ID: 1125892514

View in Genome Browser
Species Human (GRCh38)
Location 15:43276915-43276937
Sequence GCTGCTCAGAGCCACCATTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125892506_1125892514 29 Left 1125892506 15:43276863-43276885 CCTTTGCTATCTGCCCATTGATG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 110
1125892510_1125892514 3 Left 1125892510 15:43276889-43276911 CCGCTTCCTTCCAGCACCATCGT 0: 1
1: 0
2: 1
3: 14
4: 249
Right 1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 110
1125892512_1125892514 -7 Left 1125892512 15:43276899-43276921 CCAGCACCATCGTGCAGCTGCTC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 110
1125892509_1125892514 15 Left 1125892509 15:43276877-43276899 CCATTGATGAGGCCGCTTCCTTC 0: 1
1: 0
2: 0
3: 15
4: 230
Right 1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 110
1125892511_1125892514 -3 Left 1125892511 15:43276895-43276917 CCTTCCAGCACCATCGTGCAGCT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 110
1125892508_1125892514 16 Left 1125892508 15:43276876-43276898 CCCATTGATGAGGCCGCTTCCTT 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125892514 Original CRISPR GCTGCTCAGAGCCACCATTA AGG Exonic
902597434 1:17519194-17519216 CATAATCAGAGCCACCATTAGGG + Intergenic
902727791 1:18348714-18348736 GCTGCTCACAGGCACTCTTAGGG + Intronic
904860335 1:33533101-33533123 GGTGCTCGGAGCCACCCTTGAGG + Exonic
905806262 1:40879970-40879992 GCTGCTCACAGCCAGCCTCAGGG + Intergenic
911406820 1:97451704-97451726 GCTTCACAGAGCCACCTGTAGGG - Intronic
912530465 1:110317308-110317330 ACTGCCCGGAGCCACCATCAAGG - Intergenic
913555337 1:119961125-119961147 CCTGCACAGTGCCACCATTAGGG + Intronic
915789662 1:158654610-158654632 GCTGCTCAGTTCCATCAATAAGG - Exonic
920519811 1:206614834-206614856 GCAGCTCAGACCCACCAGTGGGG - Intergenic
921322972 1:213961194-213961216 CCTGCTCAGAGTGACCATGAAGG - Intergenic
923365511 1:233256840-233256862 ATTGCTCAGAGCAACCAGTATGG + Intronic
924245781 1:242083169-242083191 TGTTCTCAGAGTCACCATTACGG + Exonic
1063893979 10:10659807-10659829 GCTACTCAGATCCACCAGAATGG + Intergenic
1070783768 10:79151633-79151655 GCTGCTCAGAGCCAGCACTGAGG + Intronic
1073467083 10:103700568-103700590 GCTGCTCAGTGTCACCATCTAGG - Intronic
1074782485 10:116811926-116811948 GCTGCTCACCGCCGCCATTGAGG - Intergenic
1075659379 10:124182731-124182753 GCTGCTCAGAGGCTCCTATATGG - Intergenic
1076494081 10:130885476-130885498 GCTGCCCAGAGCCACCCTCCAGG + Intergenic
1077469616 11:2751021-2751043 CCTGCACAGAGCCACCAGGAAGG - Intronic
1078468588 11:11569264-11569286 GCAGTTCAGAGACACCATCAAGG + Intronic
1079214730 11:18498434-18498456 GCTGATCCAAGTCACCATTATGG - Intronic
1079698186 11:23510449-23510471 TCTGCTAGGAGCCACCATCAAGG + Intergenic
1079783352 11:24637952-24637974 GCAGCTCAGGGTCACCATCATGG + Intronic
1083525883 11:63364482-63364504 GCTTCTGAAAACCACCATTAGGG + Intronic
1085867648 11:80313504-80313526 GCTGCTTAGAGCAGCTATTACGG + Intergenic
1086330905 11:85753219-85753241 GCTGCCCTGACCCACCTTTAAGG - Intronic
1087659811 11:100974053-100974075 GCAGCTCAGAGCCAACAGCATGG + Intronic
1090132218 11:124156352-124156374 GCTGCTCAGAGAGACGATTCAGG + Intergenic
1091843659 12:3638258-3638280 GTTGCTCAAAGCCACCATCCAGG + Exonic
1096405701 12:51342636-51342658 ACTGCTCAGTGCCATCATTCTGG + Exonic
1096592779 12:52672779-52672801 GCTGCTCAGGGCCTCCATGGAGG - Intergenic
1096911440 12:54988635-54988657 GCTGCTCAGAGCCACTGCTCTGG + Intergenic
1099953601 12:89330871-89330893 TTTGCTCATAGCCACCATGAAGG + Intergenic
1102195786 12:111024298-111024320 GCTGCCCAGAGCCCTCATTCAGG + Intergenic
1103957190 12:124583791-124583813 GCAGCTCAGTGACACCATCAAGG + Intergenic
1104417943 12:128610944-128610966 GCTGCCTAAAGCCACCATTCAGG - Intronic
1113241974 13:108348039-108348061 GGTGCTCAAGGCCAACATTAAGG - Intergenic
1113344819 13:109467008-109467030 ACAGCTCTGAGCCACCATTTTGG - Intergenic
1113345210 13:109470699-109470721 ACAGCTCTGAGCCACCATTTTGG - Intergenic
1118286339 14:64477300-64477322 TATGCTCAGAGCCACCATGATGG - Intronic
1120609650 14:86624164-86624186 GCTGCACAGAGTCCCCATTAGGG - Intergenic
1121296613 14:92831043-92831065 GGTGCTCAGAGTCATCACTAAGG + Intronic
1122244649 14:100393835-100393857 GCAGCTCACAGCCACCATCTTGG - Intronic
1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG + Exonic
1127316210 15:57796674-57796696 GCTGCTCAGTGACATCATTGAGG + Intergenic
1131616259 15:94019990-94020012 GCTACTCACAGGCACAATTATGG + Intergenic
1131997364 15:98145103-98145125 GGTTCTCAGGGCCACCATGATGG - Intergenic
1134608440 16:15589365-15589387 GCTACTCAGTGCCACCACAATGG + Intronic
1136398966 16:30007546-30007568 GCTGCTCACTGCCTCCATTCAGG + Intronic
1139420344 16:66845697-66845719 CCTGCTCTGAGCCACCTTTTGGG + Intronic
1140880701 16:79195520-79195542 GCTGCTGAGATCCCCCATTCTGG - Intronic
1142352509 16:89586621-89586643 GGTGTTCAGAGCCACCACTCTGG + Intronic
1143273940 17:5696059-5696081 GCTGCTGGGAGCCACCAATTTGG + Intergenic
1146910429 17:36645156-36645178 TCTGCTCGGAGCCTCCATTATGG + Intergenic
1149376280 17:56047400-56047422 GCTGCTCAAAGCCAGCTCTAAGG - Intergenic
1149830331 17:59866294-59866316 GCTGCAGTGAGCCATCATTATGG - Intronic
1150281452 17:63931599-63931621 CCTGCTCAAAGCCACCATGAGGG - Intronic
1151815809 17:76470799-76470821 GCTGCTCAGAGACAGCAGTTTGG - Intergenic
1152662011 17:81546921-81546943 GCTGCTCAGAGCTGCCTTGAAGG - Exonic
1155429098 18:25737096-25737118 TCTGCTCAGGGCTACCATTAAGG + Intergenic
1163375988 19:16930892-16930914 CCTGCTCACAGCCACCACCAAGG + Intronic
1164813016 19:31172992-31173014 GGGTCTCAGAGCCACCATAAGGG + Intergenic
1165904520 19:39185492-39185514 GCAGCTCAGAGCCACGCTTGGGG + Intergenic
1166017542 19:39994203-39994225 GCTGCTCTGATCTACCATTCTGG - Intronic
1167731226 19:51257823-51257845 GATGCTAAGATCCACCATGAGGG + Exonic
927522088 2:23705085-23705107 TCTGCACACTGCCACCATTAGGG - Intronic
929825230 2:45304855-45304877 GGTGCTTAAAGTCACCATTAAGG + Intergenic
932573085 2:72948568-72948590 GCTGCTCAGCACCACCATGCAGG + Intronic
936157006 2:110053821-110053843 TCTGCACAGAGCCACAATTCTGG + Intergenic
936187688 2:110317623-110317645 TCTGCACAGAGCCACAATTCTGG - Intergenic
937650673 2:124315675-124315697 GCTTCTCAGAGCCACCTGTCAGG - Intronic
940376614 2:152965406-152965428 GCTGCTCATAGCCCTCTTTAAGG - Intergenic
942956359 2:181778785-181778807 GCTGTTCAGAGCCAGCTTTATGG - Intergenic
944667360 2:201968814-201968836 GCTGCTCAGAGCCACCCCACGGG - Intergenic
948800116 2:240429678-240429700 GCTGGTCAACGCCACCTTTAGGG + Intergenic
949077657 2:242071270-242071292 GCTGCTGAGAGCGACAAGTATGG - Intergenic
1171240464 20:23563436-23563458 GCTCCTCAGAGCCAGCCTTCAGG - Intergenic
1171418006 20:24996597-24996619 ACAGCTCAGGGGCACCATTAAGG - Intergenic
950165319 3:10792921-10792943 GCTGCCCAGACCCTCCTTTAGGG - Intergenic
951518192 3:23585085-23585107 GCTGCTCCAAGCCAGCATCATGG - Intronic
951730546 3:25806198-25806220 ACTACTCAGCTCCACCATTATGG - Intergenic
955399535 3:58581547-58581569 GCTGCTCAGAAACCCCATTGAGG - Intronic
955500738 3:59580201-59580223 GCAGGTCAGAGGCACCATTGGGG - Intergenic
956655626 3:71547548-71547570 GCCACTCAGAGCCACACTTAAGG + Intronic
958779002 3:98519467-98519489 GCTGCTCAGTGCTACCATTCTGG + Intronic
962249947 3:133829805-133829827 GATGCTCAGAGCCAACTTTTTGG + Intronic
967265342 3:187686462-187686484 GTGGCTCAGAGTCACCATCATGG + Intergenic
967728146 3:192881246-192881268 CCAGCTGAGAACCACCATTATGG + Intronic
969447352 4:7252974-7252996 CCAGCTCAGAGCCAGCATTTGGG + Intronic
974116924 4:57590479-57590501 GATGACCAGAGCCACCATTTTGG + Intergenic
979192644 4:117881494-117881516 GCTCATCAGAAACACCATTAAGG + Intergenic
981883022 4:149638772-149638794 GCTGCTCACATCCACTATTTTGG - Intergenic
985577408 5:679827-679849 GCCCCTCAGAGCCACCTTCAGGG + Intronic
985592340 5:771923-771945 GCCCCTCAGAGCCACCTTCAGGG + Intergenic
987458861 5:18182074-18182096 CTTGCTCACAGCCACCATTCAGG + Intergenic
989447447 5:41546897-41546919 GCTGCTCAGAACCTCCTTTCAGG - Intergenic
992036426 5:72782963-72782985 GCTGCAGAGAGCCCCCATCAAGG + Intergenic
996754025 5:126917340-126917362 GCTGCTCAGAGCCTGCACTCGGG + Intronic
997440736 5:133907117-133907139 GCTGCTCAGAGCTACGACTCAGG - Intergenic
998167853 5:139854699-139854721 ACTGGACAGAGCCACCATTCTGG - Intronic
1004534721 6:16489562-16489584 GCTTCTCAAAGCCACTATTAAGG + Intronic
1007619808 6:43205045-43205067 ACTGCGCAGAGCCAGCATGAAGG - Exonic
1008917618 6:56806598-56806620 GCTGCTCAGGGCTCCCTTTATGG - Intronic
1013073289 6:106748616-106748638 GATGCTCAGAGCCGCCACCAGGG - Intergenic
1022842984 7:34182276-34182298 GCTGCAGAGAGCCACCATGGGGG + Intergenic
1024261619 7:47577863-47577885 GCTCCTCAGAGCCACCCCTCAGG - Intronic
1027724003 7:81780263-81780285 GCTATTCACAGCCACCATCATGG + Intergenic
1029524606 7:101087338-101087360 GCTGCTCAGGGCCTCCAGGAGGG - Exonic
1034564469 7:151902062-151902084 CCTGCTCCTAACCACCATTATGG + Intergenic
1034961090 7:155364898-155364920 CATGCTCAGAGCCACCATCCAGG + Intronic
1035067343 7:156116636-156116658 GCTGGTCATGGCCACCATCATGG - Intergenic
1035536196 8:393066-393088 GCTGCTGAGAGCGACAAGTATGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037715219 8:21391771-21391793 GCTGCTCAGAAACACCAGGAAGG + Intergenic
1039389212 8:37163543-37163565 GCTGCTCAGAGCCGTCACCAAGG - Intergenic
1048026127 8:130588581-130588603 GCTGCTCAGATCCTCCTTCAAGG + Intergenic
1049492712 8:142913692-142913714 GGTTCTCACAGCCACCATTAGGG + Intronic
1050814414 9:9791151-9791173 GCTGCATATAGCCATCATTAAGG + Intronic
1059405100 9:114094467-114094489 GAGGCCCAGAGCCACCTTTATGG + Intronic
1061401742 9:130372250-130372272 GCTGCTCAGAGCCATGCTTGGGG + Intronic
1062397567 9:136358581-136358603 GCGGCTCAGAGACACCTTTGGGG - Exonic
1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG + Exonic