ID: 1125898451

View in Genome Browser
Species Human (GRCh38)
Location 15:43323064-43323086
Sequence CTGTTCAAATGTAAATTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125898449_1125898451 17 Left 1125898449 15:43323024-43323046 CCATCTCAAAAAAAAAAAAATTA 0: 619
1: 3148
2: 105505
3: 88045
4: 98354
Right 1125898451 15:43323064-43323086 CTGTTCAAATGTAAATTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125898451 Original CRISPR CTGTTCAAATGTAAATTCAA TGG Intergenic
No off target data available for this crispr