ID: 1125898557

View in Genome Browser
Species Human (GRCh38)
Location 15:43324252-43324274
Sequence CCTTCATTACTGAAGTTAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125898549_1125898557 26 Left 1125898549 15:43324203-43324225 CCAAGTTACATGACCTAACTTGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 223
1125898551_1125898557 13 Left 1125898551 15:43324216-43324238 CCTAACTTGCCGGCTTAATGCTA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 223
1125898552_1125898557 4 Left 1125898552 15:43324225-43324247 CCGGCTTAATGCTATTTTACACC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125898557 Original CRISPR CCTTCATTACTGAAGTTAAA AGG Exonic
903544228 1:24113599-24113621 CCTTCCCTACTGAGGTTAATAGG + Intergenic
908711276 1:67018343-67018365 CCTTCATTTCTGAAGTTCCTTGG - Intronic
913097308 1:115531027-115531049 CCATCATTAATGAGTTTAAAAGG + Intergenic
916518296 1:165540730-165540752 CCTTCACAACTGAAGTTTGATGG + Intergenic
916696147 1:167238583-167238605 CCTTCATTAAGGCAGTTAATTGG + Intronic
917346644 1:174035071-174035093 CCTTCCTTGCTGAAATTACATGG + Intergenic
918704152 1:187640177-187640199 TCTTCATTACTGCAGTTACTGGG - Intergenic
920839234 1:209540005-209540027 CCTTCCCTACTGAGGTCAAAAGG - Intergenic
921060844 1:211583243-211583265 GCTTCTTAACTGGAGTTAAAAGG + Intergenic
921667399 1:217889304-217889326 CCTTGAATAAGGAAGTTAAATGG - Intergenic
921816614 1:219571043-219571065 ACTTCATTTCTAAATTTAAAAGG + Intergenic
1064509640 10:16075738-16075760 CATTCATTACTTTAGTGAAAAGG + Intergenic
1065232178 10:23609680-23609702 CCCTCAAAACAGAAGTTAAAGGG + Intergenic
1068138492 10:52974788-52974810 CCTTCATTAGTGAAGGTCACTGG - Intergenic
1068146216 10:53074247-53074269 TTTTCATTACTAAGGTTAAAAGG - Intergenic
1068480551 10:57584251-57584273 CCTTCACTCCTGAAGTCAAGCGG + Intergenic
1072016056 10:91347729-91347751 ACTTTATGACTGAAGTAAAAAGG - Intergenic
1072748364 10:97958095-97958117 CCTTCTCTACTGAGGTTAATAGG + Intronic
1073088899 10:100915930-100915952 CCTTCATAACTCAGATTAAATGG - Intronic
1073255599 10:102149044-102149066 CCTTCATTTCTGCAGTCAGAGGG + Intronic
1074283790 10:112079177-112079199 CCTTCCCTGCTGAAGTTAACAGG + Intergenic
1074884493 10:117683870-117683892 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1081125427 11:39315105-39315127 CTCTGATTACTGAAGATAAAGGG + Intergenic
1081610947 11:44563130-44563152 CCATCCCTACTGAAGTTAATAGG - Intergenic
1092391175 12:8081262-8081284 CTTTTACTACTGAACTTAAATGG + Intergenic
1095665700 12:44795083-44795105 CCTTCATCACTCAAGATCAAAGG + Intronic
1096045370 12:48557583-48557605 CTTTGGTTACTGAAGTTACAAGG + Intergenic
1099448876 12:82784655-82784677 ACTTCAAGACGGAAGTTAAAAGG - Intronic
1099761733 12:86931570-86931592 CATTCAGTACTGAATTTTAAAGG + Intergenic
1102892387 12:116570157-116570179 CCCTCATTACTAAAGTTCACAGG + Intergenic
1103102688 12:118193552-118193574 CCTTCATTTCAGAAGTGTAATGG - Intronic
1105049015 12:133031034-133031056 CATTCATTCATAAAGTTAAAAGG - Intergenic
1106126606 13:26904897-26904919 CCATCCCTACTGAAGTTAATAGG + Intergenic
1106228468 13:27802854-27802876 GCTTCACTCCTGAACTTAAATGG - Intergenic
1109287924 13:60433915-60433937 CTTTCCTTACTGATGGTAAAGGG + Intronic
1109747405 13:66644647-66644669 CCTTGATGACTGATGTAAAATGG - Intronic
1111025974 13:82524979-82525001 ACTTCATTAAAGAAGTTCAAAGG - Intergenic
1111707152 13:91764564-91764586 TTTTCATTACTGAATTTACACGG - Intronic
1111850810 13:93572320-93572342 CCTACATTTCTGATGTGAAAGGG - Intronic
1111867511 13:93787927-93787949 CATTCATTGCAGAAGTGAAATGG + Intronic
1112988010 13:105476292-105476314 CTTTCAGTACTGAAGTTGAGAGG - Intronic
1114139086 14:19891092-19891114 CCTTCATTTATGAAGTTTAGTGG + Intergenic
1115809185 14:37087302-37087324 ACTTCATCACTAAACTTAAAAGG + Intronic
1116207270 14:41884448-41884470 CCTTCCCTACTGAGGTTAAGAGG - Intronic
1116237602 14:42298762-42298784 GCTTCAATACTGAAGTTACCAGG + Intergenic
1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG + Intergenic
1116635714 14:47392223-47392245 AGTTAATTACTGAAGTCAAAGGG + Intronic
1117042736 14:51781596-51781618 CTTTGATTTCTGAAGATAAAAGG + Intergenic
1117992714 14:61450487-61450509 CATTTAATCCTGAAGTTAAAAGG + Intronic
1118199879 14:63662330-63662352 CCTTCCTTACAGAGGTTAATAGG - Intergenic
1120686033 14:87538902-87538924 CCTTCACTACAGAACTTTAAAGG - Intergenic
1122257161 14:100486837-100486859 CCTTCCCTACTGTATTTAAAAGG - Intronic
1124553308 15:30702814-30702836 TCTTCATTACTGTAGTCATATGG + Intronic
1124677936 15:31702854-31702876 TCTTCATTACTGTAGTCATATGG - Intronic
1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG + Exonic
1127147057 15:56035460-56035482 CCTTCCCTACTGAGGTTAATAGG - Intergenic
1127712488 15:61613686-61613708 ACTTCTTAACTGAAGTTAACTGG - Intergenic
1128448756 15:67788434-67788456 GCTTCATTATTGAAGGTAGATGG + Intronic
1129748490 15:78042456-78042478 CCTTCATTCCACATGTTAAAAGG - Intronic
1131425382 15:92341555-92341577 CCTTCCCTACTGAGGTTAACAGG + Intergenic
1131537761 15:93251934-93251956 CCTTCCCTACCGAAGTTAATAGG - Intergenic
1135566077 16:23512085-23512107 CCATCCCTACTGAAGTTAATAGG - Intronic
1138984268 16:62307877-62307899 CCGTCGTGACTGAAGTTAGAGGG + Intergenic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1141045361 16:80711641-80711663 CCTACATTTCTGAAGATGAAAGG - Intronic
1141368541 16:83466246-83466268 TCTTCCTTACTGAGGTTAATAGG - Intronic
1142048717 16:87943565-87943587 CCTTCATTTCTTAAATTAGAAGG + Intergenic
1146430144 17:32785443-32785465 CCTTCCTTTTTGAATTTAAATGG + Intronic
1146471718 17:33130138-33130160 CCTTCTCTACTGAGGTTAATAGG + Intronic
1146977949 17:37131749-37131771 CCTTCCTAGCTGAAGTTAAATGG - Intronic
1147009158 17:37429876-37429898 CCTTCATTTTTGCATTTAAAGGG - Intronic
1155723831 18:29053950-29053972 ACTTCATTAAAGAAGATAAATGG + Intergenic
1156525070 18:37759298-37759320 CCTTTACATCTGAAGTTAAAAGG - Intergenic
1156557817 18:38087313-38087335 TCTTCATTTTTGAGGTTAAATGG - Intergenic
1156776886 18:40801314-40801336 CCTTGATTGCTGAAGTTGAAAGG + Intergenic
1156996855 18:43479173-43479195 CCTTCCATACTGAGGTTAATAGG + Intergenic
1158307639 18:56124552-56124574 CATTCATTAGTTAAGTTCAAAGG + Intergenic
1165388438 19:35525136-35525158 ACTTCATTAAGGAAATTAAAAGG - Intronic
925048627 2:794030-794052 CTTTTGTTACTGGAGTTAAAAGG - Intergenic
925937253 2:8776670-8776692 CCTTTGTTTCTGAAATTAAATGG + Intronic
928397334 2:30953116-30953138 CATTCATGCCTGGAGTTAAAAGG - Intronic
930148858 2:48036951-48036973 CTTTCATTACTTATGTTAGAAGG - Intergenic
931600539 2:63998795-63998817 CCTTAATTAGAGAAATTAAAAGG - Intronic
932599875 2:73116316-73116338 CCTTCTTTATTGACTTTAAATGG - Intronic
932632961 2:73362511-73362533 CCTACATGACTGAGGTTAACTGG + Intergenic
936341291 2:111634642-111634664 CCTTCAATACAAAAGTGAAAGGG + Intergenic
939648613 2:144734136-144734158 CCTTCATCTCTGAATTTTAAAGG + Intergenic
940333264 2:152498909-152498931 CCTTCACTAATTAAGTTGAAGGG - Intronic
941869216 2:170366198-170366220 CCATCCCTACTGAAGTTAATAGG + Intronic
942125410 2:172819831-172819853 CCCTCAGTAAGGAAGTTAAATGG + Intronic
942934276 2:181535299-181535321 CCTTTATGACTGATGTTACAAGG + Intronic
942960774 2:181828079-181828101 CCTTCCCTACTGAGGTTAACAGG - Intergenic
943217825 2:185061357-185061379 CCTTCATTCCCTAATTTAAACGG - Intergenic
945543768 2:211123287-211123309 CCTACATTAAGGCAGTTAAAGGG + Intergenic
945969259 2:216220224-216220246 CCTTCCCTATTGAAGTTAATAGG + Intergenic
1169852023 20:10062799-10062821 TCTTATTTACTGAAGATAAAAGG - Intergenic
1171180778 20:23088950-23088972 CCTTCATTACTGGGGTTCACAGG - Intergenic
1171840422 20:30203530-30203552 ACTTTATGACTGAATTTAAAAGG + Intergenic
1173071923 20:39776427-39776449 CCTTTATAACTGAAGAGAAATGG + Intergenic
1173075338 20:39813212-39813234 CCATCATTACTGAAGCAACATGG + Intergenic
1173450726 20:43161379-43161401 CATTCATTAAAGAAGTTATACGG + Intronic
1175532007 20:59680187-59680209 CCTTCCCTACTGAGGTTAACAGG - Intronic
1177606882 21:23391074-23391096 CTTTTACTACTGAACTTAAATGG - Intergenic
949169125 3:977645-977667 CCTCCAATACTGAATGTAAAAGG - Intergenic
951427769 3:22567889-22567911 CCTTTGTTTCTGAGGTTAAAAGG + Intergenic
953129927 3:40128108-40128130 CCTTCCCTACTGAGGTTAATAGG - Intronic
954176734 3:48850841-48850863 CCATCCCTACTGAAGTTAATGGG - Intergenic
955270854 3:57497343-57497365 CCTTGATTTCTGTAGTTCAATGG - Intronic
955418380 3:58713978-58714000 CCTTCATTCCTGAAGTGTATGGG + Intergenic
956343189 3:68249065-68249087 CCTTCCCTACTGAAGGTAATAGG + Intronic
957119505 3:76071295-76071317 CCATCATTTCTAAAGATAAATGG + Intronic
957198800 3:77105570-77105592 CCTTCATTTGTGAAGATCAAAGG - Intronic
957683777 3:83473685-83473707 CTTTCATTACTGAGATTTAAGGG + Intergenic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
960853418 3:122078804-122078826 CCTTCATTATTACAGTTTAAGGG - Intronic
960887233 3:122408506-122408528 TCTTCATTCTTGCAGTTAAATGG + Intronic
961426932 3:126855764-126855786 CCATCCCTACTGAAGTTAATAGG - Intronic
961975995 3:131026187-131026209 CCTTGATTACTGAATTTTATTGG + Intronic
964200504 3:154113912-154113934 TCTTAATTACTCTAGTTAAACGG + Intergenic
964632108 3:158822357-158822379 CTTTCAGCACTGAAGTTAACTGG - Intronic
965095728 3:164222543-164222565 TCTTCATTTCTGAATTGAAATGG - Intergenic
965823282 3:172706087-172706109 CCTTCACTACTGAGGTTAATGGG + Intronic
967213989 3:187194561-187194583 CATACATGACTGAAGTTAGAGGG + Intergenic
969048167 4:4353510-4353532 CCTTCCCTACTGAGGTTAATAGG - Intronic
969062065 4:4444324-4444346 CCATCCCTACTGAAGTTAACAGG + Intronic
970779201 4:19715258-19715280 CCTTAATTGTTGCAGTTAAATGG - Intergenic
971424168 4:26500188-26500210 CTTACATTAATGAAGTTTAAAGG - Intergenic
971752357 4:30666742-30666764 CCTTCCCTACTGAGGTTAATAGG + Intergenic
972026669 4:34387728-34387750 CCTCCATTAGAGAAGTAAAATGG + Intergenic
972083490 4:35183183-35183205 CCTTCTTAACTGAAATGAAATGG + Intergenic
972292978 4:37707833-37707855 CCATCCCTACTGAAGTTAATAGG + Intergenic
972707582 4:41560332-41560354 CTTTCATTGCTGCAGTGAAAGGG - Intronic
975878799 4:78876687-78876709 CCTTCATTACTACTGTTAAGAGG + Intronic
975883331 4:78937422-78937444 CCATCCTTATTGAAGTTAACAGG + Intronic
976483148 4:85568359-85568381 CCTTAATTTATAAAGTTAAATGG - Intronic
977237000 4:94520006-94520028 CCTTTCGTACTGAAGTTAATGGG + Intronic
977369509 4:96117372-96117394 CCTGTTTTACTGAAGTTTAAGGG + Intergenic
978086165 4:104657774-104657796 CCATCATGGCTGAAGTTGAAGGG - Intergenic
978793249 4:112684321-112684343 CATTCATTACTGTATTTAAATGG + Intergenic
978884810 4:113755392-113755414 ACTCCATTGCTAAAGTTAAAAGG - Intronic
979086900 4:116424471-116424493 CCTGCATTAGGGAAGTTCAAAGG - Intergenic
979684749 4:123499551-123499573 CCTTCATTACTGACCTACAAAGG + Intergenic
984915985 4:184725284-184725306 CCTTTATTACTGCACTTACATGG + Intronic
984990505 4:185376089-185376111 ACTACATTACTGAAGTTGAGGGG + Intronic
987205571 5:15621465-15621487 CTTTCATAACTGAAGGTCAAAGG - Intronic
988090988 5:26541477-26541499 CCTTGATCACTGAAGTTGAAAGG + Intergenic
988961978 5:36379579-36379601 CCTTCAATACTGAACTCACAGGG - Intergenic
989139730 5:38190577-38190599 CCTTCACTGCTGACTTTAAAGGG - Intergenic
989631986 5:43494973-43494995 CTTTCACTACTAAACTTAAATGG + Intronic
990141235 5:52706703-52706725 CCATCCCTACTGAAGTTAATAGG - Intergenic
990963323 5:61417636-61417658 CCATCATTACTGTAGCTAATCGG + Intronic
991549899 5:67824510-67824532 CATTCATTGCAGAAGGTAAAGGG - Intergenic
992185222 5:74237884-74237906 CCTTCATTGCTGATGAGAAATGG + Intergenic
992303341 5:75408050-75408072 CCTTCATTATTGAAGAAACAAGG - Intronic
994375000 5:99009134-99009156 CAATCATGACTGAAGTTGAAGGG + Intergenic
994794844 5:104283154-104283176 CCTACACTACTGAAGACAAAGGG - Intergenic
995101619 5:108315157-108315179 ACTTTATTACTGAAGTAAAAAGG + Intronic
995658409 5:114453038-114453060 GCTTTGTTACTGAAATTAAACGG + Intronic
996293195 5:121879185-121879207 TCTTCAGTACTCAGGTTAAAAGG + Intergenic
996468587 5:123832801-123832823 CCTTTATTCCTGAAATTAAAGGG + Intergenic
997086985 5:130813016-130813038 TCTACATTACTGAAGTCAAGAGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
999379773 5:151112231-151112253 ACTTCTTTACTTAATTTAAATGG - Intronic
1003673257 6:8179706-8179728 CATTCAAAACTGAAGTTAAATGG + Intergenic
1004787522 6:18985611-18985633 CCATGATTATTGAAGATAAAAGG + Intergenic
1006233937 6:32610915-32610937 TCTTCATCACTAAAATTAAAGGG + Intergenic
1008556040 6:52673526-52673548 CCTTCCTTATTGAGGTTAATAGG + Intronic
1008727924 6:54443556-54443578 CCTTCCTTATTGAGGTTAATAGG - Intergenic
1008832066 6:55777051-55777073 ACTCCATTGCTGAAGTAAAAAGG - Intronic
1010208394 6:73343240-73343262 CCATCCTTACTGAAGTTAATAGG + Intergenic
1013180383 6:107712394-107712416 CCTTCAACACTGTAGTTGAAGGG - Intronic
1013309168 6:108877634-108877656 CTTTCAGTACTGAAGTAAAAAGG + Intronic
1013695827 6:112701481-112701503 CCTTCATTCCTGAAGGGAGATGG + Intergenic
1015170932 6:130252221-130252243 CCTTGATTACTGATTTTGAAGGG + Intronic
1016544822 6:145209274-145209296 CCTTCAAGACTGAAGTCAAATGG + Intergenic
1017799855 6:157884876-157884898 CCTTCATCACTGCAGTTTTAAGG - Intronic
1021546152 7:21815186-21815208 CTTTGATTTCTGAAGCTAAAAGG - Intronic
1021984591 7:26086292-26086314 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1022346142 7:29516400-29516422 CCATCCCTACTGAAGTTAATAGG + Intergenic
1022413016 7:30154024-30154046 CCTTCCCTACTGAGGTTAAAGGG - Intronic
1022948538 7:35313457-35313479 CCCTCATGAATGGAGTTAAACGG - Intergenic
1023661850 7:42478362-42478384 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1024494299 7:50026360-50026382 CCTTCAATATTGAATATAAAAGG + Intronic
1024640900 7:51327653-51327675 CCTTCATTGCTTAAGTATAAGGG + Intergenic
1028028429 7:85876524-85876546 ATTTCAATACTGACGTTAAATGG + Intergenic
1028910808 7:96205435-96205457 CCATCATTCATGAAGTTATATGG + Intronic
1030774044 7:113511887-113511909 ACTTCATTAAAGAAGATAAATGG - Intergenic
1033855534 7:145556935-145556957 TCTTCAATACTTGAGTTAAAAGG + Intergenic
1033936535 7:146592738-146592760 CCATCCTTATTGAAGTTAATAGG - Intronic
1034925979 7:155122259-155122281 CATTCCTCACTGAAGTTGAAAGG - Intergenic
1035816236 8:2544104-2544126 CCTACATTTCTGAAGTGCAAAGG - Intergenic
1035917867 8:3644631-3644653 CCCTCTTTACTGAAGGTAATAGG - Intronic
1038132087 8:24743993-24744015 TCTCCATTTCTGAAATTAAATGG + Intergenic
1038278526 8:26141902-26141924 CAATCATTACTGAAGGTGAAGGG - Intergenic
1039133562 8:34294908-34294930 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1040674933 8:49737060-49737082 CCTGCATTAATGATGCTAAAGGG - Intergenic
1040721170 8:50325111-50325133 TCTTGATTACTGTAGTTATATGG + Intronic
1041793567 8:61722829-61722851 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1043372243 8:79608905-79608927 CATTCATAACTGAAGTTAGGTGG + Intergenic
1043883312 8:85569462-85569484 TCTTCATTTCTGTAATTAAATGG - Intergenic
1043946557 8:86260576-86260598 CCATCCCTACTGAAGTTAATAGG - Intronic
1044120480 8:88387889-88387911 GCTTCATTATTTAATTTAAAGGG - Intergenic
1044829527 8:96233566-96233588 CCTTCATTTCTGAAGGTAACAGG - Intronic
1045599489 8:103696414-103696436 TCTGTATTTCTGAAGTTAAATGG + Intronic
1046026370 8:108729129-108729151 CATTCCTTACTGAAGGCAAAGGG + Intronic
1046652086 8:116847147-116847169 TCTTCATTACTGCATTGAAAAGG - Exonic
1046978010 8:120304586-120304608 AAAGCATTACTGAAGTTAAATGG - Intronic
1048395600 8:134011260-134011282 CATTCATTTGTGCAGTTAAAGGG + Intergenic
1048834554 8:138505912-138505934 GATTCATTACTGAAGAAAAAAGG + Intergenic
1049679129 8:143909141-143909163 TCTTCATTTCAGAAGTTCAAGGG + Intergenic
1050313713 9:4379297-4379319 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1050661367 9:7886533-7886555 GCTTCATTAATGAAGCTCAAAGG + Intronic
1051545953 9:18275194-18275216 CCTCTAATAATGAAGTTAAAAGG + Intergenic
1052456356 9:28704171-28704193 CCTTCAAAAGTGAAGATAAAAGG - Intergenic
1055081360 9:72270323-72270345 CATTCAGTACAAAAGTTAAATGG - Intergenic
1055358392 9:75461951-75461973 CCTTCATCATTGAAGTCAAGAGG - Intergenic
1055408106 9:75996350-75996372 CCTTCTTTAATGAAGTTTAAGGG + Intronic
1056210196 9:84358137-84358159 CCTTCCCTACTGAAGCTAATCGG - Intergenic
1056339322 9:85609601-85609623 CATTCACTACTAAAGTAAAATGG + Intronic
1056370617 9:85950538-85950560 CCCTGATTACTGAAGTTCTAAGG + Intronic
1059225425 9:112668427-112668449 CCTTGATGTCTGAATTTAAATGG - Intronic
1059852256 9:118355761-118355783 TCTCCATTACAGAAGATAAAAGG + Intergenic
1060136728 9:121163710-121163732 ATTTCATTACAGAAGATAAATGG + Intronic
1060871394 9:127044140-127044162 CCTTCATTAGGTAAGGTAAATGG + Intronic
1186682216 X:11887120-11887142 CATTTAACACTGAAGTTAAAAGG - Intergenic
1187697639 X:21937804-21937826 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1188861321 X:35259984-35260006 CCTTCAAGACTCTAGTTAAATGG - Intergenic
1189049369 X:37628379-37628401 CCTACATTAATGAAGTATAAAGG + Intronic
1189167310 X:38872933-38872955 TCTTCATTATAGAAGTAAAAAGG + Intergenic
1193470064 X:81889824-81889846 CATTCATGACAGAAGTTGAAGGG - Intergenic
1194464731 X:94219463-94219485 CCATCCCTACTGAAGTTAATAGG - Intergenic
1194675050 X:96784431-96784453 CCTAAAGTACTGAAGCTAAAGGG - Intronic
1195018657 X:100803386-100803408 TCTTCATTACTGCATTGAAAAGG + Intergenic
1195934055 X:110108270-110108292 CCTTCATTATTAAAGGCAAATGG - Intronic
1195991204 X:110684047-110684069 CCTTCCCTACTGAGGTTAATAGG + Intronic
1197044659 X:121980186-121980208 CCTTCATTTCTGAAGTTTCTGGG - Intergenic
1197636908 X:128925693-128925715 ACTTCACGACAGAAGTTAAAGGG + Intergenic
1199238208 X:145515121-145515143 CCTTAATTTCTGAAGTTTACAGG - Intergenic
1199355344 X:146856630-146856652 GCTTAATAACTGAAGGTAAAGGG - Intergenic
1200423219 Y:2994967-2994989 CTTTCATTATTAAACTTAAATGG + Intergenic