ID: 1125903598

View in Genome Browser
Species Human (GRCh38)
Location 15:43370847-43370869
Sequence GACCCGGCTAAGGCGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125903583_1125903598 28 Left 1125903583 15:43370796-43370818 CCCTCCGGCCGGGTAACCCGGAG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903589_1125903598 11 Left 1125903589 15:43370813-43370835 CCGGAGCCGTCGTGCGGTCCCTC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903588_1125903598 12 Left 1125903588 15:43370812-43370834 CCCGGAGCCGTCGTGCGGTCCCT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903594_1125903598 -8 Left 1125903594 15:43370832-43370854 CCTCCAGAGGCCTCTGACCCGGC 0: 1
1: 0
2: 0
3: 18
4: 216
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903585_1125903598 24 Left 1125903585 15:43370800-43370822 CCGGCCGGGTAACCCGGAGCCGT 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903586_1125903598 20 Left 1125903586 15:43370804-43370826 CCGGGTAACCCGGAGCCGTCGTG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903584_1125903598 27 Left 1125903584 15:43370797-43370819 CCTCCGGCCGGGTAACCCGGAGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903592_1125903598 -7 Left 1125903592 15:43370831-43370853 CCCTCCAGAGGCCTCTGACCCGG 0: 1
1: 0
2: 4
3: 23
4: 191
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1125903590_1125903598 5 Left 1125903590 15:43370819-43370841 CCGTCGTGCGGTCCCTCCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 61
Right 1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125903598 Original CRISPR GACCCGGCTAAGGCGCCCTG AGG Intronic
900163067 1:1233473-1233495 GGCCCGGCTCAGGCTCGCTGAGG - Exonic
900291695 1:1926423-1926445 CACCCAGCTCAGGCGGCCTGCGG - Intronic
902186864 1:14731974-14731996 GGTGCGGCTAAGCCGCCCTGGGG + Intronic
904769027 1:32870787-32870809 GACGCGGCTCCGGCGCCCGGCGG + Exonic
904916443 1:33973743-33973765 GTCCCTGCTCAGGCACCCTGGGG - Intronic
915272148 1:154760871-154760893 GGCCCCGCAAAGGCGCCCCGCGG + Intronic
1062840625 10:667323-667345 GACCTGGCTGAGGCCTCCTGGGG + Intronic
1067225642 10:44374194-44374216 GGCCCAGCTAAGGCTGCCTGAGG - Intronic
1069703275 10:70441417-70441439 GACGCGGCGGAGGCGCCCCGGGG + Intronic
1073177340 10:101564616-101564638 GACCCCTCTCAGGCTCCCTGGGG + Intergenic
1074815338 10:117137896-117137918 GACGCTGAGAAGGCGCCCTGCGG + Exonic
1076648421 10:131970434-131970456 GCCCCAGCACAGGCGCCCTGTGG - Intronic
1085256252 11:75175254-75175276 GACCCGGCCAAGGCAGCCTCAGG - Intronic
1091718622 12:2796216-2796238 GACCAGGTAAAGGCCCCCTGAGG - Intronic
1096152892 12:49325681-49325703 GACCAGGCTAGGGGGCACTGAGG + Intronic
1096864868 12:54556571-54556593 GACCTGGCAAAGGTGCACTGAGG + Intronic
1113055193 13:106260079-106260101 GACGTGGGGAAGGCGCCCTGCGG + Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG + Intronic
1131368613 15:91861164-91861186 GACCCGGCTTTGGGGCTCTGAGG - Intronic
1134088157 16:11372762-11372784 GACCAGGCTATGGGCCCCTGAGG + Intronic
1136608903 16:31354585-31354607 AACCCGGGTGAGGCACCCTGTGG + Intergenic
1142811324 17:2396883-2396905 GAGTCGGCTAAGGCCCCCTGGGG + Intronic
1149498915 17:57136540-57136562 GTCCCGGCCAGGGCGGCCTGAGG + Intergenic
1152521631 17:80859922-80859944 GACCCGGCGCAGGGGCCCAGTGG - Intronic
1163701484 19:18788823-18788845 CACCCGGGTAAGGCCCGCTGGGG - Exonic
1165100345 19:33435266-33435288 GTCCCAGCTGAGGCTCCCTGTGG - Intronic
1165329107 19:35131584-35131606 GACCCGGCTTCCACGCCCTGGGG + Intronic
928093505 2:28390744-28390766 GACTTGGCTAGGGCGGCCTGAGG + Intergenic
946175510 2:217919831-217919853 GTCCCGGGTCAGGCACCCTGGGG - Intronic
946865540 2:224038896-224038918 GCCCCGGCCAAGGCGGCCCGCGG + Intronic
947541723 2:230984613-230984635 GACTTGGCAATGGCGCCCTGTGG + Intergenic
1171413179 20:24960103-24960125 CAACCGGCCAAGGCGCCCAGTGG - Intergenic
1172645317 20:36465517-36465539 GACCCAGGGAAGGCGGCCTGAGG - Intronic
1175308470 20:57994382-57994404 GTCCCAGCTAGGGTGCCCTGAGG + Intergenic
1176250999 20:64119895-64119917 GAACCGGGTAAAGAGCCCTGTGG + Intergenic
1176414860 21:6468274-6468296 GACCTGGCGAAGGAGCCCCGCGG - Intergenic
1179690360 21:43076596-43076618 GACCTGGCGAAGGAGCCCCGCGG - Intronic
1181030823 22:20148245-20148267 GACCCTCCTAAGACGCCTTGGGG + Intergenic
1182348142 22:29681370-29681392 GACACGGCTCAGGTGCTCTGCGG - Intronic
1183323876 22:37180965-37180987 GACCTGGCCAAGGCCCCCTGGGG + Exonic
1185397668 22:50600995-50601017 GACCCGGCCCCGGCCCCCTGCGG + Intronic
1001129523 5:169052457-169052479 GACCCAGCTAATTGGCCCTGGGG - Intronic
1001221208 5:169902592-169902614 CACCCCGCTGAGGCTCCCTGGGG + Intronic
1005813260 6:29531791-29531813 GCCCAGGCTAAGCAGCCCTGGGG + Intergenic
1006472750 6:34237567-34237589 GACCCGGGAAAGGCGCGCGGTGG + Intronic
1013457551 6:110344368-110344390 GTCACAGCTAAGGGGCCCTGAGG + Intronic
1020281501 7:6652489-6652511 GACCCGACCCAGGCGGCCTGGGG + Exonic
1028987705 7:97021247-97021269 GAGCCGGCCAGGGCGCCCTCTGG - Intronic
1035751964 8:2002516-2002538 GCCACGGCGAAGGCGCCCCGGGG - Exonic
1036784824 8:11679394-11679416 GACCCGGCTGGGGCGTCCCGCGG - Intronic
1042249536 8:66741942-66741964 GCCCTTGCTAAGGGGCCCTGGGG - Intronic
1044712764 8:95073203-95073225 GACCCGCCTAAAGCGCCGTTGGG - Intronic
1049097726 8:140558725-140558747 GACCCGGCTGGGGTGGCCTGGGG - Intronic
1049587059 8:143437128-143437150 GACCAGGCCAAGGGGCCCCGCGG + Intergenic
1049762652 8:144338094-144338116 GCCCCGGGGAAGGCGGCCTGCGG + Intergenic
1049988431 9:972177-972199 GGCCAGGCCGAGGCGCCCTGCGG - Intergenic
1052817318 9:33111752-33111774 GACCTGGCAAAGGCGCTCAGTGG + Exonic
1053140933 9:35682287-35682309 GTCCCTGCCAAGGGGCCCTGAGG - Intronic
1060821596 9:126664440-126664462 AACCAGGCCAAGGGGCCCTGTGG + Intronic
1060932058 9:127495438-127495460 GTCCCGGCCAGGGAGCCCTGGGG + Intronic
1062228087 9:135465217-135465239 GACCCGGCAATGGAGCCCTCGGG - Intergenic
1062429179 9:136519404-136519426 GCCCCGGCTACCCCGCCCTGCGG + Intronic