ID: 1125887751

View in Genome Browser
Species Human (GRCh38)
Location 15:43241228-43241250
Sequence CACAGCTTGCTAGACTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125887751_1125887754 -1 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887754 15:43241250-43241272 GAGCTCTGCTTACGCCAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1125887751_1125887756 3 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887756 15:43241254-43241276 TCTGCTTACGCCAGGAGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1125887751_1125887753 -2 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 80
1125887751_1125887759 24 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887759 15:43241275-43241297 GGACTGGCAAGCCTTTCCTTTGG 0: 1
1: 0
2: 0
3: 10
4: 113
1125887751_1125887757 8 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887757 15:43241259-43241281 TTACGCCAGGAGGGTGGGACTGG 0: 1
1: 0
2: 2
3: 3
4: 139
1125887751_1125887752 -5 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887752 15:43241246-43241268 CTGTGAGCTCTGCTTACGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1125887751_1125887755 2 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887755 15:43241253-43241275 CTCTGCTTACGCCAGGAGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125887751 Original CRISPR CACAGCTTGCTAGACTTTAC TGG (reversed) Intronic
900872615 1:5314829-5314851 CACAGCTTGCAATACTGAACAGG + Intergenic
908336924 1:63135571-63135593 CATGGTTTGCTAAACTTTACTGG + Intergenic
920854916 1:209654339-209654361 AACAGCTTCCTGGACTTTGCCGG - Intergenic
923565499 1:235073302-235073324 CTCAGCTTGCTTGAAGTTACTGG - Intergenic
1065716669 10:28576611-28576633 CACAGCATGCTAAATTTTCCAGG - Intronic
1080044105 11:27790224-27790246 CCCAGCTTTCTTCACTTTACTGG - Intergenic
1088415595 11:109585668-109585690 CACAGTTTGCTGCACTTTGCTGG - Intergenic
1092169933 12:6367919-6367941 CCCAGCCAGCTAGACTTTTCTGG - Intronic
1093371788 12:18374950-18374972 CACAGTTTTCCAGGCTTTACAGG - Intronic
1096742919 12:53707342-53707364 CACAAAGTGCTGGACTTTACAGG - Intergenic
1097326318 12:58281411-58281433 CACAGTTTCCTGGACTTAACAGG + Intergenic
1097347171 12:58506261-58506283 AATGGCTTGCTAGACTTTACTGG - Intergenic
1098198366 12:68026689-68026711 CACAGTTTGATAGGCTGTACTGG - Intergenic
1102151822 12:110694013-110694035 CCCAGCTTGCTTGAATTTTCTGG + Intronic
1102221654 12:111198876-111198898 CACAGCTTCCTATACCTTAGGGG - Intronic
1104267867 12:127253520-127253542 CACAGCTTTCTAGATTTACCTGG - Intergenic
1108427293 13:50316084-50316106 CACAGTTTGGTAGAATTCACTGG - Intronic
1113267860 13:108639408-108639430 CACAGCCTGGTAGATTTTCCTGG - Intronic
1117846260 14:59914743-59914765 CATAGCTTGCTTGATTTAACAGG + Intergenic
1120653650 14:87163943-87163965 AACAGTTGGCTAGACTTTCCTGG - Intergenic
1121497965 14:94410265-94410287 CAATGCTTGCTAGACTTTTTTGG - Intergenic
1122748180 14:103912601-103912623 CACGGCTTGCTGAAATTTACAGG + Exonic
1125887751 15:43241228-43241250 CACAGCTTGCTAGACTTTACTGG - Intronic
1129559643 15:76552860-76552882 CACTACTTGCTAGACTCTCCAGG + Intronic
1142501162 17:334179-334201 CACTGCTTCCTAGCCTGTACGGG - Intronic
1145017964 17:19411305-19411327 CGCAGCCTGCTAGCCTTTCCGGG + Exonic
1149395137 17:56232950-56232972 CTAATCTTGCTAGACTTTACTGG + Intronic
1150000763 17:61438011-61438033 CACACCTGGCCTGACTTTACAGG - Intergenic
1153903580 18:9640230-9640252 CACAGATTGCTGGGCTTCACTGG + Intergenic
1155777116 18:29778600-29778622 CAGAGCTAGCTAGAATTTGCAGG - Intergenic
1160322010 18:77905314-77905336 CACAACTTGCTCGATTTTGCTGG - Intergenic
1164142130 19:22480450-22480472 CTCAGCTTGCTAGTATTTAATGG - Intronic
1166451954 19:42909861-42909883 GACAGCTAGATAGACTTTACTGG + Intronic
1166491068 19:43261149-43261171 GACAGCTAGATAGACTTCACTGG + Intronic
925504190 2:4542812-4542834 CACAGGTTTGTAGACTGTACAGG + Intergenic
933135979 2:78736326-78736348 CACAGATTGCTGGACTTCATAGG - Intergenic
933521451 2:83380038-83380060 CACAGCTTTCTAGGCTGTATAGG - Intergenic
935629775 2:105203875-105203897 CACAGCTGTCTACACTTTTCTGG - Intergenic
936176170 2:110222082-110222104 CACAGGTGGCTAGAATTTACAGG - Intergenic
937103182 2:119287254-119287276 CAGAGCTTGCTGGACCTTGCTGG + Intergenic
943882023 2:193157950-193157972 CACAGTTTGGCAGGCTTTACAGG - Intergenic
948054545 2:235001257-235001279 AACTGCATGCTAAACTTTACGGG + Intronic
1169290137 20:4342615-4342637 CACAGCTTTCTTTGCTTTACAGG + Intergenic
1171254910 20:23683199-23683221 CACATCTGGCTGGACTTTATGGG + Intergenic
1171275531 20:23853876-23853898 CACATCTGGCTGGACTTTATGGG + Intergenic
1171282883 20:23916157-23916179 CACATCTGGCTGGACTTTATGGG + Intergenic
1173067837 20:39729904-39729926 CACAGTTTTGTAGGCTTTACAGG - Intergenic
1174346572 20:49934860-49934882 CACAGCATGCCAAAATTTACTGG + Intergenic
1176925725 21:14746454-14746476 CACAGCTCGATAGGCTGTACAGG + Intergenic
1178127548 21:29531602-29531624 CAGAAATTGCTAGACTTTCCTGG + Intronic
1181616167 22:24055981-24056003 CACACCTTTCTTGACTTCACAGG - Intronic
955513309 3:59702825-59702847 GACAGCTTGCTATAATTTATTGG - Intergenic
961289128 3:125831312-125831334 CACAGTTTTGTAGACTGTACAGG + Intergenic
964546961 3:157845037-157845059 CACAGCTAGGAAGTCTTTACTGG - Intergenic
964593371 3:158392739-158392761 AACACCTTGCTTGACGTTACTGG + Intronic
967395018 3:188998467-188998489 CACAGCATGCTAGAGTTTTGTGG + Intronic
969265320 4:6060734-6060756 CAAAACTTGCTTGGCTTTACAGG + Intronic
970451805 4:16175493-16175515 CACAGTTTTCTAGATTTTACTGG - Intronic
973687018 4:53380981-53381003 CACAACTTGCTAAAATTTATTGG + Intronic
977472149 4:97454817-97454839 GACAGTTTGAAAGACTTTACTGG - Intronic
978152513 4:105454045-105454067 CACACCTTGGTAGAATTCACAGG - Intronic
986137319 5:4992762-4992784 CACAGCTGGGGAGACGTTACTGG - Intergenic
986176337 5:5355148-5355170 CACAGATTTCTAGGCTTCACTGG - Intergenic
989983938 5:50674066-50674088 CACATCTTACTAGTCTTTCCTGG - Intronic
992760974 5:79950666-79950688 CACTGCATGCTAGAGGTTACTGG + Intergenic
994243873 5:97456300-97456322 GAAAGCTTGCTAGACATTTCTGG + Intergenic
994879011 5:105461935-105461957 CACAGTTTCATAGACTTAACAGG + Intergenic
996611292 5:125383080-125383102 CACAACTTGCTTGATTTAACAGG + Intergenic
1004777482 6:18863954-18863976 CACAGCTCTGCAGACTTTACAGG - Intergenic
1014623177 6:123694746-123694768 CCCAGGTTGCTGGACTTTGCTGG - Intergenic
1016157425 6:140829067-140829089 CACAGTTTGCCAGACCTGACTGG - Intergenic
1026495715 7:70900510-70900532 CACAACTTGCCAGAATTTATAGG - Intergenic
1029002335 7:97167376-97167398 CACAGTTTGGTAGCCTTAACAGG - Intronic
1029869192 7:103671155-103671177 TACATCTTGCTAGACTTCAGAGG - Intronic
1031659205 7:124399204-124399226 CATAGGCTGCTAGACTTTTCTGG - Intergenic
1036530102 8:9577430-9577452 CACAGTTTTGTAGACTGTACAGG + Intronic
1038657295 8:29465568-29465590 CACAGCTTGTTGGACTTTAGAGG + Intergenic
1042121232 8:65490591-65490613 AACAGTTTTCTAGACTTTTCAGG - Intergenic
1045966319 8:108028847-108028869 TACAGCTTCCTATAGTTTACAGG - Intronic
1046146422 8:110166512-110166534 CACAGCTCCACAGACTTTACAGG - Intergenic
1046863051 8:119116624-119116646 CACAGTTTTATAGGCTTTACAGG + Intergenic
1047428298 8:124766825-124766847 CACAGCTTGCGAGGCTTCTCAGG - Intergenic
1052126728 9:24785067-24785089 CATAGCTTCCTAGACTATATTGG + Intergenic
1053305363 9:36980896-36980918 CACAGCTTACTAGGCTTTACTGG + Intronic
1054423637 9:64977923-64977945 GACAGCTTTCAAGACTTCACTGG + Intergenic
1055780545 9:79816421-79816443 CATAGCTTGCTTAACCTTACTGG + Intergenic
1056111676 9:83402530-83402552 CACAGTTAGCTAGGCTTTGCTGG + Intronic
1188176319 X:26995168-26995190 TACAATTTGCAAGACTTTACAGG - Intergenic
1191190922 X:57666330-57666352 CAGAGATTGCTAGACTTCAGGGG + Intergenic
1192844546 X:74892312-74892334 CAGGGCTTCCAAGACTTTACAGG + Intronic
1196106336 X:111900081-111900103 TACAGCTTGCTGGTCTTCACAGG - Intronic