ID: 1125896032

View in Genome Browser
Species Human (GRCh38)
Location 15:43302353-43302375
Sequence CCTTCCATCCCTGAGTCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125896023_1125896032 22 Left 1125896023 15:43302308-43302330 CCTAATTGCCTCTTGAGCATTTA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1125896032 15:43302353-43302375 CCTTCCATCCCTGAGTCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1125896024_1125896032 14 Left 1125896024 15:43302316-43302338 CCTCTTGAGCATTTACAGTCACC 0: 1
1: 0
2: 0
3: 14
4: 97
Right 1125896032 15:43302353-43302375 CCTTCCATCCCTGAGTCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1125896025_1125896032 -7 Left 1125896025 15:43302337-43302359 CCCTACTAGAACCTTCCCTTCCA 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1125896032 15:43302353-43302375 CCTTCCATCCCTGAGTCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1125896026_1125896032 -8 Left 1125896026 15:43302338-43302360 CCTACTAGAACCTTCCCTTCCAT 0: 1
1: 0
2: 0
3: 31
4: 914
Right 1125896032 15:43302353-43302375 CCTTCCATCCCTGAGTCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125896032 Original CRISPR CCTTCCATCCCTGAGTCGGG CGG Intergenic
900563349 1:3319585-3319607 CCTTCCATCCCTGAAGCCAGGGG - Intronic
902750440 1:18505442-18505464 CCTTCCCTCCCTAAGCAGGGAGG + Intergenic
904311797 1:29633958-29633980 CCCTCCTTCCCTGAGGCTGGAGG + Intergenic
904346900 1:29878661-29878683 CATGGCATCCCTGAGTGGGGAGG - Intergenic
904410354 1:30321388-30321410 CCTTCCTTCCCACACTCGGGCGG - Intergenic
912495052 1:110086131-110086153 CCTTCCAACCCCCAGCCGGGTGG - Intergenic
916079793 1:161225293-161225315 CCTTCCTTCCCTGAGTCCCAAGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
920291912 1:204929331-204929353 CCATCCAACCCTGAGGAGGGAGG + Intronic
921146351 1:212361563-212361585 GCCTCCATCCCTGGGTCAGGAGG - Exonic
923260587 1:232264329-232264351 CCGGCCATCTCTGAGTGGGGAGG - Intergenic
1062860363 10:805422-805444 CCTCCCATCCCTGCGTGGGGCGG - Intergenic
1063054097 10:2484506-2484528 GCTTCCATCCCTGAGAGTGGTGG - Intergenic
1066472975 10:35717208-35717230 CCTTGCACCCCTGTGTTGGGGGG - Intergenic
1070844371 10:79509971-79509993 CCTTCCAACCTTGAGTCAGTGGG - Intergenic
1070929426 10:80250337-80250359 CCTTCCAACCTTGAGTCAGTGGG + Intergenic
1072320417 10:94244294-94244316 CCTTCCTTCCCAGAGACGCGTGG + Intronic
1076424116 10:130355249-130355271 CCTTCCTTCCCTGGGTCAGGAGG + Intergenic
1076896712 10:133316768-133316790 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896774 10:133317028-133317050 CTTTCCATCTCTGCGTCTGGAGG - Intronic
1076896916 10:133317540-133317562 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896925 10:133317574-133317596 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896934 10:133317608-133317630 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896947 10:133317644-133317666 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896959 10:133317679-133317701 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896971 10:133317714-133317736 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896984 10:133317779-133317801 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076896998 10:133317818-133317840 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897007 10:133317852-133317874 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897018 10:133317886-133317908 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897027 10:133317918-133317940 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897037 10:133317951-133317973 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897046 10:133317985-133318007 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897058 10:133318020-133318042 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897068 10:133318053-133318075 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897078 10:133318086-133318108 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897094 10:133318152-133318174 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897100 10:133318183-133318205 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897109 10:133318217-133318239 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897115 10:133318248-133318270 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897126 10:133318282-133318304 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897135 10:133318316-133318338 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897147 10:133318351-133318373 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897157 10:133318384-133318406 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897175 10:133318455-133318477 CTTTCCATCTCTGTGTCTGGGGG - Intronic
1076897193 10:133318499-133318521 CTTTCCATCTCTGCGTCCGGGGG - Intronic
1082701194 11:56433252-56433274 TCCTCCACCCCTGAGTTGGGTGG + Intergenic
1086153966 11:83645484-83645506 ATTTCCTTCCCTGAGTCTGGAGG - Intronic
1089287821 11:117419167-117419189 CCTCCAATCCCTGTGCCGGGAGG - Intergenic
1095741501 12:45611369-45611391 CCTTCCATCCTTTCGTCGGCTGG + Intergenic
1096080286 12:48828229-48828251 CATCCCTTCCCTGAGTCTGGTGG - Exonic
1097177542 12:57152084-57152106 CCTTCCTTCCCGGAATTGGGAGG + Intronic
1104589779 12:130075018-130075040 CCCTCCACCCCCGAGGCGGGAGG + Intergenic
1113778519 13:112962708-112962730 CCTTCCCTCCCAGAGCCTGGGGG - Intronic
1115797819 14:36959002-36959024 CCTTCCATGCTTGAATAGGGTGG - Intronic
1121440250 14:93944462-93944484 CCTTCCATGCCTGGGACGGATGG + Intronic
1125692093 15:41604151-41604173 CCTTGTCTCCCTGAGTGGGGAGG + Intergenic
1125896032 15:43302353-43302375 CCTTCCATCCCTGAGTCGGGCGG + Intergenic
1132314182 15:100879034-100879056 CCTTCCATCCCAGAGCCCGGGGG - Intronic
1133220235 16:4316492-4316514 CCTTCCTTCCCTCCGTCTGGAGG + Intronic
1135741368 16:24978052-24978074 CCTGCCAGCCCTGAGTCCTGGGG - Intronic
1135818596 16:25658750-25658772 CCTTCAATCCCAGAATCAGGAGG - Intergenic
1137618161 16:49858733-49858755 CCGTCCATCCCTGGGCCGCGGGG - Intergenic
1139325374 16:66148584-66148606 CCTAGCATATCTGAGTCGGGAGG + Intergenic
1141675014 16:85513255-85513277 GCTGCCATCTCTGAGCCGGGAGG - Intergenic
1142095704 16:88238295-88238317 CCTTCTGTCCCTCTGTCGGGTGG + Intergenic
1143305936 17:5946782-5946804 CCTTCCATCCTGGAGAAGGGTGG + Intronic
1143981923 17:10877521-10877543 CCTTCCCTCTGTGAGTAGGGGGG - Intergenic
1144582089 17:16464825-16464847 CCCTGCCTCCCTGAGGCGGGAGG + Intronic
1145998032 17:29115587-29115609 GCTGCCATCCCTGGGGCGGGAGG - Intronic
1146951259 17:36908187-36908209 CCTACCTTCCCTGGGTGGGGTGG - Intergenic
1148715110 17:49710553-49710575 CCATCCAGCCCTGGGGCGGGCGG + Exonic
1151246657 17:72800171-72800193 ACCTCCATCCCTGAGGCAGGAGG + Intronic
1156149067 18:34222695-34222717 GCTTCCTTCCCCGGGTCGGGCGG - Intronic
1156373918 18:36495339-36495361 CCTGCCATCCCAGACTCAGGTGG - Intronic
1161393071 19:4031394-4031416 CCCTCCATCCCCGAGCCTGGAGG - Intronic
1163248431 19:16111565-16111587 CCTTCCACCCCCGACTCGGGCGG - Intergenic
1165350006 19:35270012-35270034 CCTGCCACCCCTGGGTGGGGGGG + Intronic
1166077564 19:40422658-40422680 CCTGCCAGCCCTGAGACAGGAGG + Exonic
1166297871 19:41897514-41897536 CCTCCCTTCCCTGAGGCAGGGGG - Intronic
1167086149 19:47310950-47310972 CCTGTCATCCCTGCGTCTGGAGG + Intronic
1168244067 19:55101633-55101655 GCTTCCACCCCTGAGTCCTGGGG - Intronic
925533710 2:4893029-4893051 CCTTCCTTCCCTGAGTTCAGAGG - Intergenic
932182635 2:69662423-69662445 GGCTCCATCCCTGAGTGGGGAGG + Intronic
932190554 2:69738520-69738542 GGCTCCATCCCTGAGTGGGGAGG - Intronic
934514804 2:94980152-94980174 CCTTCTGTCCCTGACTCTGGGGG - Intergenic
939844741 2:147229410-147229432 TCTTCCATCCCTGGGTGGGATGG - Intergenic
945015511 2:205510585-205510607 CCTTTCATCCCTGACCCTGGGGG + Intronic
947590553 2:231382827-231382849 CCTTCCAGCCCTGACTCCTGCGG + Intergenic
1180879914 22:19196295-19196317 CCTTCCAGGCCTCAGTGGGGTGG + Exonic
1181458990 22:23075206-23075228 CCTCCCTTCCCTGAGTGGGCGGG + Intronic
1182038751 22:27219858-27219880 CCTTCCCTGCCTGGGTGGGGTGG - Intergenic
1183650180 22:39149137-39149159 CCTCCCATCTCGGAGTTGGGAGG - Intronic
1184405553 22:44298661-44298683 CCTTCCCTCCCTGAGTCCTGTGG - Intronic
1184462820 22:44648909-44648931 CCTCCCATCCCGGAATCGGGGGG + Intergenic
1185073439 22:48669650-48669672 CCTTTCCTCCCTGAGCCAGGGGG + Intronic
1185300130 22:50075213-50075235 CCAGCCCTCCCTGAGTCTGGCGG - Intronic
949497026 3:4641788-4641810 CCTGCCATCCGTCAGTGGGGTGG - Intronic
954212229 3:49104388-49104410 CCGGGTATCCCTGAGTCGGGAGG + Exonic
960655928 3:120004093-120004115 CCTCCCATGCCTGACTCGGCGGG + Intronic
968551471 4:1225851-1225873 GCTGCCAGCGCTGAGTCGGGAGG - Intronic
969422647 4:7106339-7106361 CCTGCCATCTCTGAGGCTGGTGG + Intergenic
971606454 4:28664627-28664649 CCTTCCCTCCCTGAGTCTGTAGG - Intergenic
975844029 4:78506547-78506569 TCTCCCATGCCTGACTCGGGGGG - Intronic
981216964 4:142181225-142181247 CCTTCCATTCCTGAGACGAAGGG + Intronic
992947111 5:81821946-81821968 CCTTCCACAACTGAGTCTGGAGG - Intergenic
1008909457 6:56717477-56717499 CCTCTCATCCCTTAGTCTGGTGG - Intronic
1018647058 6:165958786-165958808 CCCTCCAGACATGAGTCGGGAGG - Intronic
1019527553 7:1487515-1487537 CCTCCCATCCCTGCTTCGAGGGG + Intronic
1024458645 7:49636912-49636934 CCTTCCATCCCGCTGTCGGCCGG - Intergenic
1026742353 7:72986830-72986852 CCTTCCATGCCTGAGTAGCTGGG - Intergenic
1026802201 7:73407252-73407274 CCTTCCATGCCTGAGTAGCTGGG - Intergenic
1027028475 7:74871564-74871586 CCTTCCATGCCTGAGTAGCTGGG - Intergenic
1027101382 7:75378248-75378270 CCTTCCATGCCTGAGTAGCTGGG + Intergenic
1031897578 7:127369180-127369202 CCTTCCATTCCTAAGTGTGGTGG - Intronic
1032466639 7:132150124-132150146 CCATCCATCCCTTAGTCCTGTGG + Intronic
1034543542 7:151775431-151775453 CCTTCCCTTCCTGAGTCCTGAGG + Intronic
1041414752 8:57595292-57595314 CCTTCCATCTCAGAGTGTGGTGG + Intergenic
1042761815 8:72279699-72279721 CCTTACATTCCTGAGTGGGTGGG - Intergenic
1044589742 8:93902527-93902549 CCTACCATCTCTAAGTCTGGAGG - Intronic
1046974458 8:120258458-120258480 CCTTCCACCCCTGTATCTGGTGG + Intronic
1049969393 9:808073-808095 CTTTCCAACCCTGATTCAGGAGG + Intergenic
1052791269 9:32877395-32877417 CCATCCATCCCTGAGTCATGAGG + Intergenic
1186788067 X:12971781-12971803 CCCTCCAACCCTGTGTCTGGTGG - Intergenic
1189978469 X:46486187-46486209 CCTTCCATGCCTGGCTCGGCAGG - Intronic
1196518280 X:116640212-116640234 CCTACCATTCCTGGGTCTGGAGG + Intergenic
1196951300 X:120877678-120877700 CATTTCATCCCACAGTCGGGAGG - Intronic
1196955553 X:120958353-120958375 CATTTCATCCCACAGTCGGGAGG - Intronic
1196956233 X:120963214-120963236 CATTTCATCCCACAGTCGGGAGG - Intronic
1196956915 X:120968074-120968096 CATTTCATCCCACAGTCGGGAGG - Intronic
1196957597 X:120972934-120972956 CATTTCATCCCACAGTCGGGAGG - Intronic
1196958279 X:120977794-120977816 CATTTCATCCCACAGTCGGGAGG - Intronic
1196958961 X:120982654-120982676 CATTTCATCCCACAGTCGGGAGG - Intronic