ID: 1125898011

View in Genome Browser
Species Human (GRCh38)
Location 15:43318767-43318789
Sequence TAGGCTAGAAAGTAGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125898009_1125898011 -6 Left 1125898009 15:43318750-43318772 CCAAAACTGAAAAAATCTAGGCT 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1125898011 15:43318767-43318789 TAGGCTAGAAAGTAGGATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1125898007_1125898011 10 Left 1125898007 15:43318734-43318756 CCACAGGGATGTCTTACCAAAAC 0: 1
1: 0
2: 1
3: 5
4: 131
Right 1125898011 15:43318767-43318789 TAGGCTAGAAAGTAGGATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1125898006_1125898011 20 Left 1125898006 15:43318724-43318746 CCAACAGTGGCCACAGGGATGTC 0: 1
1: 0
2: 0
3: 22
4: 187
Right 1125898011 15:43318767-43318789 TAGGCTAGAAAGTAGGATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125898011 Original CRISPR TAGGCTAGAAAGTAGGATGC TGG Intergenic
900891110 1:5450445-5450467 TAGGCTGGGAAGTAGGTGGCAGG - Intergenic
902137953 1:14326906-14326928 GAGGCTATAAAGCAGGATGGGGG - Intergenic
903728290 1:25469374-25469396 TGGGCTAGAAAGTACAATGAAGG - Intronic
910177861 1:84450414-84450436 TAGTCTAGAAACTAGAATCCAGG + Intergenic
912634128 1:111275532-111275554 TATTCTAGAAAATGGGATGCAGG - Intergenic
919635518 1:199999642-199999664 AAGGCTAGAAAGTATAATCCAGG - Intergenic
921349685 1:214222888-214222910 TAGACTAGAAAGTAACATGAAGG + Intergenic
921982256 1:221271663-221271685 TACAATAGAAAGTGGGATGCTGG + Intergenic
1063042108 10:2352848-2352870 AATGTTAGAAATTAGGATGCTGG - Intergenic
1063783316 10:9351513-9351535 GTGGCTAGAATGTAGGATGCAGG - Intergenic
1064851418 10:19713119-19713141 TAGGCAAGAAAGAAGGAAGAAGG - Intronic
1065447613 10:25819538-25819560 TAGGCTAGAAAGCAGAAGTCTGG - Intergenic
1066698373 10:38099308-38099330 TAGAACAGAAAGTAGGATGGTGG - Intronic
1067841467 10:49682845-49682867 TAAGCTACAAAGTAGATTGCAGG - Intronic
1068550433 10:58402148-58402170 AAGGCTAGGATTTAGGATGCAGG + Intergenic
1069903410 10:71718721-71718743 TGGGCTAGCAAATAGGATCCAGG + Intronic
1072453520 10:95557877-95557899 CAGACGAGAAAGTAGGAGGCTGG - Intronic
1073665599 10:105530084-105530106 TAGGCTGGAAATTATGATGATGG + Intergenic
1073975170 10:109092584-109092606 AATGCTAGGAAGTAGGATGAAGG + Intergenic
1075532724 10:123243654-123243676 GAGACTAGAAAGCAGGATGCTGG + Intergenic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1085809458 11:79667271-79667293 TTAGCTGGAGAGTAGGATGCAGG - Intergenic
1086010485 11:82097303-82097325 TAGGCTTAAAAATAGGAGGCAGG + Intergenic
1088100930 11:106154987-106155009 TAGGCAACAAAGTGGGAAGCTGG + Intergenic
1089684942 11:120140785-120140807 GAGGATAGAAAGATGGATGCTGG + Intronic
1090660718 11:128879991-128880013 TAGGCTTGGTACTAGGATGCAGG + Intergenic
1090958512 11:131535269-131535291 TTGGCTAGAATTTAAGATGCCGG - Intronic
1093429456 12:19067882-19067904 TAGGCAAAAAAGTAAGATACAGG + Intergenic
1094373448 12:29763988-29764010 TAGGCTGAATTGTAGGATGCTGG + Intronic
1094559898 12:31542363-31542385 AAGGGTAGAAGGTAGGATGGGGG + Intronic
1106785922 13:33108200-33108222 TAGGCTAGCATGTATGAGGCTGG - Intronic
1108431259 13:50356256-50356278 AAGGCTAGAAAGCAGAAGGCTGG - Intronic
1108730995 13:53235687-53235709 GAGACAAGAAAGAAGGATGCTGG - Intergenic
1113313578 13:109156011-109156033 AAGCTTATAAAGTAGGATGCAGG + Intronic
1115618585 14:35119743-35119765 TAGGAAAGAAAGGAGGAGGCTGG + Intronic
1116018511 14:39433503-39433525 TAGGCAAGAAAGAAGGAAGAAGG + Intergenic
1116183653 14:41568581-41568603 TAAGCAAAAAAGTAGGATTCAGG - Intergenic
1117154170 14:52921469-52921491 TGTGCTAGAAAGTAGGGTGTAGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121691305 14:95878874-95878896 CAGGCTAGAAAGCAGCAAGCTGG + Intergenic
1125735858 15:41925339-41925361 TTGGCCAGAAAGCAGGATGCAGG - Intronic
1125898011 15:43318767-43318789 TAGGCTAGAAAGTAGGATGCTGG + Intergenic
1127223872 15:56910186-56910208 TAGGATTGAAAATAGGAGGCTGG + Intronic
1130948864 15:88570045-88570067 TAGGTTAGAAAGAAAGATGTAGG + Intergenic
1132349084 15:101127326-101127348 GAGGCTAGGCTGTAGGATGCTGG - Intergenic
1133554907 16:6896820-6896842 TAGGATAGAAAGAAGATTGCAGG + Intronic
1138406813 16:56802117-56802139 TAGGGTAGAAGTTAGGAGGCAGG - Intronic
1139427161 16:66888759-66888781 TAGGCTCCAAAGTAAGATTCAGG - Exonic
1150993223 17:70285216-70285238 TAGTCAAGAAAGTATGATACTGG + Intergenic
1153225140 18:2894167-2894189 TAGGCTAGAACGTGGGAAGCAGG + Intronic
1153482712 18:5563656-5563678 TAAGCTAGAAAGCAGGATTCAGG - Intronic
1153957437 18:10109957-10109979 CAGGCTAGAAAGAAAGATGTCGG - Intergenic
1157207976 18:45716642-45716664 TGGGAAAGAAAGTAGGATACAGG + Intergenic
1160215566 18:76926508-76926530 TATGGTAGAAAGTAGGTTTCTGG + Intronic
1160417986 18:78725011-78725033 TAATCTAGAAAGTGGCATGCTGG + Intergenic
925292275 2:2755851-2755873 TAGGGGAGAAAGCAGAATGCTGG - Intergenic
927491181 2:23522083-23522105 TAGGCTATGAACAAGGATGCTGG + Intronic
928616902 2:33050031-33050053 TAGGCAACAAAGCAAGATGCTGG - Intronic
930484453 2:51994907-51994929 TAGGCTTGGATTTAGGATGCTGG + Intergenic
932140165 2:69269558-69269580 TATGCCAAAAAGTAGGACGCTGG + Intergenic
935105992 2:100044215-100044237 GAGGGTAGAATGGAGGATGCGGG - Intronic
940960285 2:159777495-159777517 TATTCTAGAAAGTAGAAAGCTGG - Intronic
942469567 2:176245570-176245592 TAGGATGCAAAGGAGGATGCTGG + Intergenic
943137420 2:183932218-183932240 TAGGGTAGAAAGGAGGATTGAGG + Intergenic
946877134 2:224140429-224140451 TAGGGCAGAAAGGAGGATGTGGG - Intergenic
948590486 2:239046798-239046820 TAGAGTAGAAAGTTGGAAGCTGG - Intergenic
1169515136 20:6308645-6308667 TAGAGTAGAAAGTAGAATGGTGG - Intergenic
1169618017 20:7471693-7471715 TAAGCTAGTATCTAGGATGCAGG + Intergenic
1170095853 20:12645362-12645384 TAGACTAGAAAGCAGCATGGAGG + Intergenic
951342159 3:21501245-21501267 TAGGCAAGAAAGAAGGAAGACGG - Intronic
955855236 3:63265708-63265730 TACACTAGAATGTAGGAAGCAGG + Intronic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
964200572 3:154114493-154114515 TTGGCTAGACATTAGGAAGCTGG - Intergenic
964416561 3:156454174-156454196 TAAGCTAGAGAGTAGCATGCAGG + Intronic
966103861 3:176311209-176311231 TAGGCTAGAAATGAGGAGGGCGG + Intergenic
968409785 4:380083-380105 TAAGCCAGAGAGTAGAATGCTGG - Intronic
969220600 4:5756152-5756174 CAGGTTAGAAAGAAGGATGTTGG - Intronic
971622400 4:28872318-28872340 TGAGCTAGAAAGTAGAATGGTGG - Intergenic
972205972 4:36773293-36773315 TATGCTATAAAGTATGATTCTGG - Intergenic
984781731 4:183532701-183532723 TAGGCTGGAAAGCAGAATGGAGG - Intergenic
989214270 5:38888023-38888045 TAGGCAAGAAAGAAGGAAGGAGG + Intronic
990202565 5:53394530-53394552 TAAGATAGAAAGTAGAATGATGG - Intergenic
996879746 5:128282733-128282755 AAGGGTAGAAAGTACAATGCTGG - Intronic
999070484 5:148738711-148738733 TAGCCTAGAAAGAAGGAGGGAGG + Intergenic
1001958015 5:175861618-175861640 AAGGCTAGAAAGCTGGAGGCGGG + Intronic
1003278043 6:4669022-4669044 TAGGCCAGAAAGCAGGCAGCTGG - Intergenic
1006387167 6:33737711-33737733 TTGGCTGGTACGTAGGATGCGGG + Intronic
1008460282 6:51761386-51761408 TGGACTAGAGAGTAGAATGCAGG + Intronic
1009922615 6:70081264-70081286 TAAGATAGAAAGTAGTATGGAGG - Intronic
1010897111 6:81378160-81378182 TAGGCTAGATACTAGGAAGAAGG - Intergenic
1012083650 6:94793906-94793928 TAGGATAGAAAGAAAGATACAGG - Intergenic
1014964023 6:127723776-127723798 AAGACTAGAAAATAGGGTGCTGG - Intronic
1019807026 7:3135366-3135388 TGGGATAGAAAGAAGGATGCCGG - Intergenic
1021020217 7:15588324-15588346 TCAGGTAGAAAGTAGGATGCAGG + Intergenic
1021476678 7:21069603-21069625 CAGTCTAGATAGTAGGATGAAGG + Intergenic
1022816150 7:33916466-33916488 TTTGCTGGAAAGCAGGATGCTGG - Intronic
1026071284 7:67122780-67122802 TAGGATGGGAAGAAGGATGCAGG - Intronic
1026458292 7:70591746-70591768 TAGACTACAAAGTATGTTGCAGG - Intronic
1031410605 7:121436706-121436728 TAGGCAAGAAAGAAGGAAGAAGG + Intergenic
1031513621 7:122676933-122676955 AAGGCTAGAAGGTAGGTTGAGGG - Intronic
1033294924 7:140123779-140123801 AAGCCTAGAAAATAGTATGCCGG + Intronic
1036031371 8:4977725-4977747 TAAGCTACAAATTAGGTTGCAGG + Intronic
1037401419 8:18498627-18498649 TGCTCCAGAAAGTAGGATGCAGG - Intergenic
1038412470 8:27368884-27368906 TGGGCTAGGAAGGAGGAAGCAGG + Intronic
1040707561 8:50147963-50147985 AATGCTAGAAAGTAGAATACTGG + Intronic
1040946584 8:52891591-52891613 TAGTCTAGAAAATAGGGTGTGGG - Intergenic
1046666185 8:117006163-117006185 TAGGATAGAAATTAGGATGTTGG + Intronic
1047039450 8:120976508-120976530 AAGGCTACCAAGTAGGTTGCTGG - Intergenic
1047214768 8:122867164-122867186 AAGACCACAAAGTAGGATGCAGG - Intronic
1050752788 9:8960701-8960723 TAAGCTAGAAAGTAGGTCTCTGG - Intronic
1052424700 9:28289835-28289857 CAGGCTAGAAACCAGGAAGCAGG + Intronic
1055678024 9:78685735-78685757 AAGGCTAGAATGTAAGATGGTGG + Intergenic
1056956917 9:91090082-91090104 TTGGCTTGAAGGTAGGAGGCTGG - Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1058556780 9:106177205-106177227 TTGGCTAGAAAGTGGAATACAGG - Intergenic
1188332278 X:28889513-28889535 TGGGCTAGAAATTAGGAAGTTGG + Intronic