ID: 1125891215

View in Genome Browser
Species Human (GRCh38)
Location 15:43268600-43268622
Sequence GACAGAAGGCAGTCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125891215_1125891225 25 Left 1125891215 15:43268600-43268622 CCTGCTGCAGACTGCCTTCTGTC No data
Right 1125891225 15:43268648-43268670 ACCTCCCAGCTCTGAGGGCTGGG No data
1125891215_1125891222 19 Left 1125891215 15:43268600-43268622 CCTGCTGCAGACTGCCTTCTGTC No data
Right 1125891222 15:43268642-43268664 ACGCTCACCTCCCAGCTCTGAGG No data
1125891215_1125891224 24 Left 1125891215 15:43268600-43268622 CCTGCTGCAGACTGCCTTCTGTC No data
Right 1125891224 15:43268647-43268669 CACCTCCCAGCTCTGAGGGCTGG No data
1125891215_1125891223 20 Left 1125891215 15:43268600-43268622 CCTGCTGCAGACTGCCTTCTGTC No data
Right 1125891223 15:43268643-43268665 CGCTCACCTCCCAGCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125891215 Original CRISPR GACAGAAGGCAGTCTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr