ID: 1125887750

View in Genome Browser
Species Human (GRCh38)
Location 15:43241222-43241244
Sequence TTGCTAGACTTTACTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125887750_1125887754 5 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887754 15:43241250-43241272 GAGCTCTGCTTACGCCAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1125887750_1125887759 30 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887759 15:43241275-43241297 GGACTGGCAAGCCTTTCCTTTGG 0: 1
1: 0
2: 0
3: 10
4: 113
1125887750_1125887756 9 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887756 15:43241254-43241276 TCTGCTTACGCCAGGAGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1125887750_1125887757 14 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887757 15:43241259-43241281 TTACGCCAGGAGGGTGGGACTGG 0: 1
1: 0
2: 2
3: 3
4: 139
1125887750_1125887752 1 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887752 15:43241246-43241268 CTGTGAGCTCTGCTTACGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1125887750_1125887755 8 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887755 15:43241253-43241275 CTCTGCTTACGCCAGGAGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1125887750_1125887753 4 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125887750 Original CRISPR TTGCTAGACTTTACTGGCTC AGG (reversed) Intronic
903035853 1:20492086-20492108 TTGCTGGGCTTTCCTGGCCCCGG - Intergenic
905318672 1:37099913-37099935 CTGCTACACTTGACTGGCTCAGG - Intergenic
906610237 1:47196687-47196709 TTCCTTGGCTTGACTGGCTCTGG - Intergenic
909154421 1:72054036-72054058 CTGCTAGACTTAATTAGCTCTGG + Intronic
1068170529 10:53387476-53387498 TTGTTCCACTTTACTGTCTCAGG - Intergenic
1071453120 10:85818697-85818719 TTGCTACATTTTTCTGGCTTTGG - Intronic
1072135199 10:92538521-92538543 TTGCCAGACTTTTCCTGCTCTGG - Intronic
1075024705 10:118975987-118976009 GTGCTTGCCTTTGCTGGCTCTGG - Intergenic
1079123446 11:17701248-17701270 ATGCTGTACTTTACTGGCTCAGG - Intergenic
1083081125 11:60094621-60094643 TGGCTAGACTTGAATGCCTCAGG - Intronic
1083758819 11:64804954-64804976 TTGTCAGACTTTTCTGGCCCAGG - Intronic
1086329532 11:85739832-85739854 TGGCTAGGCTATACTGCCTCTGG + Intronic
1090171184 11:124606113-124606135 TAGCTAGGCTGTTCTGGCTCAGG - Intergenic
1090421884 11:126580854-126580876 TTCCTTGACTTTACAGTCTCCGG + Intronic
1090860535 11:130648690-130648712 GTGCTAGAGTTCCCTGGCTCCGG - Intergenic
1094809808 12:34126008-34126030 TTGCAAGGCATTAGTGGCTCAGG - Intergenic
1098138580 12:67428645-67428667 TTTCCAGATTTTACTGTCTCTGG + Intergenic
1102070510 12:110015261-110015283 TTGCTAGACTCCACTTCCTCAGG - Intronic
1105569275 13:21585284-21585306 TTTTTATACTTTACTGCCTCAGG - Intronic
1107605836 13:42055666-42055688 TTGTTAGGCTTTACTTACTCAGG + Intronic
1109878479 13:68437826-68437848 TTGCTAGTCTTTAATGGCTTAGG - Intergenic
1116068707 14:40015511-40015533 TTGCTTGACTTTATTGGGCCTGG + Intergenic
1118833087 14:69453243-69453265 TTGCTAGACCTTGCTGCTTCTGG - Exonic
1118902127 14:69995011-69995033 TAAATAGACTTTACTGACTCTGG - Intronic
1119035560 14:71227738-71227760 TTACTAGACTTTCCTGGATGAGG - Intergenic
1119504480 14:75160362-75160384 CTATTAGACTTTGCTGGCTCTGG - Intronic
1125887750 15:43241222-43241244 TTGCTAGACTTTACTGGCTCAGG - Intronic
1133116947 16:3582872-3582894 ATGCTAGACATTTCTGGCTGGGG - Intronic
1135189405 16:20342652-20342674 TTGCTAGACTTTACAGCTTTGGG + Intronic
1141050623 16:80759946-80759968 TTACTAGAAATTACTGTCTCAGG + Intronic
1141543587 16:84746634-84746656 TTGCAAGACTGGAGTGGCTCTGG + Intronic
1146857997 17:36271018-36271040 TTGCTACACTTACCTGCCTCAGG + Intronic
1147076791 17:37995553-37995575 TTGCTACACTTACCTGCCTCAGG + Intronic
1147077012 17:37997506-37997528 TTGCTACACTTACCTGCCTCAGG - Intronic
1147088317 17:38075099-38075121 TTGCTACACTTACCTGCCTCAGG + Intergenic
1147108893 17:38245418-38245440 TTGCTACACTTACCTGCCTCAGG - Intergenic
1148420559 17:47542684-47542706 TTGCTATACTTACCTGCCTCAGG + Intronic
1153782966 18:8510255-8510277 TTGCTAGGGTATTCTGGCTCTGG + Intergenic
1158283400 18:55852161-55852183 TCCCTATACTTTTCTGGCTCAGG + Intergenic
1164011307 19:21205473-21205495 TTGCAAGGCATTAGTGGCTCAGG - Intergenic
926392827 2:12411594-12411616 TAGCTAAGCTTTACTGGCTTTGG - Intergenic
928421957 2:31144251-31144273 TGGCAACACTTTACTGGCACTGG - Intronic
930302295 2:49631956-49631978 TAGCTAGACTATCTTGGCTCAGG + Intergenic
933469085 2:82697442-82697464 TTGCTAGATTTCACTGCCTTTGG - Intergenic
942230163 2:173853389-173853411 TTGCTGGACTTAACTGCCACAGG - Intergenic
944482259 2:200169881-200169903 TTGCAAGAGTTTACAGCCTCAGG - Intergenic
947417435 2:229911854-229911876 TTTCTAGCCATTACTGACTCTGG - Intronic
1170602514 20:17851787-17851809 CTGCTAAATTTGACTGGCTCAGG - Intergenic
1172287520 20:33751482-33751504 TTGCTAGACTTCACTGCTGCAGG - Intronic
1172503977 20:35447410-35447432 TTGCTAGAGTTGAGTGTCTCTGG + Intronic
1173425551 20:42940254-42940276 ATGTTATACTTTACTGGCTCTGG + Intronic
1175047859 20:56124312-56124334 TGGCTAGACATTACTGCCTGTGG + Intergenic
1176884066 21:14232934-14232956 TTGCTTGCCTTTACTTGCTATGG - Intergenic
1177955527 21:27593661-27593683 TTGATACACTTTGCTGGCTGAGG - Intergenic
950131076 3:10547082-10547104 CTCCGAGACTTTACTGGCTGGGG + Intronic
950962640 3:17121633-17121655 CAGTTAGAATTTACTGGCTCAGG - Intergenic
951990124 3:28667489-28667511 TTACTAAACTATACAGGCTCTGG - Intergenic
953919673 3:46943302-46943324 TTGCTAGAATTTGCAGGCTCTGG - Intronic
959421153 3:106130597-106130619 TTCCTAGACTTTGATGACTCAGG + Intergenic
964955958 3:162356101-162356123 GTCCTGGACTTTACTGGCTCTGG + Intergenic
972206719 4:36782534-36782556 TGCCTGGATTTTACTGGCTCCGG + Intergenic
978094375 4:104757732-104757754 TTACTAGACATTACTGTCTTTGG + Intergenic
981050898 4:140308553-140308575 TTGCTAAGATTTTCTGGCTCTGG + Intronic
986511826 5:8515248-8515270 TTTGCAGACTGTACTGGCTCTGG - Intergenic
987193182 5:15500186-15500208 TCGCTAGTCTTCACTCGCTCCGG + Exonic
987253995 5:16129873-16129895 TTGATAGGCTTTCCTCGCTCTGG - Intronic
990325061 5:54667055-54667077 TGGCTAGACTTAAATGGCACGGG + Intergenic
1007052822 6:38850216-38850238 ATGCTAATCTTTACTGGCTATGG + Intronic
1007645466 6:43376979-43377001 TTGCTAGATGGTCCTGGCTCAGG - Intergenic
1008899590 6:56595940-56595962 AAGCTAGACGTTCCTGGCTCAGG + Intronic
1012173091 6:96043898-96043920 TTGCTAGTCTTTACAAGTTCAGG + Intronic
1014112858 6:117639254-117639276 TGGCTAAACTTCCCTGGCTCTGG - Intergenic
1014275853 6:119387845-119387867 TTACTAGACTGTATTAGCTCAGG + Intergenic
1022746085 7:33173743-33173765 CTGTTAGACTTTACTGCTTCTGG + Intronic
1024408713 7:49013919-49013941 TTGCTTGACTGTTCTGGCTAGGG - Intergenic
1028205333 7:88010357-88010379 TAGAAAGAATTTACTGGCTCGGG + Intronic
1029893381 7:103955634-103955656 TTGTTTTACTTTCCTGGCTCAGG + Intronic
1031449315 7:121894815-121894837 TTGATAGACTTTATTGGATTTGG + Intronic
1037141464 8:15525344-15525366 TTTCTTGACTTTATTGGCTGTGG + Intronic
1040837392 8:51746801-51746823 AGCCTAGACTTCACTGGCTCAGG + Intronic
1041008260 8:53516537-53516559 TTACTAGACATTGCTGGCTGAGG - Intergenic
1041463580 8:58137648-58137670 TTCCTACACTTCACTGGCTGGGG - Intronic
1046345437 8:112919031-112919053 TTGCTAGAAATTACTGGCGGTGG - Intronic
1047222993 8:122933765-122933787 TTTCCTGACTTTCCTGGCTCAGG + Intronic
1048595818 8:135864573-135864595 TTGCTATCCTTGACTGACTCTGG + Intergenic
1050256266 9:3795326-3795348 CTCCTAGACTCTCCTGGCTCTGG + Intergenic
1051757529 9:20419939-20419961 TTGTTAGACTTTTCTGTGTCAGG - Intronic
1055835733 9:80439238-80439260 TTGCTAGAATTAACAGGCTTGGG + Intergenic
1056291771 9:85150679-85150701 GAGCTAGAATTCACTGGCTCAGG - Intergenic
1060660245 9:125401158-125401180 TTGCCAGAGTTCCCTGGCTCTGG + Intergenic
1060748208 9:126151646-126151668 CTCCCAGACTTTACTAGCTCTGG + Intergenic
1188762434 X:34049319-34049341 TTTCAAGACATTACTGGATCTGG + Intergenic
1189777749 X:44485414-44485436 TTTGTAGACTGTCCTGGCTCTGG + Intergenic