ID: 1125909142

View in Genome Browser
Species Human (GRCh38)
Location 15:43420811-43420833
Sequence CTGAGGAGACCCATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125909142_1125909152 26 Left 1125909142 15:43420811-43420833 CCTTTGTCCATGGGTCTCCTCAG 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1125909152 15:43420860-43420882 GCATGAGCCTGGTCTCTCTGTGG 0: 1
1: 0
2: 3
3: 17
4: 189
1125909142_1125909147 4 Left 1125909142 15:43420811-43420833 CCTTTGTCCATGGGTCTCCTCAG 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1125909147 15:43420838-43420860 TTCTTTAAAAACCCCATCACAGG 0: 1
1: 0
2: 2
3: 31
4: 233
1125909142_1125909149 15 Left 1125909142 15:43420811-43420833 CCTTTGTCCATGGGTCTCCTCAG 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1125909149 15:43420849-43420871 CCCCATCACAGGCATGAGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125909142 Original CRISPR CTGAGGAGACCCATGGACAA AGG (reversed) Intronic
900481544 1:2901928-2901950 CTGAGGAGACCCATGTGGGACGG + Intergenic
900496614 1:2978703-2978725 CTGAGGACACCTAGGGGCAAGGG + Intergenic
901901726 1:12369780-12369802 CTTAGGAGACCAAAGTACAAAGG + Intronic
902730523 1:18365776-18365798 CTGAGGACAGCCATGGAAAGGGG + Intronic
902972356 1:20062976-20062998 CTGAGAAGATCCATGGACGTGGG + Intronic
904351090 1:29907187-29907209 ATGATGAGACTCATGGACAAAGG - Intergenic
904371030 1:30047507-30047529 CTGGGGAGACCCCTGGGGAAAGG + Intergenic
906195156 1:43925703-43925725 ATGTGGAGACACATGGACCAAGG + Intronic
913321130 1:117589260-117589282 CTAAGGAGTCACATGGACTAGGG + Intergenic
915544178 1:156586509-156586531 CAGAGGAGACCCATGGAGTCGGG + Exonic
915880385 1:159664899-159664921 CTGAGGACAGTCAGGGACAAAGG - Intergenic
917638482 1:176959558-176959580 CAGAGCAGACCCATTGACTAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
1062798784 10:364030-364052 TTGGAGAGACCCAAGGACAATGG - Intronic
1062943347 10:1440200-1440222 CTCAGGAGACCCATAGTGAAGGG - Intronic
1063165910 10:3462175-3462197 CCCAAGAGACCCATGGACAATGG + Intergenic
1063165942 10:3462378-3462400 CCCAAGAGACCCATGAACAATGG + Intergenic
1063165965 10:3462562-3462584 CCCAAGAGACCCATGAACAATGG + Intergenic
1063368409 10:5505323-5505345 CTGAGAAGACCCATGGGAGAGGG - Intergenic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1070653834 10:78257102-78257124 CTGAGGAGACAAGTGGAGAAAGG + Intergenic
1071947220 10:90658849-90658871 CTGAGGACAGCCAAAGACAAAGG + Intergenic
1072426414 10:95334429-95334451 CTGTGCACACCCATGGAGAAGGG + Intronic
1072534976 10:96355568-96355590 CTGAGGGGTCCCATTCACAAGGG + Intronic
1073460072 10:103661177-103661199 CCGAGGAGGCCGATGGACAGGGG - Intronic
1074826551 10:117219093-117219115 CTGTGGACACCTCTGGACAAGGG - Intergenic
1075231453 10:120683068-120683090 CTAAGGAGACACGAGGACAAAGG - Intergenic
1075282684 10:121154037-121154059 CTGAGGAGGCCCATTGGTAAGGG - Intergenic
1075765272 10:124887930-124887952 TTGAGGAGAACCTTGGAGAAGGG - Intergenic
1076566894 10:131405052-131405074 CTGAGGAGACCCCCGGATTATGG + Intergenic
1077311211 11:1889838-1889860 CTGAGGAGCCCCCTGTACCACGG - Exonic
1078452860 11:11453211-11453233 CTGAGGAGACCCCTGGGCCAGGG + Intronic
1080295685 11:30724395-30724417 CTCAGGAGGCCCATGGTTAATGG - Intergenic
1084657471 11:70527803-70527825 CAGAGGACACCCAGGGACAATGG + Intronic
1085397660 11:76215066-76215088 CTGAGAAGACACATGAACAGGGG + Intergenic
1085457979 11:76676190-76676212 GTGAGGGCAGCCATGGACAATGG + Intergenic
1085935308 11:81134631-81134653 CTTAGGAGACCCGTGAACACAGG + Intergenic
1087405099 11:97721047-97721069 TTGAGGAGACCTTTGGAAAATGG + Intergenic
1087411285 11:97792941-97792963 CTGAGGAGAGGCAGGGACAAAGG - Intergenic
1089184380 11:116605024-116605046 CTGAGGAGACCCCAGGAGAGAGG - Intergenic
1090877289 11:130801988-130802010 TGGAGGAGTCCCATGGATAAAGG + Intergenic
1091700383 12:2655063-2655085 CTGAAGAGACCATTGAACAATGG + Intronic
1094474810 12:30833004-30833026 CTGAGGACAGACCTGGACAAGGG - Intergenic
1095981221 12:47975823-47975845 CTGAGGAGACCTCAGGATAAAGG + Intronic
1097336605 12:58390675-58390697 CTGAGGAGAAACATGGAAGAGGG - Intergenic
1097597502 12:61652612-61652634 CAGAGCAGGCCCAGGGACAATGG + Intergenic
1097998624 12:65917238-65917260 CTGAGGAGTCCCAGGGCCTAAGG + Intronic
1098759963 12:74410989-74411011 CTGAAAATATCCATGGACAATGG - Intergenic
1101092336 12:101300455-101300477 CAGAGGAAACACATGGGCAAAGG - Intronic
1103186922 12:118966226-118966248 CTGAGAACACACATGGACACAGG - Intergenic
1104991938 12:132629989-132630011 CTGGGGAGGCCCAAGGAGAAAGG + Intronic
1108528718 13:51308644-51308666 CTTAGGAGATCCATGGGCAGAGG - Intergenic
1113250653 13:108448988-108449010 CTGAGGAGATCCAGGGGCAATGG - Intergenic
1113577346 13:111403802-111403824 CTGAGCAGCCCCTTGGACAAGGG + Intergenic
1114325896 14:21588351-21588373 CTGAGGACAGCCAGCGACAAAGG + Intergenic
1114969450 14:28006967-28006989 ATGAGGTGACAGATGGACAAAGG - Intergenic
1119739452 14:77004816-77004838 CTGAGCAGACACCTGGACTATGG - Intergenic
1121015050 14:90544037-90544059 CCAAGGAGACCCATGGCCGAGGG + Intronic
1121078001 14:91085299-91085321 CTGAGGACCCACATGGGCAAAGG - Intronic
1121639130 14:95473543-95473565 CAGAGGCAACACATGGACAAAGG + Intronic
1121866870 14:97370632-97370654 CTGGGGAACCCCATGGAAAATGG - Intergenic
1122644870 14:103187776-103187798 TTGTGGAGACCCCTGGAGAAGGG + Intergenic
1122783099 14:104151992-104152014 CTGAGGACAGCAAGGGACAAAGG - Intronic
1202828940 14_GL000009v2_random:5046-5068 CTGAGGAAAGCCATGGAAAACGG - Intergenic
1202900679 14_GL000194v1_random:34884-34906 CTGAGGGAAGCCATGGAAAATGG - Intergenic
1124389667 15:29242792-29242814 CTGGGGAGCCCCTTGGACGAGGG + Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125909142 15:43420811-43420833 CTGAGGAGACCCATGGACAAAGG - Intronic
1126400402 15:48262941-48262963 GTGAGGAAACTCATTGACAAAGG - Intronic
1129659477 15:77544966-77544988 CAGAGGAGAGCCAGGGTCAAGGG - Intergenic
1131108459 15:89750138-89750160 CTGAGGAGCCCAAGTGACAAGGG - Exonic
1131691789 15:94835274-94835296 GTTAGAAGACCCATGGAAAAGGG + Intergenic
1134051220 16:11138895-11138917 CTGAGGAAACCCTTGCGCAAGGG - Intronic
1138497343 16:57416448-57416470 CTGGGGAGCCCCCTGGCCAAGGG + Intergenic
1138974245 16:62184436-62184458 CTGAGGAAACCTAGTGACAAAGG - Intergenic
1139818137 16:69693928-69693950 CTGAGGAGAGCTATGGAACAAGG - Exonic
1141729592 16:85812735-85812757 CTGTGCAGACCCATCCACAAAGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1148966506 17:51440433-51440455 CTGAAGAAACCCATGGAGAGAGG + Intergenic
1149567177 17:57648661-57648683 CTGTGGGCACCCATGGACCAAGG + Intronic
1150531498 17:65987958-65987980 CTGAGGATAGCCAGAGACAAAGG + Intronic
1150650190 17:67005176-67005198 CAGAGGAGACCCATGGACTAAGG - Intronic
1152291285 17:79441515-79441537 CTGAGGAATCCCAGGGACAGCGG + Intronic
1152333314 17:79685933-79685955 CTGTGAAGAGCCATGGACAGTGG - Intergenic
1153442665 18:5137858-5137880 GGGAGGAGACCCTTGGTCAATGG + Intergenic
1157323147 18:46649351-46649373 CTGGGGAGGCCCAAGCACAAAGG + Intronic
1158592345 18:58788459-58788481 CGGAGGAGGCCCAAGGACACAGG - Intergenic
1160207367 18:76845966-76845988 CTGCAGAGACCCCTGCACAATGG + Intronic
1160572820 18:79830559-79830581 CTGGAGGGACCCATGGCCAAAGG - Intergenic
1161501591 19:4619083-4619105 CTGAGGAGACGCAGAGACAGAGG - Intergenic
1161501649 19:4619523-4619545 CTGAGGAGACGCAGAGACAGAGG - Intergenic
1162080650 19:8215761-8215783 CAGAGGAGTGCCAGGGACAAGGG - Intronic
1163635663 19:18436164-18436186 CTGCGGAGACCCATTGAGGAAGG + Exonic
1163794308 19:19327761-19327783 CTGAGCAGACCCAGGGAACAAGG - Intronic
1165135142 19:33663151-33663173 CTGAAGTGACCCCTGGACAAAGG + Intronic
1166623136 19:44322957-44322979 CTGAGGACAGCCAGAGACAAAGG - Intergenic
1167434732 19:49472905-49472927 CTCATGTGGCCCATGGACAAAGG - Intronic
1167538786 19:50072351-50072373 CTGAGGGGTCCTGTGGACAAGGG + Intergenic
1167832840 19:52040518-52040540 AGGAGAAGAACCATGGACAATGG - Exonic
1167885854 19:52499405-52499427 CTGAGGAGACTACTGGACACAGG - Intronic
1167920710 19:52781010-52781032 CTGAGGAGACAACTGGACACAGG + Intronic
1167922580 19:52794075-52794097 CTGAGGAGACAACTGGACACAGG + Intronic
1167970202 19:53184509-53184531 TTGAGGAGACAACTGGACAAAGG + Intronic
1202643756 1_KI270706v1_random:122754-122776 CTGAGGGAAGCCATGGAAAATGG + Intergenic
927408696 2:22800777-22800799 CTGAGGAGACCCTCCAACAAAGG + Intergenic
927709564 2:25316136-25316158 CGGGGGAGACCCAGGCACAAAGG + Intronic
928930054 2:36615226-36615248 CAGAGGAGCCCCAGGGACTATGG + Intronic
931573054 2:63690094-63690116 CTAAGTGGACCCATGCACAAAGG + Intronic
933936199 2:87205675-87205697 TTGAGGAGCCCCAGGGACAATGG - Intergenic
934575895 2:95401476-95401498 CTGAGGAGAACCTGGCACAAGGG - Intergenic
935401972 2:102669693-102669715 CTGATGATTCCTATGGACAACGG + Intronic
936074074 2:109390666-109390688 CTGGCGAGACCCATGGACTCTGG + Intronic
936356950 2:111760154-111760176 TTGAGGAGCCCCAGGGACAATGG + Intergenic
940026939 2:149218424-149218446 ATGAGGACACGCATGGACATGGG + Intergenic
940689408 2:156896624-156896646 TAGAGGAGATCCATGGACCAGGG - Intergenic
942710492 2:178829493-178829515 CTGTGGAGATTCATGGAAAAAGG + Intronic
946866173 2:224043058-224043080 CCGAAGAGACCCATGGAAAAAGG - Intergenic
947040781 2:225917061-225917083 CTGAGGACAGCCAGAGACAAAGG - Intergenic
947133113 2:226950183-226950205 CTGGGGAGACCCTGGGTCAAAGG - Intronic
948326604 2:237126797-237126819 CTGAGAAGACACACAGACAAGGG - Intergenic
948903031 2:240965676-240965698 CAGGGGAGGCCCATGGACAGCGG + Intronic
1172274316 20:33671502-33671524 TTGAAGAGACCCAAGGAGAAGGG + Intronic
1174931413 20:54819343-54819365 CTGAGAAGTCCCATGGTCTATGG - Intergenic
1175302496 20:57952833-57952855 CTTAGGAAACGCATGGCCAAGGG + Intergenic
1175843302 20:62044936-62044958 AGGAGGAGACCCATGGGCACAGG + Intronic
1175874857 20:62224508-62224530 CTGAGGAGACACACGAGCAAAGG + Intergenic
1176043691 20:63081544-63081566 ATGTGGACACACATGGACAAGGG + Intergenic
1176608123 21:8849874-8849896 CTGAGGAAAGCCATGGAAAACGG - Intergenic
1176620054 21:9049662-9049684 CTGAGGGAAGCCATGGAAAATGG - Intergenic
1179997397 21:44980327-44980349 CTGAGGACAGCCAGGGACAAAGG - Intergenic
1180141142 21:45893909-45893931 CTGAGCTGCCCCATGGACACTGG + Intronic
1180358214 22:11859679-11859701 CTGAGGGAAGCCATGGAAAACGG - Intergenic
1180380052 22:12132651-12132673 CTGAGGGAAGCCATGGAAAACGG + Intergenic
1180956753 22:19744712-19744734 CTGGTGAGAACCATGCACAAGGG + Intergenic
1182866085 22:33605986-33606008 CTGAGGAGAGCAACAGACAAAGG + Intronic
1183249794 22:36722351-36722373 CTGGAAAGACCCATGGACAGAGG - Intergenic
1183687447 22:39369350-39369372 CTCAGGAGCCCCTTTGACAATGG + Intronic
1184004068 22:41696221-41696243 CTGAAGAGATCCAGGTACAAGGG + Exonic
1184101021 22:42341844-42341866 CTGGGGGCACCCATGGAAAAAGG + Intronic
949859693 3:8494092-8494114 ATGAGGAGACCCTGGCACAAGGG + Intergenic
962735843 3:138324453-138324475 ATGAGGAGGCCCATAGACAGTGG + Intronic
966903187 3:184502118-184502140 CTCAGGAGAAAAATGGACAAAGG + Intronic
967782217 3:193452057-193452079 CTGTGGAGACACATGAGCAATGG - Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
974706006 4:65516520-65516542 CAGAGTTGACCCTTGGACAAGGG - Intronic
974965847 4:68759991-68760013 CAGAGGTGACCTATGCACAAAGG + Intergenic
976231835 4:82852353-82852375 ATGAGGTGACCCATAGACAGAGG + Intronic
976833900 4:89348274-89348296 CTGAGGACAGCCAGAGACAAAGG - Intergenic
978888201 4:113791131-113791153 CTGAGGATAGCCAGAGACAAAGG + Intergenic
979339313 4:119501989-119502011 CTGAGGAGAACTTTGAACAAAGG + Intronic
980247900 4:130271134-130271156 CTGAGGATACCCAGAGACAATGG - Intergenic
980980092 4:139647470-139647492 TGGAGGTGACCCATGGACAAGGG - Intergenic
982573765 4:157082065-157082087 TGGATGAGACCCATGGACACAGG - Intronic
983503593 4:168528022-168528044 ATGAGGAAACCCAGGGATAAGGG - Intronic
985100574 4:186454242-186454264 CTGAAGAGACCCACAGAGAAAGG + Intronic
1202771125 4_GL000008v2_random:208686-208708 CTGAGGAAAGCCATGGAAAACGG + Intergenic
986329941 5:6710622-6710644 CTGAGAAGAGACATGGACACAGG + Intergenic
986720807 5:10560268-10560290 CTGAGGAAATACCTGGACAAGGG + Intergenic
987034577 5:14006934-14006956 CTGAGAAGACCCAAGGCCACTGG - Intergenic
987188577 5:15450507-15450529 CTGAGGATACCCATAGAAGATGG + Intergenic
988877790 5:35467622-35467644 CTGAGGAAACTCATTAACAAGGG - Intergenic
990162890 5:52962825-52962847 CTGAGAAGTCCCATGGTCTACGG + Intergenic
992052568 5:72955322-72955344 CTGAAGAGAACTATGGACTATGG + Intergenic
992969187 5:82038261-82038283 CTGAGGAGACTCATGAAATAAGG + Intronic
993643539 5:90435202-90435224 CAGAGGAGAACCATGGAAAGCGG - Intergenic
997784599 5:136698042-136698064 CTGAGGAGAGCCATGAAGAGAGG - Intergenic
998850504 5:146346221-146346243 CTGAGGAGTCCCCTGGACCGCGG + Intergenic
999969749 5:156847510-156847532 CTGAGGACAGCCATAGATAAAGG + Intergenic
1001489344 5:172144710-172144732 CTGAGTTCACCCATGGGCAAGGG + Intronic
1002082149 5:176743527-176743549 CTGAGAAGCGCCAAGGACAAAGG - Intergenic
1002311899 5:178319990-178320012 CAGAGGAGAGCCCTGGACAGAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1004334134 6:14748725-14748747 CTGAGGAAAACCAAGCACAAAGG + Intergenic
1006129705 6:31861998-31862020 CTGCGGAGGTCCATGGACCAGGG - Exonic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1007254246 6:40517502-40517524 CTGATGTGGCCCCTGGACAAAGG + Intronic
1008314122 6:50018217-50018239 CTGAGGAGATCCATGACAAAAGG - Intronic
1008389675 6:50935474-50935496 CTGTGCAGAGCCATGTACAAAGG - Intergenic
1008539913 6:52537640-52537662 CTGATGAGAACTATGAACAAGGG - Intronic
1008634049 6:53391732-53391754 CTGAGGAAACCAGGGGACAAGGG + Intergenic
1010074555 6:71785281-71785303 CTGAGGACAGCCAGAGACAAAGG + Intergenic
1013045079 6:106477679-106477701 AAAAGGAGACCCATGGACAACGG + Intergenic
1014188126 6:118458751-118458773 CTGGGGAGACCCATGGAACAAGG + Intergenic
1014234666 6:118940602-118940624 CTGAGGAGACCTTTGGCCATAGG + Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014837130 6:126172263-126172285 CTGAGGTGTCACATCGACAAAGG + Intergenic
1015181120 6:130364257-130364279 CTGATGAGAGCCATGAAAAAAGG - Intronic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018329730 6:162714351-162714373 CTGAGGAGATGCAGGGACACTGG + Intronic
1021309048 7:19070175-19070197 TTGAGGAGAGCTGTGGACAAGGG - Intronic
1023092780 7:36632291-36632313 CTGAGGAGCCCGATGGGCAAAGG - Intronic
1023366566 7:39470358-39470380 TTGAGGAAAGCCATGGTCAAGGG + Intronic
1024708249 7:51985477-51985499 CTGAGGAGCAACATGGACATGGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1030465377 7:109895208-109895230 CTGAGCAGAGCTATGGACTAAGG - Intergenic
1031120408 7:117715430-117715452 CTGAGGGGAAGCCTGGACAATGG - Intronic
1032680683 7:134179805-134179827 TTGTGGAAACTCATGGACAAAGG + Intronic
1033347925 7:140540008-140540030 ACGAGGAGACCCAGGGCCAACGG + Intronic
1033470322 7:141641315-141641337 CAGAGGAGACCCCTGTACAAAGG + Exonic
1037282787 8:17261914-17261936 CTGAGGACAGCCAGAGACAAAGG - Intronic
1038073595 8:24045925-24045947 CTGACATGACCCATGGAGAAGGG + Intergenic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1042809187 8:72805321-72805343 CTGATTAGAACCATGGCCAAAGG - Intronic
1043946834 8:86263078-86263100 ATGAGGTGACTCTTGGACAATGG + Intronic
1048921520 8:139235557-139235579 CTGGGGAAGCCCATGGAGAAAGG + Intergenic
1050268075 9:3912150-3912172 ATGAGGTGACCTAAGGACAATGG + Intronic
1051180432 9:14406149-14406171 CTATGAAGACCAATGGACAAGGG + Intergenic
1052072463 9:24098848-24098870 TTGAGGAGCTCCATGGAAAAAGG - Intergenic
1052159475 9:25238827-25238849 CTGAGGGGAGACATGGGCAAAGG - Intergenic
1053010690 9:34631132-34631154 CAGAGGAGGTCCATGGACAAAGG + Intergenic
1054354912 9:64050991-64051013 CTGAGGGAAGCCATGGAAAATGG - Intergenic
1056463210 9:86828146-86828168 CCTAGCAGACCCATGGACAAAGG + Intergenic
1056498727 9:87187193-87187215 CTGAGGAGTCACATGATCAATGG - Intergenic
1058185544 9:101850030-101850052 CTGTGGAGGACCATGGATAAAGG + Intergenic
1059987099 9:119831002-119831024 ATTAGAAGAGCCATGGACAATGG + Intergenic
1061542848 9:131287598-131287620 CTGAGGCCACCCAGGGAGAATGG + Intergenic
1061944502 9:133901283-133901305 CTGAGGAGACCCGTGGGGAGTGG - Intronic
1203743251 Un_GL000218v1:20120-20142 CTGAGGGAAGCCATGGAAAATGG - Intergenic
1203703472 Un_KI270742v1:14781-14803 CTGAGGGAAGCCATGGAAAACGG - Intergenic
1203566851 Un_KI270744v1:99395-99417 CTGAGGGAAGCCATGGAAAATGG + Intergenic
1192923995 X:75736519-75736541 CTGAGGACAGCCAGGCACAAAGG - Intergenic
1192947488 X:75981961-75981983 CTGAGGACAGCCAGGCACAAGGG - Intergenic
1193623418 X:83786208-83786230 CTGAGGACAGCCAGAGACAAAGG + Intergenic
1197972573 X:132130536-132130558 CAGAGGAGACCCCTGTACGAAGG - Intergenic
1199459575 X:148069667-148069689 CTGAAGAGAGCCAAAGACAAAGG - Intergenic
1199791681 X:151161121-151161143 CTGAGAAGTCCCATGGAGATTGG - Intergenic
1201156781 Y:11137588-11137610 CTGAGGGAAGCCATGGAAAACGG - Intergenic