ID: 1125887753

View in Genome Browser
Species Human (GRCh38)
Location 15:43241249-43241271
Sequence TGAGCTCTGCTTACGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125887751_1125887753 -2 Left 1125887751 15:43241228-43241250 CCAGTAAAGTCTAGCAAGCTGTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 80
1125887750_1125887753 4 Left 1125887750 15:43241222-43241244 CCTGAGCCAGTAAAGTCTAGCAA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125887753 Original CRISPR TGAGCTCTGCTTACGCCAGG AGG Intronic
903545672 1:24121977-24121999 TGGGCTCTGGTTTCTCCAGGAGG + Intronic
904795873 1:33055991-33056013 TGGTCTCTGCTTACGGTAGGTGG + Intronic
908096309 1:60742666-60742688 TGAGCACAGGTTACACCAGGAGG - Intergenic
910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG + Intergenic
911841455 1:102687170-102687192 GGATCTCTGCTAACTCCAGGAGG + Intergenic
918251700 1:182708734-182708756 TGAGCTCTGATTCCCCCATGCGG - Intergenic
924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG + Intergenic
1083682234 11:64356997-64357019 TGAGATCTGCTTCCCTCAGGAGG - Intronic
1084598642 11:70132071-70132093 GGAGCCCTGCTTACCCCAGAGGG - Exonic
1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG + Intronic
1088375233 11:109133552-109133574 TGAGCACTGCTTCCTCCAGAGGG - Intergenic
1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG + Intronic
1090879947 11:130824665-130824687 TGTGATCTGCTTAAACCAGGTGG - Intergenic
1091106057 11:132920858-132920880 TGAGCTCAGGAGACGCCAGGTGG - Intronic
1091306245 11:134538100-134538122 TGAGCTCTGCAAACGTCTGGTGG + Intergenic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG + Intergenic
1102714714 12:114960357-114960379 TGAACTCTGCTTGGGCAAGGGGG + Intergenic
1104129558 12:125880058-125880080 TGAGGTTTGCTTACTCCAGTGGG - Intergenic
1111833979 13:93364300-93364322 TCAGCTCTGCTTATGACACGTGG - Intronic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG + Intergenic
1124156340 15:27228218-27228240 TGGGGTCTGCTTAAGGCAGGAGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG + Intergenic
1139229896 16:65273538-65273560 TAGGCCCTGCTTAGGCCAGGTGG + Intergenic
1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG + Intronic
1148573148 17:48686705-48686727 TGGGCTCAGCCTCCGCCAGGAGG - Intergenic
1153914390 18:9732988-9733010 TGAGCTGAGCTTTCACCAGGTGG + Intronic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1164563126 19:29307852-29307874 TGAGCTCTGCTTCAGCCAAATGG - Intergenic
1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG + Intergenic
1168552186 19:57305607-57305629 GGAGGACTGCTTAGGCCAGGAGG - Intergenic
925717176 2:6795148-6795170 TGAGCTCTTCTCAGGCCATGAGG - Intergenic
926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG + Intronic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
930280887 2:49368198-49368220 TGAGCTCTGCACATGCCAAGAGG + Intergenic
942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG + Intergenic
943430201 2:187790153-187790175 GGAGAACTGCTTAAGCCAGGAGG + Intergenic
945017325 2:205532976-205532998 TGTGTTCTGCTTTTGCCAGGAGG + Intronic
948372370 2:237497548-237497570 TGTGCTCTGCTCAAACCAGGTGG + Intronic
1170592772 20:17783521-17783543 TGAGATCTGGTGAGGCCAGGAGG - Intergenic
1174173175 20:48629486-48629508 GGAGCTCTGCTACCGCCTGGGGG - Exonic
1175499790 20:59441691-59441713 TGAGCTCTGCTTGTACAAGGTGG - Intergenic
1179054354 21:37916985-37917007 TGAGCTTTGCTTGCACCTGGTGG + Intergenic
1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG + Exonic
1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG + Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG + Intronic
1184755322 22:46512613-46512635 TGACATCTGCTGAAGCCAGGAGG + Intronic
954444124 3:50537479-50537501 TGAGTTCTGCCTCCTCCAGGAGG - Intergenic
955798207 3:62659758-62659780 TGAGCTCTTCTTCACCCAGGTGG - Intronic
959254900 3:103996770-103996792 TGAGCTCTGATGAAGCCAGCTGG + Intergenic
959990344 3:112624348-112624370 TGTGCTTTGCATAAGCCAGGAGG + Intronic
960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG + Intronic
961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG + Exonic
964874491 3:161350802-161350824 TAAGCCCTGCTTCAGCCAGGTGG + Intronic
967670214 3:192224841-192224863 TGACCTCTTCTTACGCTAGTAGG + Intronic
969211898 4:5694368-5694390 TAAGTTCTTCTTAGGCCAGGAGG + Exonic
985625003 5:980998-981020 TGAGGTCTGCTTACTCCAAGAGG + Intronic
985667420 5:1188439-1188461 TGAGTTATGCTTCCGCCAGCAGG - Intergenic
990023507 5:51158150-51158172 TGAGCTCTTCTTTCAACAGGAGG + Intergenic
992671296 5:79063636-79063658 TGAGCTCTGATTTCTCCAGCAGG + Exonic
992937028 5:81718480-81718502 TGACCTCTGCTTCCGGTAGGAGG - Intronic
996893375 5:128450209-128450231 TGTGCTCTGCTTAAGTGAGGTGG - Intronic
999716006 5:154360488-154360510 AGAGCTCTGCTTATGTCATGTGG - Intronic
1002298955 5:178246963-178246985 AGAGATTTGCTCACGCCAGGAGG + Intronic
1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG + Intronic
1006913294 6:37578258-37578280 TCAGCTCTGCAGACGCCTGGGGG + Intergenic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1016982584 6:149866377-149866399 TGACATCTGCTTCAGCCAGGAGG + Intergenic
1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG + Exonic
1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG + Intronic
1024889687 7:54185730-54185752 TGAGCTGTGATTAGGCCAGGAGG + Intergenic
1031827050 7:126578476-126578498 TGAGCTGTGCATTTGCCAGGTGG + Intronic
1035652488 8:1279032-1279054 TGAGCTATACTCACCCCAGGGGG + Intergenic
1049554149 8:143273939-143273961 TCAGCTCTCCTCACGCCAGCAGG - Intronic
1049610430 8:143552653-143552675 AGAGCCCTGCTAAGGCCAGGGGG - Intergenic
1049694625 8:143977258-143977280 TGGGCTCTGCTGACCCCTGGTGG + Exonic
1059004292 9:110384274-110384296 GGAGCTCTGCTTGCCCCATGTGG + Intronic
1059456539 9:114403418-114403440 TGAGCTCTGCTGACCCAGGGTGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG + Intronic
1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG + Intergenic
1200154891 X:153970177-153970199 GGAGCTCTGCCTGCGCCAAGGGG + Intronic