ID: 1125911378

View in Genome Browser
Species Human (GRCh38)
Location 15:43442747-43442769
Sequence CTCAGGTTCCCAAAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 2, 2: 17, 3: 80, 4: 730}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125911370_1125911378 19 Left 1125911370 15:43442705-43442727 CCAGGCTGGTCTCAAACTTCCGA 0: 40
1: 2969
2: 53741
3: 130480
4: 185823
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730
1125911372_1125911378 0 Left 1125911372 15:43442724-43442746 CCGACCTCAGGTGATTCACCCGC 0: 61
1: 2148
2: 7810
3: 11355
4: 11885
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730
1125911373_1125911378 -4 Left 1125911373 15:43442728-43442750 CCTCAGGTGATTCACCCGCCTCA 0: 148
1: 5373
2: 26325
3: 59433
4: 87773
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730
1125911369_1125911378 28 Left 1125911369 15:43442696-43442718 CCATGTTGACCAGGCTGGTCTCA 0: 1802
1: 47757
2: 119762
3: 180782
4: 177059
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125911378 Original CRISPR CTCAGGTTCCCAAAGTGTGC TGG Intronic