924 GGGGTGGGGAGGAGAGGAAGAGG + Intergenic
969707543 4:8820113-8820135 GTGGAGTGGAGGAGGTGGGGGGG + Intergenic
969979005 4:11135049-11135071 GGGGAATGGAGGAGGGGGAGAGG - Intergenic
970319279 4:14859922-14859944 GAGGTGGGGAGGAGATGAAGGGG + Intergenic
970546668 4:17137392-17137414 GGGGAAGGGAAGAGGTGAAGTGG - Intergenic
971109287 4:23565110-23565132 GGAGTGAGGGGGAGGTGAAGGGG - Intergenic
971473459 4:27050952-27050974 GTGGTGGGGAGGAGGTGAGAAGG - Intergenic
972216563 4:36904526-36904548 TTGGTGTGGAGGAGGGGAGGTGG + Intergenic
972512234 4:39779035-39779057 CGGGGGTGGGGGGGGTGAAGGGG - Exonic
972560196 4:40220264-40220286 GGGGTGGGGAGGGGGAGAGGAGG - Intronic
972602108 4:40581945-40581967 TGGGTGCAGAGGAGGGGAAGCGG - Intronic
972651930 4:41026180-41026202 GGAGTGTGGAGGATGGGAGGAGG + Intronic
973602477 4:52555847-52555869 TGGGGTTGGAGGAGGAGAAGGGG - Intergenic
975528167 4:75373854-75373876 GGGCGGTGGCGGGGGTGAAGGGG - Intergenic
975894399 4:79070035-79070057 GGGTAGAGGAGGTGGTGAAGAGG + Intergenic
976097776 4:81527769-81527791 GGAGTGTGGGCAAGGTGAAGAGG + Intronic
976117984 4:81748761-81748783 TGGGGGTGGAGGTGGGGAAGGGG - Intronic
976151431 4:82096369-82096391 GGGGAGTGGGAGGGGTGAAGAGG + Intergenic
976753858 4:88477540-88477562 GGGAAGTGGGGGAGGGGAAGGGG + Intronic
977173380 4:93790076-93790098 TGGGGTGGGAGGAGGTGAAGTGG - Intergenic
977293976 4:95191964-95191986 GGGGAGGGGAGGAGGTGAGCAGG - Intronic
979217199 4:118180044-118180066 GGGGAGTGGAGGAAGAGGAGAGG + Intronic
979402223 4:120262450-120262472 GGGGTGAGGAGGAAGGGTAGTGG + Intergenic
979614430 4:122726430-122726452 TTGGTGTGGATGCGGTGAAGAGG + Intergenic
979725447 4:123955678-123955700 GGGAGGAGGAGGAGGAGAAGAGG + Intergenic
979939387 4:126740849-126740871 GTGGTGAGGAGTAGATGAAGCGG - Intergenic
980113977 4:128661706-128661728 GGAGTGGGGAGGAGGTAACGAGG - Intergenic
980328420 4:131379357-131379379 GAGGTGTGGAGGAGGAGGCGCGG + Intergenic
980880777 4:138708148-138708170 GGAGTGGGGATGAGGTGAAATGG - Intergenic
981044535 4:140253073-140253095 GGAGAGAGGAGGAGGGGAAGAGG + Intergenic
981212782 4:142128779-142128801 GATGTGTGGAGGAGGTGAGGGGG - Intronic
981254387 4:142644257-142644279 GGGGTCAGGAGGAGGAGGAGTGG + Intronic
981550461 4:145937227-145937249 CGCGGGTGGAGGAGGGGAAGGGG + Intronic
981683840 4:147430845-147430867 GGGGTTTGGGGGAGGTCATGAGG + Intergenic
981748028 4:148069397-148069419 GGGCTGGGGAGGTGGTGAATGGG + Intronic
981775978 4:148368188-148368210 GGAGTGTGGTGGAGAGGAAGAGG - Intronic
981937338 4:150251145-150251167 GGGGTGTGGGGGATGTGTGGGGG - Intronic
981937378 4:150251236-150251258 GGGGTGTGGGGGATGTGTGGGGG - Intronic
982215992 4:153082931-153082953 GGGGAGAGAAGGGGGTGAAGGGG + Intergenic
982251732 4:153413994-153414016 GGGGTGGGGAGCAGGGAAAGGGG - Intronic
982722927 4:158877931-158877953 GGGGGGTGGGGGAGGAGACGGGG - Intronic
983192256 4:164767062-164767084 GGGATGTGGGGTAGGTGATGGGG + Intergenic
983526531 4:168765883-168765905 GGGGTTGGGAGGAAGAGAAGAGG + Intronic
983643215 4:169963101-169963123 AGGGAGAGGAGGAGGTGAAATGG - Intergenic
984211831 4:176859340-176859362 GGGGAGTGGAGGAGTCCAAGAGG + Intergenic
984703439 4:182833035-182833057 GGGGAGAGGAGGAGGGGGAGAGG - Intergenic
984925445 4:184802560-184802582 AGGGTGTGGAGAAGATGAAGAGG - Intronic
985068246 4:186144297-186144319 GGGGTGTGCAGGAGATGCACCGG + Intronic
985749729 5:1667327-1667349 GGGGAGGGGAGGAGGGGAGGAGG - Intergenic
986029821 5:3883537-3883559 GGGCTGTGGAGGAGAGCAAGGGG - Intergenic
986175431 5:5348235-5348257 GCGGTGAGGAGGAAGTGATGAGG + Intergenic
986347844 5:6851022-6851044 GGCATGTGTAGGAGGTGAGGAGG + Intergenic
986602301 5:9484840-9484862 AGGGTGTGGAGGAGGAGAGAAGG - Intronic
987010376 5:13756848-13756870 GGAGGGTGGAGGATGGGAAGAGG - Intronic
988418763 5:30979361-30979383 GGGGTGAGGAGGGGTAGAAGTGG - Intergenic
988680566 5:33480852-33480874 GGGATGGAGAGGAGATGAAGGGG - Intergenic
988680584 5:33480902-33480924 GGGAAGGGGAGGAGATGAAGGGG - Intergenic
988680655 5:33481080-33481102 GGGGAGGGGAGGAGATGGAGGGG - Intergenic
988680673 5:33481144-33481166 GGGGAGGGGAGGAGCTGGAGGGG - Intergenic
988817131 5:34845544-34845566 TGGGTGTGGAGAGAGTGAAGAGG + Exonic
988908133 5:35810891-35810913 GAGGTGTGGAGGACTTGAGGAGG - Intronic
989089515 5:37715406-37715428 GGAATGTGGAGGAGGGGAAAAGG + Intronic
990174369 5:53090766-53090788 GGGGGGTGGGGGAGGTGCGGGGG + Exonic
990676866 5:58196500-58196522 GACATGTGGAGGAGGTGATGGGG + Intergenic
991057286 5:62334496-62334518 AGGGGGAGGAGGAGGAGAAGTGG - Intronic
991316200 5:65309466-65309488 GGGGTGGGGAGGGGGCAAAGGGG + Intronic
991931485 5:71757061-71757083 GGGAGGTGGAGGAAGTGAGGAGG + Intergenic
992365190 5:76083512-76083534 GGTGAGTGGGGGAGGTGAAGCGG + Exonic
992567212 5:78009775-78009797 GGGGGGTGGGGGAGGGGGAGAGG + Intronic
992755077 5:79896608-79896630 GGGTAGTGGGGGAGGGGAAGTGG - Intergenic
993664117 5:90673716-90673738 GGGGTTTTCAGGAGGTGATGAGG - Intronic
993828344 5:92721941-92721963 GGGGTGCGGTGGTGGTGATGGGG - Intergenic
993905849 5:93621656-93621678 GGGGTGGTGTGGAGGGGAAGGGG + Intronic
994006910 5:94848026-94848048 GGGGTGGTGAGCAGGTGGAGAGG + Intronic
994050871 5:95360636-95360658 TTGGTGTGGATGAGGTGAACAGG - Intergenic
994084905 5:95747372-95747394 GTGGTGTGGAGAAGGTTAATTGG - Intronic
994123359 5:96142695-96142717 GAGGTATGGTGGAGGTGCAGTGG + Intergenic
994389933 5:99180469-99180491 GGGGATGGGAGGGGGTGAAGGGG - Intergenic
994625427 5:102212985-102213007 TGTGTGTGGGAGAGGTGAAGAGG - Intergenic
995720280 5:115123246-115123268 GGGGTGTGGGGGAGGGGAGAGGG + Intergenic
995873360 5:116765239-116765261 GGGGTGGGGAGGGGGGGAACAGG - Intergenic
996034812 5:118746811-118746833 TGAGTGTGGAGGAGGGGCAGAGG + Intergenic
996557656 5:124795940-124795962 GGGGTGCAGAGGAGATGAAATGG - Intergenic
997108586 5:131048849-131048871 GGGGTGTGTCGGGGGTGGAGAGG + Intergenic
997262390 5:132475068-132475090 GGGGTGTGGAGATGGAGGAGGGG + Intronic
997287234 5:132688930-132688952 GGGGAGGGGAGCAGGTGGAGAGG + Intergenic
997321822 5:132983954-132983976 GGGGAGAGGGGGAGGGGAAGAGG + Intergenic
997474081 5:134132745-134132767 GGGTTGGGGGGGTGGTGAAGGGG + Intronic
997517550 5:134501725-134501747 GGTGGGTGGAGGAGCTGAATTGG + Intergenic
997549712 5:134741189-134741211 GTGGTGTGGCCGAGGTAAAGGGG + Exonic
997952416 5:138252928-138252950 TGGGTGTGGTGGAGGGGAAGAGG + Exonic
998134219 5:139666303-139666325 TGGGGGTGAAGGGGGTGAAGGGG - Intronic
998136263 5:139676204-139676226 GGACTGTGGAGGAGGTGGGGAGG - Intronic
998136274 5:139676240-139676262 GGACTGTGGAGGAGGTGGGGAGG - Intronic
998167131 5:139850627-139850649 GGGGTCTGTAGGAGGTGAGCAGG - Intronic
998399231 5:141839503-141839525 GAGGTGGGGAGGAGCTGGAGAGG + Intergenic
998400297 5:141845327-141845349 GGTGAGTGGAGGAGGAGCAGGGG - Intergenic
998649108 5:144097937-144097959 GGAGGGTGGAGGACGGGAAGAGG + Intergenic
998822184 5:146067095-146067117 GAAGGGTGGAGGAGGTGAGGCGG - Intronic
998836086 5:146203879-146203901 GGGGCGTGGGGGAGGGGAGGTGG + Intronic
999005071 5:147967016-147967038 GGGCTGCTGAGGAGATGAAGAGG + Intergenic
999129836 5:149273802-149273824 GGGGAGTGGGGGTGGTGGAGAGG - Intronic
999143366 5:149377293-149377315 AAGGTGTCCAGGAGGTGAAGAGG - Intronic
999273764 5:150314593-150314615 GTGGGTTGGAGGAGGAGAAGAGG - Intronic
999545994 5:152629224-152629246 TGGGAGTGGGGGAGGGGAAGTGG - Intergenic
999694826 5:154179478-154179500 GGGGTGGGGAGAAGGTGCGGAGG + Intronic
1000107282 5:158072102-158072124 GGGGTGTGAAGGGGTTGAAGGGG + Intergenic
1000163473 5:158624200-158624222 GTCGTGTGGGAGAGGTGAAGTGG + Intergenic
1000349034 5:160338391-160338413 GGGGGGTGGGGGAGTTGAGGGGG - Intronic
1000931598 5:167258527-167258549 GTGATGTGGAGGAAGTGATGTGG + Intergenic
1000965297 5:167648682-167648704 GGAGGGTGGAAGAGGTGCAGGGG + Intronic
1001068459 5:168560338-168560360 GAGGTTTGAAGGAGGTGAGGGGG - Intronic
1001315608 5:170639261-170639283 GGGGCGTGGATGAGGTGAGGCGG - Intronic
1001442724 5:171757508-171757530 GGGTGGTGGAGGAGGAGGAGTGG - Intergenic
1001449160 5:171810774-171810796 GGGCTGGGGATGAGGAGAAGGGG - Intergenic
1001546242 5:172572268-172572290 GTGGTGAGGAGAAAGTGAAGTGG - Intergenic
1001651440 5:173318873-173318895 GGAGTATGGAAGAGCTGAAGTGG + Intronic
1001761215 5:174209953-174209975 GGGGTGAGCTGGGGGTGAAGAGG + Intronic
1001761222 5:174209974-174209996 GGGGTGAGCTGGGGGTGAAGAGG + Intronic
1001799330 5:174529686-174529708 GGGGAGTGGAGGAGGTGTCTAGG - Intergenic
1001893221 5:175356607-175356629 GGGGTGTGGAGGAGGGGAGCTGG - Intergenic
1001920216 5:175594062-175594084 AGGGTGGGGAGTAGGTGGAGGGG - Intergenic
1002042282 5:176523482-176523504 GGGGAGGGGAGGAGGAGGAGGGG - Intergenic
1002469416 5:179426584-179426606 GGGGGATGGGGCAGGTGAAGAGG + Intergenic
1002564700 5:180104255-180104277 GGGGTCTGGAGGAGGCGATTAGG + Intronic
1002567376 5:180119526-180119548 TGGGTTTAGAGAAGGTGAAGCGG - Intronic
1002643835 5:180643442-180643464 GGGGAGGGGAGGAGGGAAAGTGG - Intronic
1002777560 6:341829-341851 GGCGTGTGAAGGAGCTGAGGAGG - Intronic
1003020384 6:2504652-2504674 GGGGTGAGGAGGAGATGAGAAGG - Intergenic
1003020389 6:2504673-2504695 GGGGTGAGGAGGAGATGAGGAGG - Intergenic
1003020395 6:2504694-2504716 GGGGTGAGGAGGAGATGAGGAGG - Intergenic
1003020400 6:2504714-2504736 GGGGTAAGGAAGAGATGAAGGGG - Intergenic
1003020411 6:2504752-2504774 GGGGTGTGGAGGAGATGAGGGGG - Intergenic
1003020419 6:2504773-2504795 GGGGTGTGGAGGAGATGAGGAGG - Intergenic
1003020445 6:2504894-2504916 GGGGTGAGGAGGAGATGAGGAGG - Intergenic
1003020451 6:2504915-2504937 TGGGTGAGGAGGAGATGAGGAGG - Intergenic
1003020460 6:2504950-2504972 GGGATGAGGAGGAGATGAGGAGG - Intergenic
1003020465 6:2504971-2504993 GGGGTGAGGAGGAGTTGAGGAGG - Intergenic
1003020471 6:2504992-2505014 GGGGTGGGGAGGAGATGAGGAGG - Intergenic
1003146825 6:3516682-3516704 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003146842 6:3516738-3516760 GGGGAGTGGGGGAGATGATGGGG - Intergenic
1003146899 6:3516920-3516942 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003147002 6:3517239-3517261 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1003165056 6:3670317-3670339 GGGGTGGGGAGGGGGTGGGGGGG + Intergenic
1003318151 6:5030079-5030101 CAGGTGTGGAGGATGAGAAGCGG + Intergenic
1003514176 6:6804573-6804595 GCGGTGTGGAAGAGGTTCAGGGG - Intergenic
1003627753 6:7758778-7758800 GGGGTGGAGAGAGGGTGAAGGGG - Intronic
1004159100 6:13197772-13197794 GGGCTGGGAAGGAGGTGCAGAGG - Intronic
1004367991 6:15028088-15028110 GGGGAGGGTAGGAGGTGAGGTGG + Intergenic
1004843716 6:19615069-19615091 GGTGTGTGGAGGAAGGGTAGGGG - Intergenic
1004902324 6:20205922-20205944 GGGTTGGGGAGGAGTTGGAGGGG - Intronic
1005311419 6:24563044-24563066 GGGGTCTGGAGCATGTGAAGAGG - Intronic
1005709420 6:28489548-28489570 GGGGTGCGGAGGTGGGGGAGGGG + Intergenic
1005843976 6:29763217-29763239 TGGGGGTGGAGGAGATGAAGGGG - Intergenic
1005873588 6:29995104-29995126 TGGGGGTGGAGGACGTGAAGGGG - Intergenic
1005969990 6:30753220-30753242 GGGGGGTATAGGAGGTGAACCGG - Intergenic
1006185074 6:32176951-32176973 TGGGAGTGGAGGAAGAGAAGAGG - Exonic
1006259278 6:32854318-32854340 GAGGGGTGGAGGAGATGCAGCGG + Intronic
1006271745 6:32970870-32970892 GGGGAGGGGAGGAGGGGAGGAGG + Exonic
1006333575 6:33409454-33409476 TAGGTTTGGAGGAGGTGAAAAGG - Intronic
1006370629 6:33641652-33641674 GGGGAGAGGATGAGGTGGAGAGG - Intronic
1006375556 6:33669960-33669982 GAGGTGGGGAGGTGGTGAAAGGG - Intronic
1006375818 6:33671134-33671156 GGGGCGTGGCCGAGGTGAGGTGG - Intronic
1006444421 6:34070766-34070788 GGGGTGTGGCGGGGGTGTGGTGG - Intronic
1006503947 6:34476251-34476273 GGGGTGCTGTGAAGGTGAAGGGG - Intronic
1006602873 6:35237585-35237607 AGGGGGTGGAGGAGGTGGGGCGG - Intronic
1006716533 6:36124045-36124067 AGGAGGTGGAGGAGGTGCAGGGG + Intergenic
1006739661 6:36298560-36298582 GGGGGCTGGAGGAGGAGAAAAGG - Intronic
1006756277 6:36418376-36418398 GGGATGGGGTGGAGGTGAAAAGG + Intronic
1006787967 6:36680449-36680471 GGGGTGGGGAGGGGGAGAATGGG - Intronic
1006976500 6:38107322-38107344 AGTATGTGGAAGAGGTGAAGTGG + Intronic
1007169432 6:39852322-39852344 AGGGAGAGGAGAAGGTGAAGTGG - Intronic
1007299104 6:40852914-40852936 GTGGTGTAGATGAGATGAAGAGG + Intergenic
1007341570 6:41194192-41194214 GGGGTGGGGAGGAGGGGCAGGGG - Intronic
1007395728 6:41576608-41576630 AGAGGCTGGAGGAGGTGAAGTGG + Intronic
1007478207 6:42133235-42133257 GGGGCGAGGAGGAGGTGAAGGGG + Intronic
1007631270 6:43274876-43274898 GGGGTGGGGAAGGGGTGGAGAGG + Intronic
1007681326 6:43635737-43635759 GCAGTGTGGGGGAGGTTAAGTGG - Intronic
1007727980 6:43928319-43928341 GGTGTGAGGAGGTGGTGATGGGG - Intergenic
1007760923 6:44133431-44133453 GGGCTGTGGAGCAGGGGAGGAGG - Intronic
1007760978 6:44133638-44133660 GGGGTGGGCAGGAGGAGAAAAGG - Intronic
1007836204 6:44675916-44675938 GGGGTGTGGAGGACGAAGAGAGG - Intergenic
1007912222 6:45527402-45527424 GGGGTAGGGAGGAGGTTAGGAGG + Intronic
1008228836 6:48958441-48958463 GGGCTGAGTAGAAGGTGAAGGGG - Intergenic
1008355307 6:50546001-50546023 TAGGTGAGGAGGAGATGAAGTGG - Intergenic
1008619639 6:53258948-53258970 AGCGTGTGAAGGAAGTGAAGGGG - Intergenic
1008649108 6:53545147-53545169 GGGGAGAGGAGGCGGTGCAGCGG + Intronic
1009441738 6:63688244-63688266 GGAGGGGGGAGGAGGGGAAGGGG - Intronic
1009488393 6:64254700-64254722 CGGGAGTGGATGAGGTGTAGTGG - Intronic
1009799015 6:68509160-68509182 TTGGTGTGGATGAGGTGAAAAGG - Intergenic
1010146332 6:72673607-72673629 GAGGAGTGGAGGAGGCGAAGAGG + Intronic
1010257371 6:73774484-73774506 AGGGTTTGGAGGAGGAGGAGAGG + Intronic
1010444554 6:75935592-75935614 TTGGTGGCGAGGAGGTGAAGGGG + Intronic
1010481778 6:76363911-76363933 GGAGGGTGGAGGATGGGAAGAGG - Intergenic
1010828625 6:80503500-80503522 AAGATGTGGAGGAGGTGAAAGGG - Intergenic
1011417429 6:87137295-87137317 GAGGAGGGGAGGAGGGGAAGGGG - Intergenic
1011499947 6:87976972-87976994 GAGGTGAGGAGGAGGTGAGGTGG - Intergenic
1011617643 6:89211768-89211790 GAGGTGTTGAGGATGTTAAGAGG - Intronic
1011648014 6:89478623-89478645 GGGGTGAGGAGGCGGGGAGGGGG + Intronic
1012981081 6:105831087-105831109 GGAGGCTGGAGGAGGGGAAGGGG + Intergenic
1013448355 6:110253936-110253958 GGGGTGAGGAGGATGGCAAGTGG + Intronic
1013466948 6:110426394-110426416 GGAGTGAGGAGGAGGTGGAGAGG - Intronic
1013648709 6:112171560-112171582 TGGATGTGGAGGAGGGAAAGGGG + Intronic
1013793016 6:113857590-113857612 GGGGGGTGGGGGTGGTGGAGAGG - Exonic
1014046701 6:116897158-116897180 GAGGAGTGGAGTAGGGGAAGAGG + Intronic
1014285494 6:119492694-119492716 TTGATGTGGATGAGGTGAAGAGG + Intergenic
1015075117 6:129147496-129147518 AGGGGGTGGAGGGGGTGGAGTGG + Intronic
1015776530 6:136820362-136820384 GGGGTGTGGAGCAAGGGCAGGGG + Intergenic
1015809180 6:137144290-137144312 GGGGGGTGGAGGAGAATAAGAGG - Exonic
1016510984 6:144842802-144842824 GGGGTGGGGAGGTGGGGAGGTGG - Intronic
1017087780 6:150730335-150730357 GGGGTGTGGGGGTGGGGGAGTGG + Intronic
1017160916 6:151365381-151365403 GGGATGTGGAAAAGGGGAAGAGG + Exonic
1017413302 6:154192873-154192895 TTGGTGTGGAGGTGGTGAACAGG + Intronic
1017549759 6:155493396-155493418 GGGGTGTGGATGGGGGGAGGAGG + Intergenic
1017598152 6:156052155-156052177 AGGGTGTGGAGTAGGGGTAGAGG + Intergenic
1017637414 6:156456298-156456320 GGGATGGGGAGGAGGGGATGGGG - Intergenic
1017759368 6:157556253-157556275 GGGGGGTGGAGGGTGGGAAGGGG + Intronic
1018129693 6:160717214-160717236 GGGGTGGGGAAGAGTTCAAGAGG + Intronic
1018603787 6:165576623-165576645 GGGAGGTGAAGGAGGAGAAGAGG - Intronic
1018676198 6:166224169-166224191 CGGGCGGGGAGGAGGTGCAGGGG + Intergenic
1018747439 6:166773249-166773271 GGGGTGAGGAGAGGGGGAAGAGG + Intronic
1018839916 6:167509223-167509245 AGTGTGTGAAGGAGGTGAGGGGG - Intergenic
1019011079 6:168844020-168844042 GGGGTCTTGGGGAGGTGATGGGG - Intergenic
1019223556 6:170493388-170493410 GAGGAGGGGAGGAGGGGAAGAGG + Intergenic
1019223575 6:170493448-170493470 GGGAAGAGGAGGAGGTGAGGAGG + Intergenic
1019223582 6:170493470-170493492 GGGAAGAGGAGGAGGTGAGGAGG + Intergenic
1019223604 6:170493542-170493564 GGGGAGGAGAGGAGGTGAGGAGG + Intergenic
1019228914 6:170540907-170540929 TGGTTGTGGAGAAGGTGCAGAGG + Intronic
1019295527 7:272089-272111 AGGATGTGGAGGAGGAGGAGTGG + Intergenic
1019478673 7:1256118-1256140 CGGGCGCGGTGGAGGTGAAGTGG - Intergenic
1019517495 7:1446365-1446387 GGGGGGAGGAGGAAGAGAAGGGG + Intronic
1019624382 7:2008655-2008677 GGGCTGTGGAGGAGGGGCTGAGG - Intronic
1019657366 7:2203051-2203073 GGGGTGAGGAGGGGCTGCAGAGG - Intronic
1019666100 7:2252946-2252968 GGGGTGAGGGGGAGCAGAAGAGG - Exonic
1020089944 7:5333305-5333327 GGGTTTTGGAGGAGCTCAAGGGG - Intronic
1020123418 7:5518662-5518684 GGGGGGAGGAGAAGGGGAAGGGG - Intergenic
1020289967 7:6715775-6715797 GGGAGGTGGAGGAGGTGGGGAGG - Intergenic
1020331118 7:7017823-7017845 GGGTTGTGGGGGAGGTGGGGTGG - Intergenic
1020504224 7:8962984-8963006 GGGGTGAGTAGGAGGAGGAGTGG + Intergenic
1020535466 7:9390897-9390919 GGAGTGGGGAGGAGTTGTAGGGG + Intergenic
1020790784 7:12626064-12626086 AGGCTGTGGAGGAAGTGAATGGG - Intronic
1020912383 7:14147928-14147950 TGGGAGTGGAGTAGGTGAGGAGG + Exonic
1022541473 7:31139780-31139802 GGGGTGGGCAGGAGGGGGAGGGG - Intergenic
1023038653 7:36153787-36153809 GGAGCGTGGGGGAGGTGGAGTGG + Intronic
1023040590 7:36169631-36169653 GGGGCGAGGAAGAGGGGAAGAGG - Intronic
1023113414 7:36837432-36837454 GGGGTCTTTAGGAGGTGATGAGG - Intergenic
1023193119 7:37604316-37604338 AGAGTTTGGAGGTGGTGAAGAGG + Intergenic
1023229399 7:38009776-38009798 GGGGTGTAGAGAGAGTGAAGGGG + Intronic
1023302196 7:38784656-38784678 GGGGGAAGGAGGAGGGGAAGGGG + Intronic
1023409471 7:39875146-39875168 GGGGAGTGGAGGATGGGGAGAGG - Intergenic
1023825746 7:44007601-44007623 GGGAGGTGGAGGAGGTGGGGAGG + Intronic
1023935354 7:44736130-44736152 GGGCTGGGGAGGAGGTAATGCGG + Intergenic
1023995372 7:45156319-45156341 GGGGTGGGCAGCAGGTGTAGGGG - Intergenic
1024013945 7:45294309-45294331 GGGGTGTGAAGGGGCTGATGGGG + Intergenic
1024578487 7:50783015-50783037 GGGCTGTGGGGGAGGAGAGGAGG - Intronic
1024988382 7:55214790-55214812 GGGGTCTGGAGAAGCTGAAAGGG - Intronic
1025043460 7:55668875-55668897 GGGGAGTGGAGGATGGGGAGAGG + Intergenic
1025136380 7:56417389-56417411 GGGGAGTGGAGGATGGGGAGAGG + Intergenic
1026038759 7:66848032-66848054 GGGGGGTGGGGGAGGGGAGGGGG + Intergenic
1026089318 7:67286452-67286474 GGGAGGTGGAGGAGGTGGGGAGG + Intergenic
1026308798 7:69166196-69166218 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1026472424 7:70705628-70705650 GTGGGGTGGAGGAGGCGAAGGGG - Intronic
1026475518 7:70731792-70731814 GGGGGATGGCGGAGGGGAAGGGG - Intronic
1026806133 7:73430467-73430489 GGGAGGGGGAGGAGGGGAAGGGG - Intergenic
1026806146 7:73430491-73430513 GGAGGGGGGAGGAGGGGAAGGGG - Intergenic
1026848056 7:73708629-73708651 AGAACGTGGAGGAGGTGAAGCGG - Exonic
1026893493 7:73996841-73996863 GGGCTGGGGGGGTGGTGAAGAGG - Intergenic
1027089349 7:75286954-75286976 GGGACGTGGAGGATGTGGAGAGG + Intergenic
1027118906 7:75501770-75501792 GGGAGGTGGAGGAGGTGGGGAGG + Intergenic
1027212612 7:76163525-76163547 GGGGGGTGGGGGAGGGGAGGGGG - Intergenic
1027272915 7:76533839-76533861 GGGAGGTGGAGGAGGTGGGGAGG - Intergenic
1027326364 7:77052923-77052945 GGGAGGTGGAGGAGGTGGGGAGG - Intergenic
1028091817 7:86712152-86712174 GGAGTGAAGAGGAGGTTAAGGGG - Intronic
1028384948 7:90244440-90244462 GGGGTGAGGGGGACGTGAAAAGG + Intergenic
1028394136 7:90348634-90348656 TGGGGGTGGAGGAGGTGGAAGGG + Intronic
1028421835 7:90641628-90641650 GTGGTGGGGAGGAGATGATGGGG + Intronic
1028485564 7:91353663-91353685 GCGGGGTGGGGGAGGTGGAGGGG + Intergenic
1028509708 7:91610476-91610498 GGGGTGGGGAGGAGGGCAAATGG + Intergenic
1028646230 7:93099810-93099832 GGGGTGTGGGGGTGGTGAAAGGG - Exonic
1028811680 7:95094937-95094959 TGGGTGTGTAGGAGGAGAAGAGG + Intronic
1028936431 7:96469377-96469399 TTGGTGTGGATGAGGTGAACAGG - Intergenic
1029147487 7:98457298-98457320 GTGGTGTGGAAGAGATGATGTGG - Intergenic
1029223528 7:99008634-99008656 GGGGTGTTTAGGAGATGAACAGG + Intronic
1029450892 7:100641338-100641360 GGGGCGTGGGGGAGGGGCAGGGG + Intronic
1029459847 7:100688267-100688289 GGGGTGGGGAGGAGGGGACCTGG + Exonic
1029503967 7:100950915-100950937 GGAGTGAGGACTAGGTGAAGAGG - Intronic
1029538333 7:101168829-101168851 GGGGGGAGGGGGAGGAGAAGAGG - Intergenic
1029675961 7:102069102-102069124 TGGGTGTCGAGGAGGAGGAGAGG - Intronic
1029708972 7:102289318-102289340 GTGGTGTGGTGGAGGGGCAGGGG + Intronic
1029718586 7:102348247-102348269 GGGAGGTGGAGGAGGTGGGGAGG - Intergenic
1029754030 7:102561008-102561030 GGGAGGTGGAGGAGGTGGGGAGG + Intronic
1029771980 7:102660098-102660120 GGGAGGTGGAGGAGGTGGGGAGG + Intronic
1029989086 7:104946601-104946623 GGGTGGTGGTGGTGGTGAAGAGG - Intergenic
1030005266 7:105112390-105112412 AGGAGGTGGAGGAGGTGGAGGGG - Exonic
1030067850 7:105674141-105674163 GCAGTGGGTAGGAGGTGAAGAGG - Intronic
1030348443 7:108457459-108457481 TGGGGGTGGAGGAGGTGGTGAGG - Intergenic
1030435184 7:109508941-109508963 GGGGTGGGGTGGAGGTGGTGGGG - Intergenic
1030579381 7:111334201-111334223 GAGGGGAGGAGGAGATGAAGGGG - Intronic
1030627017 7:111855331-111855353 GGGGTGTGGAGAAGCTACAGAGG + Intronic
1030685698 7:112485022-112485044 TGGGTGTGGTGGAGGGGGAGGGG + Intronic
1030738992 7:113085947-113085969 GGAGGGTGGAGGAGGGGGAGAGG + Intronic
1031084218 7:117286468-117286490 GGGGGGAGAAGGAGGTGAGGAGG - Intronic
1031448766 7:121887859-121887881 GGGGTGTTGGGGGGATGAAGAGG - Intronic
1031489768 7:122371885-122371907 GGGGTGGGGTGGAGGTGATATGG + Intronic
1031524073 7:122803095-122803117 GGGAGTTGGAGGAAGTGAAGAGG - Intronic
1032192907 7:129774598-129774620 GGGCTGGGGAGGCGGTGAGGAGG + Intergenic
1032415447 7:131732224-131732246 GGGATGTGGAGGATGAGAAAAGG - Intergenic
1032421381 7:131782638-131782660 GGGGTGAGGGGCAGGGGAAGTGG - Intergenic
1032448277 7:132003415-132003437 GGAGTGGGGAGGAGGTGAAATGG + Intergenic
1032632468 7:133668919-133668941 GGGAAGGGGAGGAGGTGATGGGG + Intronic
1032634045 7:133686716-133686738 TGGGTGTGGATGTGGTGAAAAGG + Intronic
1032800021 7:135310402-135310424 GGGGTGTGGAGGATTAGAGGAGG - Intergenic
1033250390 7:139753452-139753474 TGGGAGTGGACGAGGAGAAGGGG + Intronic
1033411967 7:141126301-141126323 GGGGCCTGGAGGAGGTGAATGGG + Intronic
1033657743 7:143384419-143384441 GGAGGGTGTAGGAGGTGAAGTGG + Intronic
1033969835 7:147025441-147025463 GGGGAGGGGAGGAGGGGGAGGGG + Intronic
1033969843 7:147025455-147025477 GGGGAGGGGAGGAGGGGGAGGGG + Intronic
1034963716 7:155378352-155378374 GTGGGGTGGGGGTGGTGAAGGGG - Intergenic
1034989448 7:155538790-155538812 GGGGTGGGCAGGAGGTGAATAGG - Intergenic
1034997017 7:155584043-155584065 GGGGTGAAGAGGAGGTGAGTTGG - Intergenic
1035410012 7:158632221-158632243 GGGCTGGGGAGGACGTGAGGAGG - Intronic
1035477501 7:159153639-159153661 GGGCTGAGGAGGAGGGGAAAGGG - Intergenic
1035708153 8:1692505-1692527 GGGGAGTGGAGGACAGGAAGAGG + Intronic
1035788645 8:2283570-2283592 AGAATGTGGAGGAGGTGGAGTGG + Intergenic
1035804160 8:2438135-2438157 AGAATGTGGAGGAGGTGGAGTGG - Intergenic
1035889766 8:3330594-3330616 GGAGGGTGGAGGATGAGAAGAGG + Intronic
1036173746 8:6515933-6515955 GGGGTGCAGAGGAAGTGCAGTGG + Intronic
1036193561 8:6693939-6693961 GGTGAGTGGTGGAGGTGAGGAGG + Intergenic
1036216699 8:6885701-6885723 GGGTTGAGGAGGAGGAGTAGAGG - Intergenic
1036301975 8:7574825-7574847 GGGGTGGGGACGGGGGGAAGGGG - Intergenic
1036751332 8:11445313-11445335 GGTGGGTGGAGGTGGTGAGGGGG - Intronic
1036791909 8:11726617-11726639 GGGGAGTGGGGGCGGTGCAGAGG + Intronic
1037414589 8:18635884-18635906 GGGGTGGGGTGGAGGGCAAGGGG + Intronic
1037420460 8:18696231-18696253 GAGGTGAGGAGGAGGTGGAAAGG - Intronic
1037585598 8:20273909-20273931 GGGGAGGGGAGGAGAGGAAGTGG - Intronic
1037635103 8:20694553-20694575 GGGGTGAGCAGGAGGAGAAAGGG - Intergenic
1037760436 8:21738216-21738238 GGGGTGGGGAAGAGGGGAGGAGG - Intronic
1037811712 8:22090307-22090329 GGGTTGGGGAGGAGGTGGTGGGG - Intronic
1037881350 8:22574936-22574958 GGGGTGGGGAGGAAATGAAAGGG - Exonic
1037907948 8:22726541-22726563 GGCGTGAGGAGGAGGGGAAAGGG + Intronic
1037916654 8:22777232-22777254 GGGGAGTGGAGGAGTAGAGGAGG - Intronic
1038197911 8:25385005-25385027 TGGGAGTGGAGCAGGTAAAGGGG + Intronic
1038436575 8:27540739-27540761 GGGCTGTGGTGGAGGAGAACTGG - Intronic
1038716294 8:29994113-29994135 GCGATCTGGAGGACGTGAAGGGG - Intergenic
1038981932 8:32769283-32769305 CGTGTGTGAAGGAGGTGAGGTGG + Intergenic
1039132867 8:34287402-34287424 GGGCTGAGGAAGAGGTAAAGTGG - Intergenic
1039745882 8:40426234-40426256 GGGGTCTTCAGGAGGTGATGGGG + Intergenic
1039781714 8:40792701-40792723 GGGGAGGGGAGGAGGTGGGGAGG + Intronic
1039781750 8:40792941-40792963 GGGGTGTGGGGATGGTGAATAGG + Intronic
1039840935 8:41292421-41292443 AGTGTGTGAAGGAAGTGAAGGGG - Intronic
1039908794 8:41807940-41807962 GGGAAGAGGAGGAGGGGAAGAGG + Intronic
1040071974 8:43195783-43195805 AGGGTGTGGAAGAGGAGTAGGGG + Intronic
1040442157 8:47454478-47454500 GGGGTGCGGGGGTGGGGAAGCGG + Intronic
1040563244 8:48543282-48543304 TGGGTGGGGAGGAGATGAAGAGG - Intergenic
1040590682 8:48789693-48789715 CGGGTGTGGCGGAGGTGAGGTGG + Intergenic
1041029736 8:53724583-53724605 GGGGCGGGGAGGAGGGGGAGGGG - Intronic
1041304197 8:56443998-56444020 GGATTGTGGGGGAGGAGAAGAGG - Intronic
1041380619 8:57250835-57250857 GGCCTGTGCAGAAGGTGAAGAGG - Intergenic
1041451659 8:58012811-58012833 GGGGAGTGGAGGAGTGGATGAGG + Intronic
1041661285 8:60403929-60403951 GCGGTGAGGAGGAGGGAAAGTGG + Intergenic
1041746168 8:61211391-61211413 GGGAGGAGGAGGAGGTAAAGGGG - Intronic
1042797300 8:72678437-72678459 GGGGTGGGGAGGAAGCAAAGAGG - Intronic
1043215388 8:77579872-77579894 GGATAGTGGAGGAGGAGAAGTGG + Intergenic
1043427073 8:80158241-80158263 GGGGTGGGGAGGAGGAGAATGGG - Intronic
1043524987 8:81086828-81086850 ATGGTGTGGAGGAGGTGCATTGG + Intronic
1043679321 8:83002139-83002161 TTGGTGTGGAGGTGGTGAAAAGG + Intergenic
1043912420 8:85878401-85878423 GGGGTATTGAGGAGGGGCAGAGG - Intergenic
1044014183 8:87030897-87030919 GGGGGGAGGAGGAGGTGGGGAGG - Intronic
1044188134 8:89281123-89281145 AGGATGTGGAGCAGGTGACGTGG - Intergenic
1044352867 8:91186802-91186824 GGGGTGGTGAGGAGGTGGATGGG + Intronic
1044601693 8:94011675-94011697 GGAGTGGGGAGGTGGGGAAGAGG + Intergenic
1044847445 8:96396075-96396097 GGGGTTTGGGGGAGGTGATTAGG + Intergenic
1044935006 8:97285573-97285595 GAGGTGGGGAGGACTTGAAGTGG - Intergenic
1044983261 8:97736404-97736426 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1044997312 8:97849790-97849812 GGGGGGTGGAGGAGGGGGGGTGG - Intronic
1044998097 8:97856128-97856150 GGGGGGGGGAGGAGGAGGAGGGG + Intergenic
1045050317 8:98318853-98318875 GGGGTGTGGAGAGAGAGAAGGGG - Intergenic
1045863353 8:106837818-106837840 GGTGTGTGGAGGAGAAAAAGGGG - Intergenic
1046238304 8:111456837-111456859 GAGGTGTGGAGGAGATCCAGGGG + Intergenic
1046819909 8:118622614-118622636 GGGGTGTAGGGGAGGAGGAGTGG + Intergenic
1046936064 8:119887133-119887155 GGGGAGGGGAGGAGGGGAGGGGG - Intronic
1047802762 8:128327017-128327039 TGGGTGAGGAGGAGGTGACTAGG - Intergenic
1048069173 8:131003873-131003895 AGGAGGTGGAGGAGGAGAAGAGG + Intronic
1048643254 8:136388170-136388192 GGAGTGTGGAGGGGCTGGAGGGG - Intergenic
1048748446 8:137643190-137643212 GTGGAGTGTATGAGGTGAAGTGG - Intergenic
1049214807 8:141402677-141402699 GAGGTATGGGGGAGGGGAAGAGG - Intronic
1049310484 8:141931378-141931400 GGCCTGAGGAGGAGGTGAGGAGG + Intergenic
1049314615 8:141956935-141956957 GGGGTGTGGAGCAGGTGGAGGGG + Intergenic
1049351690 8:142168000-142168022 GGGATGGTGAGGAGGTGACGAGG - Intergenic
1049388048 8:142354125-142354147 TGGGGGTGGATGAGGTGAAATGG + Intronic
1049418408 8:142505906-142505928 GGGAGGTGGGGGAGGTGAAGCGG + Intronic
1049419348 8:142510129-142510151 GGGGTGGAGAGGAGGAGGAGGGG + Intronic
1049440292 8:142606480-142606502 TGGGTGAGGAAGGGGTGAAGAGG - Intergenic
1049442386 8:142615281-142615303 GGGGTTTGGAGGACATGGAGGGG + Intergenic
1049468725 8:142765471-142765493 GGGGTGGGGAGGAGGTGGAGGGG + Intronic
1049547961 8:143243361-143243383 GGGGGGAGGAGGAGGGGGAGGGG + Intergenic
1049547981 8:143243396-143243418 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1049575756 8:143388907-143388929 CGGGTGGGGAGGAGGGGAAGAGG + Intergenic
1049632196 8:143664863-143664885 GGGGTCTGGAGCAAGGGAAGGGG - Intergenic
1049665631 8:143841340-143841362 GGGGCTTCGAGGAGGTGAGGCGG - Intergenic
1049797626 8:144503867-144503889 GGGGTGCTCAGGAGGTGAAGGGG - Intronic
1050331117 9:4547334-4547356 GGGGTTTGGTGGAGGAAAAGTGG - Intronic
1050359927 9:4820232-4820254 AGGGTGTGTGGGAGGTGAATGGG + Intronic
1050458220 9:5854166-5854188 GGGATCTGGAGGAGGAGAAGGGG + Intergenic
1051183802 9:14438560-14438582 AGGGGGTGGTGGAGGTGGAGAGG + Intergenic
1051337114 9:16076075-16076097 TGGGTGTAGAGGAGGTAGAGGGG + Intergenic
1051642743 9:19238582-19238604 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1051724822 9:20078302-20078324 GGGGAGTGGGGGTGGGGAAGTGG - Intergenic
1053131310 9:35617294-35617316 CGGGTGCGCAGGAGGAGAAGGGG - Intronic
1053524903 9:38818674-38818696 GAGGTGAGGAGTTGGTGAAGTGG - Intergenic
1054197135 9:62043090-62043112 GAGGTGAGGAGTTGGTGAAGTGG - Intergenic
1054641273 9:67545604-67545626 GAGGTGAGGAGTTGGTGAAGTGG + Intergenic
1054785092 9:69202757-69202779 AAGAGGTGGAGGAGGTGAAGGGG + Intronic
1054879059 9:70126100-70126122 TGGGGGTGGGGGAGGGGAAGAGG - Intronic
1055068065 9:72138632-72138654 GGAGTATGCAGGAGTTGAAGGGG + Intronic
1055380151 9:75697810-75697832 GGGGTGGGGTGGAGGTAAAAAGG - Intergenic
1055581492 9:77711177-77711199 GGGGAGGGGAGGAGGGGAAGGGG - Intergenic
1056091528 9:83210233-83210255 GGGGTTTGGAGGGGGCCAAGGGG + Intergenic
1056381692 9:86062395-86062417 AGGATGGGGAGGAGGGGAAGGGG + Intronic
1056531592 9:87492913-87492935 GAGGTGTGGGAGAGGTGCAGGGG + Intergenic
1056656353 9:88512662-88512684 GGGTTGAGGAGAAGGTGTAGGGG + Intergenic
1056735782 9:89208524-89208546 AGTGTGTGAAGGAAGTGAAGGGG - Intergenic
1056754458 9:89373187-89373209 GGGGTGCGGTGGAGGTGATGTGG - Intronic
1056819758 9:89830783-89830805 GGGCTGAGGAGGAGGGGAGGAGG - Intergenic
1057181591 9:93033526-93033548 GAGGAGTGGAGGAGGAAAAGAGG - Intronic
1057222302 9:93263812-93263834 GGGGTGTGGTGGGGGTGGGGGGG + Intronic
1057489359 9:95509251-95509273 GGGGAGGGGAGGGGGTGGAGGGG + Intronic
1057497382 9:95571871-95571893 GGGGGGAGGAGGAGGAGAGGGGG + Intergenic
1057547048 9:96026515-96026537 GGGGTGTGGAGCAGATGCTGCGG - Intergenic
1057548456 9:96035047-96035069 GGGGTGTGGTAGAGGAGATGGGG - Intergenic
1057700514 9:97360462-97360484 GGGGTCTGGATGAGGTGTTGGGG - Intronic
1058360773 9:104143718-104143740 GGGCTGGGGAGCAGGGGAAGTGG - Intergenic
1058495731 9:105557501-105557523 GGGGTGTGGCGGGGGTGGGGGGG - Intergenic
1058736838 9:107901307-107901329 TAGGTGTGGAGGTGGAGAAGAGG + Intergenic
1059325783 9:113503437-113503459 GGAGTGTGAAGGAGGGGAAGAGG - Intronic
1059371093 9:113836974-113836996 GGAGTGTGGGGGATGGGAAGAGG - Intergenic
1059409848 9:114124955-114124977 GGGGTGGGGAGACGGTGATGGGG - Intergenic
1059760235 9:117330588-117330610 TAGGTGGGGAGGAGGCGAAGAGG - Intronic
1059999693 9:119946992-119947014 GGGGTGGGGAGGGGGTGGGGAGG + Intergenic
1060000812 9:119957113-119957135 GGGGGGTGGAGCAGGTGGATTGG - Intergenic
1060082249 9:120660553-120660575 GGGGTGTGGTGGGGAGGAAGTGG - Intronic
1060108618 9:120890931-120890953 GGGGTGGAGAGTAGGAGAAGAGG - Intronic
1060298444 9:122359357-122359379 GAGGTGGGGAGGAGGAGAAATGG - Intergenic
1060374371 9:123105460-123105482 AGGGGGTTGAGGTGGTGAAGAGG - Intergenic
1060513510 9:124251142-124251164 GGGCTGGGGAGGAGGTGGAGAGG - Intergenic
1060513865 9:124253659-124253681 GGGCTGGGGAGGAGGTGGAGAGG + Intergenic
1060610942 9:124963882-124963904 AGGCTGTGGAGGAGGAGGAGGGG + Intronic
1060919454 9:127409505-127409527 GGGAAGTGGGGGAGGTGATGGGG + Intergenic
1061042847 9:128149829-128149851 GGGGTGGGGATGGGGGGAAGGGG - Intronic
1061147337 9:128807755-128807777 TGGGTGTGGCAGGGGTGAAGTGG + Intronic
1061465787 9:130778439-130778461 GGGGTGAGGAGGTGGAGAAGTGG + Intronic
1061594739 9:131621581-131621603 AGGGTGGGGAGGTGGTGGAGTGG + Intronic
1061753989 9:132799979-132800001 GGACTGTGGAGGAGGAAAAGGGG + Intronic
1061887191 9:133597484-133597506 GAGGTGTGGAGAAGTTCAAGGGG + Intergenic
1061903072 9:133683016-133683038 GGGGGGTGCAGGGGGTGCAGGGG - Intronic
1061986753 9:134134698-134134720 GGGGTGGGGAGGGAGAGAAGTGG + Intergenic
1062101773 9:134732187-134732209 GGGGTGTGTAGGGTGTGAACAGG + Intronic
1062190919 9:135247435-135247457 GGGGAGTGGAGGAAGAGGAGGGG + Intergenic
1062326282 9:136014046-136014068 GGGGAGGGGGGGAGGTGGAGGGG + Intronic
1062369764 9:136231895-136231917 AGGGGGTGGAGGGGGTGGAGAGG - Intronic
1062382170 9:136291727-136291749 GGAGTGTGGGGGCGGTGAGGAGG + Intronic
1062469721 9:136697044-136697066 GGGGGGAGGAGGAGGGGGAGGGG - Intergenic
1062510329 9:136901866-136901888 GGGGAGTGGGCGAGGAGAAGAGG - Intronic
1185499130 X:584276-584298 AGGGAGAGGAGGAGGGGAAGGGG + Intergenic
1185499158 X:584376-584398 AGGGAGAGGAGGAGGGGAAGGGG + Intergenic
1185575541 X:1169190-1169212 GGAGGGAGGAGGAGGTGGAGGGG + Intergenic
1185581411 X:1213324-1213346 GGGGTGGGGTGGGGGGGAAGGGG - Intergenic
1185647426 X:1625047-1625069 TGGCAGTGGAGGAGGTGAAAGGG + Intronic
1185661905 X:1735141-1735163 AGGGGGAGGAGGAGGAGAAGTGG - Intergenic
1185942750 X:4339478-4339500 GGGGAATGGGGGAGGTGAACTGG - Intergenic
1186058265 X:5674577-5674599 GGGGAGGGGAGGGGGGGAAGAGG + Intergenic
1186181655 X:6979306-6979328 TGTGTGTGGAGGAGGTGGTGGGG - Intergenic
1186356870 X:8799748-8799770 GGGGAATGGAGGTGGTGGAGAGG - Intronic
1186357194 X:8800863-8800885 GGGGAATGGAGGGGGTGGAGAGG - Intronic
1186428855 X:9487301-9487323 GGGCTGGGGAGAAGGGGAAGGGG - Intronic
1186518498 X:10185384-10185406 GTGGTGTGGAGGAGAGGGAGGGG + Intronic
1187103602 X:16219333-16219355 GGGTTGTGGAGGAGATGTTGAGG + Intergenic
1188150403 X:26667360-26667382 AGGGGGAGGAGGAGGAGAAGAGG - Intergenic
1188450717 X:30306258-30306280 TGGGTGGGGAGAAGGTGGAGGGG - Intronic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1189381839 X:40507650-40507672 GTGGAGTGGAGGAGGTGAGATGG + Intergenic
1189988874 X:46576189-46576211 AGGGAGAGGAGGAGGGGAAGGGG - Intronic
1190179240 X:48177532-48177554 GGAGAGGGGAGGGGGTGAAGGGG + Intergenic
1190190684 X:48274516-48274538 GGGAGGGGGAGGAGGAGAAGGGG + Intronic
1190324818 X:49199996-49200018 GGGGTCTGCGGCAGGTGAAGGGG - Intronic
1190690582 X:52909989-52910011 GAGGTGAGGAGGAGTTGCAGAGG + Intergenic
1190695401 X:52945803-52945825 GAGGTGAGGAGGAGTTGCAGAGG - Intronic
1190806324 X:53840933-53840955 CGGTAGTAGAGGAGGTGAAGGGG + Intergenic
1191626226 X:63274331-63274353 TGGGTATGGAGGAGGTAAAGAGG - Intergenic
1191675127 X:63785251-63785273 GGGCTGTGGAGGAGGGGCGGCGG - Intronic
1191779296 X:64848932-64848954 AGAGTGTGGAGGAGTAGAAGGGG - Intergenic
1191896902 X:66002383-66002405 GGGGTATGGAGGAAGTGGTGTGG - Intergenic
1192078362 X:68023079-68023101 TGGCTGTGGATGAGGTGATGAGG + Intergenic
1192244571 X:69361833-69361855 GGTGTGAGGAGCAGGGGAAGGGG + Intergenic
1192436404 X:71145980-71146002 GGTGTGGGGAGGAGGGGAAGGGG - Intronic
1192454801 X:71267700-71267722 GGGTTGTGGAGGAGTTGTGGAGG - Intergenic
1192667491 X:73102604-73102626 GGGGTGGGGAGGAAGGGGAGGGG + Intergenic
1193893992 X:87087799-87087821 GGAGTGTGGAGGATGGGAGGAGG + Intergenic
1195124872 X:101798270-101798292 GGGGGGTGGAGGGTGTGGAGAGG + Intergenic
1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG + Intergenic
1195254481 X:103079295-103079317 GAGGTGGGTAGGAGGTTAAGGGG - Intronic
1195329217 X:103783010-103783032 GGGGTGGGGAGGAGTTGGATAGG + Intronic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1195947183 X:110227659-110227681 TGGGGGTGGAGGAAGAGAAGAGG + Intronic
1196601547 X:117606494-117606516 GGGGTGGGGTAAAGGTGAAGTGG + Intergenic
1197310086 X:124894085-124894107 GTGGTGAAGAGGAGGTGAAGGGG - Intronic
1197749135 X:129953087-129953109 GGGGTGGTGCGGAGGGGAAGGGG - Intergenic
1197749790 X:129956811-129956833 GGGGTGGGGGGGAGGTGGGGAGG - Intergenic
1197913741 X:131513416-131513438 GGGGGGTAGAGGAGGTGAGGGGG + Intergenic
1198388238 X:136148002-136148024 GGAGTGAGGAGGGAGTGAAGGGG + Intronic
1198538345 X:137609013-137609035 GGGGGGTGGGGGAGGTGGAAGGG + Intergenic
1198934998 X:141895739-141895761 GGGGAGGGGTGGAGGGGAAGGGG + Intronic
1199850704 X:151723341-151723363 GGGAGGTGGGGGAGGTGAAAGGG - Intergenic
1199876193 X:151930237-151930259 GGGGTGTGGAGAAGATGGTGAGG + Intergenic
1199977642 X:152903831-152903853 GGGGTGAGGAGGAGGGGAGAAGG - Intergenic
1200134798 X:153869735-153869757 GGGCTGTGGGGGAGAGGAAGAGG - Intronic
1200135902 X:153874553-153874575 AGGGCTTGGAGGAGGTAAAGGGG - Intronic