ID: 1125911378

View in Genome Browser
Species Human (GRCh38)
Location 15:43442747-43442769
Sequence CTCAGGTTCCCAAAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 2, 2: 17, 3: 80, 4: 730}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125911372_1125911378 0 Left 1125911372 15:43442724-43442746 CCGACCTCAGGTGATTCACCCGC 0: 61
1: 2148
2: 7810
3: 11355
4: 11885
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730
1125911373_1125911378 -4 Left 1125911373 15:43442728-43442750 CCTCAGGTGATTCACCCGCCTCA 0: 148
1: 5373
2: 26325
3: 59433
4: 87773
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730
1125911369_1125911378 28 Left 1125911369 15:43442696-43442718 CCATGTTGACCAGGCTGGTCTCA 0: 1802
1: 47757
2: 119762
3: 180782
4: 177059
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730
1125911370_1125911378 19 Left 1125911370 15:43442705-43442727 CCAGGCTGGTCTCAAACTTCCGA 0: 40
1: 2969
2: 53741
3: 130480
4: 185823
Right 1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG 0: 1
1: 2
2: 17
3: 80
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125911378 Original CRISPR CTCAGGTTCCCAAAGTGTGC TGG Intronic
900469089 1:2843100-2843122 CTCTGGTTCCCACAGGGTGATGG + Intergenic
900511268 1:3062214-3062236 CCCAGGGACCCAAAGTGTGGGGG + Intergenic
900728173 1:4232415-4232437 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
901316067 1:8309594-8309616 CTCAGCCTCCCAAAGTGCTCGGG + Intergenic
901389577 1:8935324-8935346 CTCGGCCTCCCAAAGTGTGCTGG + Intergenic
901482025 1:9531773-9531795 CTCAGCTTCCCAAAGTGTGCTGG + Intergenic
901571419 1:10163976-10163998 CTCAGCCTCCCAAAGTGCGGGGG + Intronic
901818640 1:11810958-11810980 CTCAGCCTCCTAAAGTGTGGGGG - Intronic
902043320 1:13507983-13508005 CTTGGCCTCCCAAAGTGTGCTGG - Intronic
902348819 1:15838196-15838218 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
902387909 1:16086331-16086353 CTTAGCTTCCCAAAGTGTGCTGG + Intergenic
902566867 1:17317175-17317197 CTCAGCTTCCCAAAGTGCTAGGG + Intronic
902699062 1:18159170-18159192 CTCAGGTTCCGGAGCTGTGCTGG - Intronic
902807067 1:18867798-18867820 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
903064443 1:20691047-20691069 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
903353964 1:22735171-22735193 CTCACCCTCCCAAAGTGTGCTGG - Intronic
903613947 1:24638405-24638427 CTCAGGCTCTCAAAAAGTGCTGG - Intronic
903616438 1:24662194-24662216 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
903833355 1:26188010-26188032 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
903881605 1:26513913-26513935 CTCAGCCTCCCAAAGTGCCCAGG - Intergenic
903931972 1:26867501-26867523 CTCAGCTTCCCAAAGTGCTAGGG + Intergenic
904124169 1:28224631-28224653 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
904246113 1:29189318-29189340 CTCAGTTTCCCAAAGTGCTGGGG + Intergenic
904459811 1:30669611-30669633 CTCAGCATCCCAAAGTGTTGGGG - Intergenic
904646762 1:31973495-31973517 TTCAGCTTCCCAAAGTGTGCTGG - Intergenic
904668284 1:32141646-32141668 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
904685897 1:32260260-32260282 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
904690346 1:32289091-32289113 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
904777714 1:32921550-32921572 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
904800741 1:33091489-33091511 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
905575421 1:39040321-39040343 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
906397542 1:45480071-45480093 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
906505593 1:46377007-46377029 CTCAGCCTCCCAAAGTGTTCGGG + Intergenic
907130965 1:52096600-52096622 CTCAGCTTCCCAAAGTGGTGGGG - Intergenic
907138027 1:52157653-52157675 CTCAGCCTCCCAGAGTGTGCTGG + Intronic
907215704 1:52861957-52861979 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
907424916 1:54373510-54373532 CTCAGCTTCCCAAAATGTTGGGG - Intronic
907474193 1:54694719-54694741 CTCAGCCTCCCAAAGTGGTCAGG + Intronic
907833263 1:58085617-58085639 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
908524884 1:64978026-64978048 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
909427685 1:75546071-75546093 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
909657822 1:78050145-78050167 CTCGGCCTCCCAAAGTGAGCTGG + Intronic
910408115 1:86912021-86912043 CTCAGCCTCCCAAAGTGCACTGG + Intronic
910963180 1:92783560-92783582 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
911218379 1:95220197-95220219 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
912054051 1:105572237-105572259 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
912904334 1:113688096-113688118 CTCAGCTTCCCAAAGTGCAGGGG + Intergenic
914213078 1:145599525-145599547 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
914357745 1:146902114-146902136 CTCAGCTTCCCAAAGTGCCGAGG + Intergenic
914804959 1:150984908-150984930 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
914894553 1:151657419-151657441 GTCAGCCTCACAAAGTGTGCTGG + Intronic
915159642 1:153908911-153908933 CTCAGCCTCCCAAAGTGCTCTGG + Intronic
915542290 1:156575299-156575321 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
916006748 1:160668523-160668545 CTCAGCTTCTCAAAGTGTTAGGG + Intergenic
916185013 1:162122754-162122776 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
916410231 1:164539972-164539994 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
916448589 1:164896736-164896758 CTCTGGTTCCCAAAGTGTACAGG - Intronic
916693377 1:167212694-167212716 CTCGGCTTCCCAAAGTGTTGGGG - Intergenic
916698003 1:167260127-167260149 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
917993462 1:180408903-180408925 CTCAGCCTCCCAAAGTGTTAGGG - Intronic
918764417 1:188460450-188460472 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
920237120 1:204515579-204515601 CTCGGCCTCCCAAAGTGCGCTGG + Intergenic
920535978 1:206736907-206736929 CTCAGCCTCCCAAAAAGTGCTGG + Intergenic
921144627 1:212341988-212342010 CTCAGCTTCCTAAAGTGTGTTGG + Intronic
921184204 1:212656024-212656046 GTCAGGAACCCAAAGTGTGCTGG - Intergenic
921291555 1:213662527-213662549 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
921410088 1:214826442-214826464 CTCAGTCTCCCAAAGTGCTCGGG + Intergenic
921491853 1:215786857-215786879 CTCAGGAAACCAAAGAGTGCAGG - Exonic
921623473 1:217352274-217352296 TTCAGGTTTCCAAAATGTTCAGG - Intergenic
921874874 1:220183502-220183524 CTCAGCTTCCCAAAGTGTTAAGG + Intronic
922298596 1:224274383-224274405 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
922547617 1:226470343-226470365 CTCAGCTTCCCAAAGACTACAGG + Intergenic
922847484 1:228699179-228699201 CTCAGCTTCCCAAAGTGCTGAGG - Intergenic
923078168 1:230628868-230628890 CTCAGCCTCCCAAAGTGTTGAGG + Intergenic
923569385 1:235100519-235100541 TTCACGTTCCCACAGTGTGATGG + Intergenic
923581717 1:235222932-235222954 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
924236813 1:242005805-242005827 CTCAGCCTCCCAAAGTGTGCTGG - Intergenic
924366893 1:243303819-243303841 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1063372444 10:5530597-5530619 TTCAGCTCCCCAAGGTGTGCAGG - Intergenic
1063596375 10:7439603-7439625 CTCAGACTCCCAAAGTGTTGGGG + Intergenic
1064421790 10:15197000-15197022 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1064665717 10:17649150-17649172 CTCAGCCTCCCAAAGTGTAGGGG - Intronic
1064685180 10:17854201-17854223 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1064718740 10:18206241-18206263 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1064971405 10:21070923-21070945 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1065235276 10:23644181-23644203 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1065507603 10:26444846-26444868 CTCAGCCTCCCAAAGTGTTTGGG - Intronic
1065667822 10:28082001-28082023 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1065715570 10:28564023-28564045 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1066110747 10:32194603-32194625 CTCAGCCTCCCAAAGTTTACAGG - Intergenic
1066197476 10:33115351-33115373 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1067265864 10:44744851-44744873 CTCAGCCTCCCAAAGTGTTAGGG - Intergenic
1068636202 10:59351084-59351106 CTCAGCCTCCCAAAGTGCTCGGG - Intronic
1068971607 10:62963907-62963929 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1068994270 10:63184491-63184513 CTTAGCCTCCCAAAGAGTGCTGG + Intronic
1069573482 10:69508190-69508212 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1069834474 10:71300153-71300175 CTCAGTTTCCCCAGTTGTGCAGG + Exonic
1070557040 10:77536633-77536655 CTCAGGTTCCCACAGCTTGTGGG + Intronic
1070734973 10:78856991-78857013 CTCAGTTTCCCCAAGGGTGCAGG - Intergenic
1070899636 10:80016984-80017006 CTCAGTTTCCCAAAGTGCTGAGG - Intergenic
1070940204 10:80337773-80337795 CTGAGGTTCCTCAACTGTGCTGG + Intronic
1071067246 10:81650427-81650449 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1072134069 10:92526592-92526614 CTCAGCTTCCCAAAGTGCTAGGG - Intronic
1072352957 10:94576046-94576068 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1072688286 10:97552026-97552048 CTCAGTCTCCCAAAGTGCGGGGG + Intronic
1072942346 10:99777654-99777676 CTCAGCCTCCCAAAGTGCCCAGG + Intergenic
1073327678 10:102651777-102651799 CTGATGTTCCCAGAGTGTCCTGG + Intronic
1074656970 10:115602100-115602122 CTCAGGCTCCCAAAGTGCTAGGG - Intronic
1075363844 10:121864889-121864911 CTAAGCTTCCCATAATGTGCAGG + Intronic
1076197992 10:128534063-128534085 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1076628335 10:131835557-131835579 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1077262874 11:1632381-1632403 CTCAGGTTTCCAAGCTGTCCTGG + Intergenic
1078138831 11:8675986-8676008 CTCAGCTTCCCAAAGATTACAGG + Intergenic
1078155639 11:8797699-8797721 TTCAGCCTCCCAAAGTGTGGGGG + Intronic
1078262034 11:9718846-9718868 CTCAGCCTCCCAAAGATTGCAGG - Intronic
1078264252 11:9741850-9741872 CTCGGCCTCCCAAAGTGTGGTGG - Intronic
1078730420 11:13969126-13969148 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
1078763278 11:14269196-14269218 CTCCGCCTCCCAAAGTCTGCTGG - Intergenic
1079207707 11:18431207-18431229 CTTAGGCTCCCAAAGTGTTGCGG - Intronic
1080062443 11:27971321-27971343 CTGAGCTTCCCAAAATGTCCTGG + Intergenic
1080530466 11:33170393-33170415 CTTAGATTCCCAAAATGTGAAGG - Intergenic
1081722152 11:45298167-45298189 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1081943971 11:46972245-46972267 ATCAGGTTTCCAAATTGTCCTGG + Intronic
1082054166 11:47799335-47799357 CTCAGCTTCCCAAAGTGCTAAGG + Intronic
1082201059 11:49368111-49368133 CTCAGGTTGCCAAAGCCTTCGGG + Intergenic
1083049246 11:59762326-59762348 CTCAGGTGCCCACTGTCTGCAGG + Intronic
1083246427 11:61431420-61431442 CTCAGCTTTCCAAAAAGTGCTGG + Intronic
1083285200 11:61654332-61654354 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1083602724 11:63958859-63958881 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1083771136 11:64868243-64868265 CACAGGTTTCCAACGCGTGCTGG + Intronic
1083976019 11:66120952-66120974 CTCTGCTTCCCACTGTGTGCGGG + Intronic
1083982190 11:66181463-66181485 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1084401998 11:68949769-68949791 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1084915285 11:72424503-72424525 CTCGGCCTCCCAAAGTGTGCTGG - Intronic
1084949855 11:72658582-72658604 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1085642472 11:78200975-78200997 CTCACGTTCCCCAAGTAGGCTGG + Intronic
1085645920 11:78222832-78222854 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1085766215 11:79284986-79285008 CTCTGCCTCCCAAAGTATGCTGG - Intronic
1085968049 11:81553046-81553068 CTCAGGTTCACTAAATATGCTGG + Intergenic
1086023584 11:82262262-82262284 CTCAGTTTCGCAAAGTGTTAGGG - Intergenic
1086347950 11:85916857-85916879 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1086654618 11:89338099-89338121 CTCAGGTTGCCAAAGCCTTCGGG - Intronic
1087708712 11:101524498-101524520 CTCGGCCTCCCAAAGTGTACAGG + Intronic
1087813698 11:102635495-102635517 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1088243383 11:107793166-107793188 CTCAGGCTCCCAAAGTGCGGGGG + Intronic
1089291744 11:117441531-117441553 CACAGGTGCCCAGAGTGTGGTGG + Intronic
1089662774 11:119996439-119996461 CACAGCTGCCCAAAGTGTGTTGG - Intergenic
1090293726 11:125568775-125568797 CTCAGCTTCCCAAAGTGCTGAGG + Intergenic
1090370992 11:126252492-126252514 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1090507471 11:127334168-127334190 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1091197228 11:133742074-133742096 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1091570077 12:1677417-1677439 CTTGGGCTCCCAAAGTGTGCTGG + Intergenic
1091748159 12:3005887-3005909 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
1091922064 12:4312795-4312817 CTTGGCCTCCCAAAGTGTGCCGG + Intergenic
1092225042 12:6742760-6742782 CTCAGCTTCCCAAAGTGTTTAGG + Intergenic
1092235398 12:6804763-6804785 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1093315818 12:17648297-17648319 CTCAGCCTCCCATAGTGTGCTGG - Intergenic
1094192838 12:27714332-27714354 CTCAGTCTCCCAAAGTGCGGTGG - Intronic
1094383304 12:29867085-29867107 CTCAGCTTCCCAAAGTGCATTGG - Intergenic
1095042218 12:37455618-37455640 CCCAGGCTCCCCAAGAGTGCAGG - Intergenic
1095084832 12:38049993-38050015 CTCAGTCTCCCAAAGTGTTGGGG + Intergenic
1096090724 12:48898845-48898867 CTGAGGATCCCAAAGTGGCCAGG - Intergenic
1096322485 12:50627578-50627600 CTCAGCCTCCCAGAGTGTGGGGG + Intronic
1097006147 12:55919403-55919425 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1097204965 12:57313306-57313328 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1098845789 12:75534184-75534206 CTCTGTTCCCCAAAGTGTACTGG + Intergenic
1099119296 12:78668073-78668095 CTCAGGTGCCCAAAGTGCTGGGG - Intergenic
1099525534 12:83714112-83714134 CTCAGCTTCCAAATGTGGGCAGG + Intergenic
1100198656 12:92275345-92275367 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
1100977142 12:100134352-100134374 CTCAGCTTCCCAAAGTGCTTGGG - Intronic
1101145835 12:101839668-101839690 CTTGGCCTCCCAAAGTGTGCTGG - Intergenic
1101400088 12:104379603-104379625 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1101505814 12:105345235-105345257 CTCAGCTTCCCAAAGTGTTAGGG - Intronic
1101772329 12:107762457-107762479 CTCAGCTTCCCAAAGTGCTGAGG - Intergenic
1102304726 12:111796007-111796029 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1102699974 12:114830585-114830607 TTCGGCTTCCCAAAGTGTGCTGG + Intergenic
1103038506 12:117675633-117675655 TTCCTCTTCCCAAAGTGTGCTGG + Intronic
1103280856 12:119756875-119756897 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1103305298 12:119959346-119959368 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1103361173 12:120354940-120354962 CTCAGGTTCCCAAAGTGTTGTGG - Intronic
1103523955 12:121554932-121554954 TTCAGCTTCCCAAAGTGTTGGGG - Intronic
1103539357 12:121655094-121655116 CTCAGCCTCCTAAAGTGAGCCGG - Intronic
1103694860 12:122806729-122806751 CTTGGCCTCCCAAAGTGTGCTGG + Intronic
1103717152 12:122951476-122951498 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1104037503 12:125107707-125107729 CTCAGGTTCCCAAAGTGCTGGGG - Intronic
1104454618 12:128900885-128900907 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1105312327 13:19223386-19223408 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1105409307 13:20158087-20158109 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1105516632 13:21096783-21096805 CTCAGCTTCCCAAAGTGTTGAGG + Intergenic
1106177549 13:27344106-27344128 TTCAGGTGCCCAAAGTCTCCTGG - Intergenic
1106179781 13:27360821-27360843 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1106214645 13:27685292-27685314 CTCAGCCTCCCAAATAGTGCTGG + Intergenic
1106222975 13:27762335-27762357 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1106308809 13:28535157-28535179 CCCAGGATCCCCAAGAGTGCAGG - Intergenic
1106741875 13:32653040-32653062 CTCAGCCTCCCAAAGTGCACAGG - Intronic
1107348201 13:39486030-39486052 CTCAGGGCCACAAAGTCTGCTGG + Intronic
1107444145 13:40455489-40455511 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1107485306 13:40821044-40821066 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1107701838 13:43056387-43056409 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1107924738 13:45247638-45247660 CTCAGCTTCCCAAAGTGCTAGGG + Intronic
1109207503 13:59498524-59498546 CTCAGCCTCCCAAAGTGTGCTGG - Intergenic
1109268517 13:60228586-60228608 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1112325543 13:98440856-98440878 CTCTGGTTCCCAGCTTGTGCTGG + Intronic
1112568762 13:100574321-100574343 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1112906024 13:104423445-104423467 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1113515214 13:110889684-110889706 CTCAGGATTCCAAAGTGTTTTGG + Intronic
1114475479 14:22991492-22991514 CTCAGCCTCCCAAAGTGTGCTGG + Intronic
1115686778 14:35804680-35804702 CTCAGCCTCCCAAAGTATTCTGG - Intronic
1115687624 14:35812394-35812416 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1116890792 14:50266182-50266204 CTCAAATTCCCAAGGAGTGCTGG + Intronic
1117248966 14:53916210-53916232 CTCAGCCTCCCAAAGTGCACTGG - Intergenic
1117373338 14:55098648-55098670 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1117595355 14:57321500-57321522 CTCAGCTTCCCAAAGTGCTCTGG - Intergenic
1117941692 14:60973535-60973557 CTCGGCTTCCCAATGTGTGAAGG - Exonic
1118322274 14:64760117-64760139 CACAGGCTCCCAATGGGTGCGGG + Intronic
1118802563 14:69204316-69204338 CTCACCTTCCCAAAGTGCTCGGG - Intronic
1119061684 14:71481225-71481247 CTCAGGTTCTCAAAGTGCTAGGG - Intronic
1119239015 14:73043391-73043413 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1119414152 14:74458363-74458385 CTCAGCTTCCCAAAGTGCTGAGG - Intergenic
1119448813 14:74689994-74690016 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1119546714 14:75477292-75477314 CTCAGCTTCCCAAAGTGTTGGGG + Intergenic
1119584372 14:75818748-75818770 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1119745770 14:77042927-77042949 CTCAGCTTCCCAAAGTTTCTGGG + Intergenic
1120538487 14:85726578-85726600 CTCAGGCTCCCAAAGTGTTAAGG + Intergenic
1120628349 14:86857169-86857191 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1120735983 14:88053269-88053291 CTCAGCCTCCCAAAGTGCGATGG + Intergenic
1120827001 14:88965213-88965235 CTCAGCCTCCCAAAGTGCACTGG + Intergenic
1120907353 14:89632136-89632158 CTTAGCCTCCCAAAGTGTGGGGG + Intronic
1120990030 14:90367341-90367363 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1121718946 14:96095940-96095962 CTCAGGCTCCCGCAGGGTGCTGG + Intergenic
1122224322 14:100264858-100264880 CTCAGCTTCCCAAAGTGTTGAGG - Intronic
1122327613 14:100891834-100891856 CTCAGTTTCCCCATGTCTGCAGG + Intergenic
1122566185 14:102658224-102658246 CTCGGCTTCCCAAAGTGTTGGGG + Intronic
1122778162 14:104132047-104132069 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1122790811 14:104183450-104183472 CTCAGTTTCCCCAAATGTCCCGG - Intergenic
1122790827 14:104183509-104183531 CTCAGTTTCCCCAAGTGTCCCGG - Intergenic
1122868810 14:104624480-104624502 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1122948831 14:105029326-105029348 CTCAGCCTCCCAAAGAGTGCTGG + Intergenic
1202940741 14_KI270725v1_random:143343-143365 CCCAGGCTCCCCAAGAGTGCAGG - Intergenic
1124470892 15:29984796-29984818 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1125194509 15:37030890-37030912 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1125321112 15:38490072-38490094 GCCAGGTTCACAAAGTATGCTGG + Exonic
1125358857 15:38845182-38845204 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1125665246 15:41425353-41425375 CTCGGCCTCCCAAAGTGTGCTGG + Intronic
1125896210 15:43304312-43304334 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG + Intronic
1126522556 15:49613097-49613119 CTTGGCCTCCCAAAGTGTGCTGG - Intronic
1127096770 15:55519345-55519367 CTCAGTTTCCCAAAGTGCTAGGG - Intergenic
1127383396 15:58448555-58448577 CTCAGGCTCTCAGAGTGTGAAGG + Intronic
1127411398 15:58710833-58710855 CTCTGCTTCTCAAAGTCTGCTGG + Intronic
1127416990 15:58767905-58767927 CTCAGCTTCCCAAAGTGCTGAGG + Intergenic
1127483211 15:59396110-59396132 CTCAGGCTTCCAAAGTGCGGGGG + Intronic
1127768248 15:62208739-62208761 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
1127938714 15:63670803-63670825 CTCAGCCTCCCAAAGTATGCTGG - Intronic
1128088565 15:64903568-64903590 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1128465290 15:67905453-67905475 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1128667346 15:69548147-69548169 TTCAGGTTCCCAAAGTCTTTGGG - Intergenic
1130068675 15:80628351-80628373 CTCAGTTTCCCAAAGTGCTGGGG - Intergenic
1130207909 15:81895045-81895067 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1130854556 15:87830065-87830087 CTTAAGTTCCCACAGTGGGCCGG - Intergenic
1131030968 15:89185715-89185737 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1131075887 15:89494757-89494779 CTCAGCCTCCCAAAGTATGCTGG + Intronic
1131460131 15:92611977-92611999 CTCAGCTTCCCAAAGTGTTGGGG - Intergenic
1132895147 16:2225380-2225402 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1133159336 16:3899662-3899684 CTCGGTTTCCCAAAGTGTTGGGG - Intergenic
1133223012 16:4327444-4327466 CTTAGTTTCCCTGAGTGTGCTGG + Intronic
1133373886 16:5267547-5267569 CTCAGCCTCCTAAAGTGTTCGGG + Intergenic
1133542402 16:6768976-6768998 CTCGGGCTCCCAAAGTGTTGAGG + Intronic
1133548720 16:6833416-6833438 CTCGGCTTCCCAAAGTGTTGGGG + Intronic
1134300308 16:12984854-12984876 CTGAGGTGCCTAAAGGGTGCAGG + Intronic
1134384964 16:13763384-13763406 CTCAGCCTCCCAAAGTGCACTGG + Intergenic
1134656900 16:15954278-15954300 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1134667521 16:16029473-16029495 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1135387866 16:22059923-22059945 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1135806421 16:25546834-25546856 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1136059237 16:27713487-27713509 CTCGATCTCCCAAAGTGTGCTGG - Intronic
1136181929 16:28559066-28559088 TTCAGCCTCCCAAAATGTGCTGG - Intronic
1136406112 16:30048360-30048382 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1137584515 16:49656257-49656279 CTCAGCCTCCCAAAGTGTGTGGG - Intronic
1137829611 16:51531490-51531512 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1137831257 16:51545419-51545441 CTCATGGACCCAAAGTGGGCTGG + Intergenic
1138430786 16:56967402-56967424 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1138683433 16:58704092-58704114 CTCGGCTTCCCAAAGTGTTGCGG + Intergenic
1138774234 16:59702292-59702314 ATCAGTTTCCCAAACTGTACAGG + Intergenic
1138794479 16:59951674-59951696 CTCAGCTTCCCAAAATGTTGGGG - Intergenic
1139465566 16:67152133-67152155 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1139551028 16:67673174-67673196 CTCGGGTTCCCAGAATGTGCTGG - Intergenic
1139648441 16:68348888-68348910 CTCAGCCTCCCAAAGTGTCGGGG + Intronic
1139724990 16:68890631-68890653 CTTGGCCTCCCAAAGTGTGCTGG - Intronic
1139730350 16:68938953-68938975 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1139786899 16:69400502-69400524 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1139827399 16:69768086-69768108 CTCAGCCTCCCAAAGTGTTTGGG + Intronic
1139976438 16:70815178-70815200 CTCAGCTTCCCAAAGTGCCGAGG - Intronic
1140066507 16:71615833-71615855 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1140959644 16:79899716-79899738 CTTAAGTTCCCAAAGTAGGCTGG - Intergenic
1140960389 16:79906469-79906491 CTCAGTCTCCCAAAGTGCTCGGG - Intergenic
1141027957 16:80565601-80565623 CTCAGCTTCCCAAAGTGCGGGGG + Intergenic
1141352797 16:83314186-83314208 GTCCGTTTCCCAAAGTGTGTTGG - Intronic
1141757472 16:86001507-86001529 CTCAGCTTCCCAAAGTGCTGAGG - Intergenic
1203143887 16_KI270728v1_random:1786867-1786889 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1142686833 17:1582054-1582076 CTCAGCCTCCCAAAGTGTTTTGG + Intronic
1142729315 17:1840813-1840835 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1143853108 17:9827709-9827731 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1143896637 17:10141589-10141611 CGCAGTTTCCTAAAATGTGCAGG + Intronic
1144170685 17:12657184-12657206 CTCGGCTTCCCAAAGTGTTGGGG - Intergenic
1144351392 17:14400415-14400437 CTCAGTTTCCCAAAGTGCTGGGG + Intergenic
1144652301 17:17014688-17014710 CTCACCTCCCCGAAGTGTGCTGG - Intergenic
1145055465 17:19700914-19700936 CTCGGCTTCCCAAAATGCGCTGG - Intronic
1145069800 17:19794825-19794847 CTCAGCCTCCCAAAGTGTTCTGG - Intronic
1145215521 17:21048769-21048791 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1145867299 17:28249552-28249574 CTCAGCCTCCCAAAGTGCTCCGG + Intergenic
1146136178 17:30322917-30322939 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1146599336 17:34201054-34201076 CTCAGCTAACGAAAGTGTGCCGG + Intergenic
1146667441 17:34714599-34714621 CTCAGGATCCCAAAGAAAGCTGG - Intergenic
1147289928 17:39433439-39433461 CTCAGCCTCCCAAAGTGGCCAGG + Intronic
1147342124 17:39759162-39759184 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1147370239 17:39987597-39987619 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
1147619564 17:41856391-41856413 CTCTGCTTCCCAAAGTGTTTGGG + Intronic
1147783192 17:42958816-42958838 CTCAGCTTCCCAAAGTGCCTGGG + Intronic
1147928842 17:43963714-43963736 CTCGGCTTCCCAAAGTGTTGGGG - Intronic
1147941321 17:44050359-44050381 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1148008388 17:44453781-44453803 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1148286237 17:46395423-46395445 CTCAGTCTCCCAAAGTGTTGGGG - Intergenic
1148308403 17:46613014-46613036 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1149443781 17:56698041-56698063 CTCAGCCTCCCAAAGTGCCCAGG + Intergenic
1149737870 17:59013396-59013418 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1149739339 17:59029645-59029667 CTCGGCCTCCCAAAGTGTGCTGG - Intronic
1149894358 17:60417703-60417725 CTCAGCCTCCCAAAGTGTGCTGG + Intronic
1150056112 17:62018451-62018473 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1150242130 17:63643007-63643029 CTCGGCTTCCCAAAGTGTTGGGG + Intronic
1150741633 17:67783588-67783610 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1150801129 17:68283567-68283589 CTCAGCTTCCCAAAGTGTGCTGG - Intronic
1150997503 17:70335746-70335768 CTCAGCTTCCCAAAGTGCCAGGG - Intergenic
1151296442 17:73189858-73189880 CTCAGCCTCCCAAAGTGCTCGGG - Intergenic
1151395420 17:73819763-73819785 CCCAGGCTCCCCAAGAGTGCAGG + Intergenic
1151794637 17:76335604-76335626 CTCGGCCTCCCAAAGTGTGTTGG + Intronic
1152022798 17:77789776-77789798 CTCAGCTTCCCAAAGTGCTGAGG + Intergenic
1152488427 17:80611516-80611538 CTCGGCTTCCCAAAGTGTTGGGG + Intronic
1152498341 17:80691044-80691066 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1152691114 17:81718092-81718114 CTCAGGCTCCCAAAGTGCTGGGG - Intronic
1152827552 17:82476980-82477002 CTCGGCCTCCCAAAGTGTGCTGG + Intronic
1153689908 18:7581909-7581931 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1153850000 18:9084831-9084853 CTTGGCCTCCCAAAGTGTGCTGG + Intergenic
1155029402 18:21971237-21971259 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1155302915 18:24449107-24449129 CTCAGCTTCCCAAAGTGCTAGGG - Intronic
1155585465 18:27359164-27359186 CTCGGCTTCCCAAAGTGTTGGGG - Intergenic
1155994555 18:32316695-32316717 CTCAGCCTCCCAAAGTGTGCTGG + Intronic
1158086186 18:53654262-53654284 CTCAGCTTCCCAAAGTTTTAGGG + Intergenic
1158328603 18:56337357-56337379 CTGAGTTTCCCACAGTGTGTTGG - Intergenic
1158617207 18:58999232-58999254 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1158919388 18:62173481-62173503 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1158946750 18:62453717-62453739 CTCAGCCTCCCGAAGTGTGCTGG - Intergenic
1158992732 18:62886524-62886546 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1159489112 18:69106464-69106486 CTCAGTCTCCCAAAGTGTTGGGG + Intergenic
1159795773 18:72841479-72841501 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1161555409 19:4939309-4939331 CTCAGCCTCCCAAAAGGTGCTGG + Intronic
1161694765 19:5760114-5760136 CTCAGCCTCCCAAAGTGTTGTGG - Intronic
1161947378 19:7446144-7446166 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1162058824 19:8082218-8082240 CTCAGCCTCCCAAAGTGTGCTGG + Intronic
1162380219 19:10327502-10327524 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
1162397854 19:10427874-10427896 CTCAGCCTCCCAAAGTGTGTTGG - Intronic
1162431078 19:10628966-10628988 CTCAGCCTCCCAAAGTGTGCTGG - Intronic
1162436732 19:10664930-10664952 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1162565532 19:11444315-11444337 CCCAGATTCCCAAAGGGTGGCGG + Intronic
1162645740 19:12048891-12048913 CTCAGTTTCCCAAAGTGCTGAGG - Intronic
1163081555 19:14947267-14947289 CTCAGCCTCCCAAAAAGTGCTGG + Intergenic
1163139937 19:15340687-15340709 CTCAGGTTCCCAAAGTGCTGGGG + Intergenic
1163226575 19:15965713-15965735 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1163464442 19:17458851-17458873 CTCGGCCTCCCAAAGTGTGCTGG + Intronic
1163469483 19:17488105-17488127 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1163606229 19:18277132-18277154 CTCAGCTTCCCAAAGTTTCTGGG - Intergenic
1163740030 19:19005975-19005997 CTCAGCCTCCCAAAATGTGCTGG - Intronic
1163891193 19:20016057-20016079 CTCAGCTTCCCAAAGTGCTAGGG - Intronic
1164107306 19:22119410-22119432 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1164308587 19:24026636-24026658 CTCAGTTTCCCAAAGTGCTGAGG + Intergenic
1164960849 19:32428221-32428243 CTCGGCTTCCCAAAGTGTTGGGG + Intronic
1165237665 19:34435867-34435889 TTCGGGTTCCCAAAAAGTGCTGG - Intronic
1165344177 19:35233360-35233382 CTCAGCCTCCCAAAGTGTGCTGG - Intergenic
1165370793 19:35404659-35404681 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1165944338 19:39432644-39432666 CTCATCTTCCCAATGTGTCCAGG - Intergenic
1166127551 19:40724695-40724717 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1166597800 19:44065827-44065849 CTCAGCTTCCCAAAGTGCCTTGG + Intronic
1166661604 19:44650812-44650834 CTCAGCCTCCCAAAGTATGCTGG + Intronic
1166831740 19:45643506-45643528 CTCATTTTCCCAAAGTGGGAGGG + Intronic
1167093702 19:47362031-47362053 CTCAGGCTCCCAAAGTGATGGGG - Intronic
1167297277 19:48658853-48658875 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1167388965 19:49181781-49181803 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
1167417452 19:49383288-49383310 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1167431759 19:49459199-49459221 CTCAGATTCCCAGTATGTGCTGG + Intronic
1167743526 19:51338304-51338326 CTCAGGTGGCCAAAGCGTGGGGG - Intronic
1168373996 19:55860323-55860345 CTCAGCTTCTCAAAGTGTTGGGG - Intronic
925691002 2:6523216-6523238 CTCAGGTTCCCATATTTTGGGGG - Intergenic
926953773 2:18271929-18271951 CCCAGGTCCCCCAAGAGTGCGGG + Intronic
926996900 2:18745360-18745382 CTCAGCTTCTCAAAGTGCGCTGG + Intergenic
927768833 2:25839980-25840002 CTCAGCTTCCCAAAGTGTTGCGG + Intronic
927801770 2:26106992-26107014 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
928170779 2:29001743-29001765 CTCGGCCTCCCAAAGTGTGTGGG + Intronic
929640229 2:43571002-43571024 CTCAGCCTCCCAAAGTGTTGTGG - Intronic
929898303 2:45980331-45980353 CTCATAATCACAAAGTGTGCTGG + Exonic
930654148 2:53991654-53991676 CTCAGTCTCCCAAAGTGTTGGGG + Intronic
931197806 2:60069459-60069481 CTGAGCTTCCCATAGTGAGCTGG - Intergenic
931347890 2:61463209-61463231 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
931457032 2:62418402-62418424 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
931682204 2:64760351-64760373 TTCAGGGACCCAAAGTTTGCTGG - Intergenic
931684575 2:64782723-64782745 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
932071105 2:68621428-68621450 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
932205349 2:69875939-69875961 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
932234602 2:70110911-70110933 CTCAGCCTCTCAAAGTGTGCTGG - Intergenic
932239469 2:70145507-70145529 CTCGACCTCCCAAAGTGTGCTGG - Intergenic
932563339 2:72890798-72890820 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
932578162 2:72974025-72974047 CTCAAGTCCCCAGAGTGAGCTGG - Intronic
933006920 2:77006258-77006280 CTTAGATTCCCAAAGTGTTAGGG - Intronic
933288665 2:80412129-80412151 CTCAGGGTCCCAGGGAGTGCTGG - Intronic
933462573 2:82607467-82607489 CTCAACTTCCCAAAGTGTTGGGG + Intergenic
933663773 2:84948143-84948165 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
933890409 2:86763526-86763548 CTCAGCTTCCCAAAGTGCTGCGG - Intronic
934060390 2:88286909-88286931 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
934570784 2:95372054-95372076 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
934843937 2:97649566-97649588 CTCAGCCTCCCAAAGTGTTGTGG - Intergenic
935127827 2:100239731-100239753 CTCAGGTTTCCAAGGAGGGCAGG + Intergenic
936005306 2:108881890-108881912 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
936612000 2:114010692-114010714 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
937600249 2:123722919-123722941 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
938039706 2:128065605-128065627 CTTGGCCTCCCAAAGTGTGCTGG - Intergenic
938093097 2:128446088-128446110 CTCAGCCTCCCAAAGTGTTCAGG + Intergenic
938182945 2:129200706-129200728 CTCAGGTTCCAAAAGTGCTGGGG - Intergenic
938308434 2:130269452-130269474 CCCAGGTTCCCAATGCGTCCTGG - Intergenic
938446895 2:131387384-131387406 CTCAGGTTCCCAATGCCTCCTGG + Intergenic
938537792 2:132259250-132259272 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
938543821 2:132308868-132308890 CTCGGGTTCCCAAAGTGCTGGGG + Intergenic
938550604 2:132378061-132378083 CTCTGTTTCCCAAAGTGTTGGGG + Intergenic
938891516 2:135710373-135710395 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
938944050 2:136194708-136194730 CTCAGCATCCCAAAGTGTTAGGG - Intergenic
940072635 2:149706249-149706271 CTCAGCCTCCCAAAGTGGGGGGG + Intergenic
940304643 2:152212464-152212486 CTCAGACTCCCAAAGTGTTAGGG + Intergenic
940559553 2:155277638-155277660 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
941323322 2:164082546-164082568 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
941955427 2:171199394-171199416 CTCAGCTTCCCCAAAAGTGCTGG - Intronic
942014805 2:171802255-171802277 CTCAGCCTTCCAAAGTGTGGAGG + Intronic
942028089 2:171930864-171930886 CTCAGCTTCCCAAAGTGCTAGGG + Intronic
942577784 2:177383229-177383251 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
944110697 2:196128785-196128807 CTCAGGTTCCCAAAGCAGGTGGG + Intergenic
944548292 2:200820426-200820448 CTCAGGCTCCCAAAGTGTTGGGG - Intronic
944717923 2:202393545-202393567 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
945907391 2:215610396-215610418 CTCAGCCTCCCAAAGTGCTCTGG + Intergenic
946045075 2:216814163-216814185 CTCAGTTCCCCAAAGTGAGATGG - Intergenic
946057201 2:216912549-216912571 CTCTAGGTCCCAAAGAGTGCTGG - Intergenic
946585418 2:221181300-221181322 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
946837431 2:223786500-223786522 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
946989205 2:225308916-225308938 CTCAGATCAACAAAGTGTGCAGG + Intergenic
947005313 2:225504756-225504778 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
947469164 2:230384659-230384681 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
947771930 2:232676881-232676903 CTCAGCTTCCCAAAGTGTCCAGG - Intronic
948153174 2:235760837-235760859 CTCAGCCTTCCAAAGTGTGATGG + Intronic
948310133 2:236979184-236979206 CTCAGCCTCCCAAAGTGCGGCGG - Intergenic
948624275 2:239259195-239259217 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
948779092 2:240306197-240306219 CTCAGCCTCCCAAAAAGTGCTGG + Intergenic
948845568 2:240681363-240681385 CTCAGTTTCCCCAACTGTACGGG + Intronic
948985249 2:241518108-241518130 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
948997872 2:241592989-241593011 CTCAGCTTCCCAAAGTGCTGTGG - Intronic
1168746840 20:250554-250576 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1168793349 20:595119-595141 CTCAGCTTCCCAAAGTGCTAGGG - Intergenic
1169530525 20:6480526-6480548 CTCAGGTTTCCAAATTGCTCTGG + Intergenic
1170844810 20:19953381-19953403 CTCAGCATCCCAAAGTGTGCTGG + Intronic
1170977164 20:21175761-21175783 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1171114881 20:22516644-22516666 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1171184491 20:23115257-23115279 CTCAGCCTCCCAAAGTGTGGGGG + Intergenic
1171868902 20:30510933-30510955 CTCGGCCTCCCAAAGAGTGCTGG - Intergenic
1171908413 20:30920281-30920303 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1172102975 20:32496798-32496820 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1172219827 20:33266115-33266137 CTCTGGTTCCCAGAGTGGGAAGG + Intergenic
1172281589 20:33711615-33711637 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1172306561 20:33884850-33884872 CTTGGGTTCCCAAAGTTGGCAGG - Intergenic
1172363274 20:34329900-34329922 CTCAGCCTTCCAAAGTTTGCTGG - Intergenic
1172653694 20:36523908-36523930 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1173153292 20:40586246-40586268 CTCAGGTAACTCAAGTGTGCTGG - Intergenic
1173597326 20:44267356-44267378 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1173944791 20:46942006-46942028 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1174027365 20:47589142-47589164 CTCAGCTTCCCAAAGTGCTTGGG + Intronic
1174594489 20:51673120-51673142 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1174597044 20:51692548-51692570 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1174761844 20:53214452-53214474 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
1175929027 20:62484909-62484931 CTCAGTTTCCCAATCTGTGGTGG + Intergenic
1175991875 20:62793854-62793876 CTCAGCTTCCCCATCTGTGCAGG - Intergenic
1176208386 20:63903832-63903854 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1176228633 20:64018712-64018734 CTCAGCCTCCCAAAGTATGTAGG + Intronic
1176248426 20:64108674-64108696 CTCAGCCTCCCAAAGTGCTCAGG + Intergenic
1176582413 21:8543599-8543621 CCCAGGCTCCCCAAGAGTGCAGG + Intergenic
1177525331 21:22283305-22283327 CTCAGCTTCCCAAGGTGCGGGGG + Intergenic
1177687135 21:24451461-24451483 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1177935743 21:27343276-27343298 CTCAGGTTCCTCATCTGTGCGGG - Intergenic
1178273328 21:31213776-31213798 CTCAGCTTCCCAAAGTGCTAGGG - Intronic
1178328663 21:31666223-31666245 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1178380306 21:32102182-32102204 CTCAGCCTCCCAAAGTGTGGGGG - Intergenic
1178865894 21:36327064-36327086 CTCAGCCTCCCAAAGTGCGGGGG + Intronic
1178995774 21:37397986-37398008 CTCAGCCCCCCAAAGTTTGCTGG - Intronic
1179147892 21:38784774-38784796 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1179889964 21:44330462-44330484 CTCAGATTCTCCGAGTGTGCCGG - Exonic
1180265246 22:10520647-10520669 CTCAGGCTCCCCAAGAGTGCAGG + Intergenic
1180341847 22:11626453-11626475 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1180924370 22:19543781-19543803 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1181548799 22:23623153-23623175 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1182440052 22:30357766-30357788 CTCGGCTTCCCAAAGTGTTAGGG + Intronic
1182461604 22:30487371-30487393 CTCAGCTTCCCAAAGTGCTGAGG - Intergenic
1182578215 22:31288123-31288145 CTCAGCCTCCCAAAGTGTATAGG - Intronic
1182960528 22:34470213-34470235 CTGGGGTTACCAAAGTGAGCAGG + Intergenic
1183254710 22:36754999-36755021 GTTAGGTTCCCAAATAGTGCTGG + Intergenic
1183407197 22:37636172-37636194 CTCAGCCTCCCAAAGTGTTGTGG + Intronic
1183583797 22:38740542-38740564 CTCAGGTTCACAATGAGTGCTGG - Intronic
1183665430 22:39243609-39243631 CTCGGGTTCCCAAAGGGTGGGGG + Intronic
1183825858 22:40386671-40386693 CTCAATCTCCCAAAGTGTTCGGG + Intronic
1184083289 22:42241105-42241127 CTCAGTCTCCCAAAGTGCTCTGG + Intronic
1184270493 22:43379014-43379036 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
949546576 3:5078039-5078061 CTCAGCTTCCCAAAGTGCAGAGG - Intergenic
949921555 3:9007219-9007241 CTCAACTTCCCAAAGTGTTGGGG + Intronic
949990080 3:9571467-9571489 CTCAGACTCCCAAAGTGGGAAGG + Intergenic
950093504 3:10314229-10314251 CTCAGCCTCCCAAAGTGTTAAGG + Intronic
950301140 3:11880142-11880164 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
950306932 3:11922792-11922814 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
950314120 3:11985606-11985628 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
950355459 3:12404550-12404572 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
950375709 3:12570623-12570645 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
951210428 3:19968710-19968732 CTCAGCCTCCCACAGTGTGCTGG + Intronic
951576006 3:24114780-24114802 CTCAGCTTCCCAAAGTGTTGGGG + Intergenic
951885745 3:27522423-27522445 CTCAGCTTCCCAAAGTGCCGGGG - Intergenic
952306448 3:32151017-32151039 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
953474540 3:43194425-43194447 CTCAGGTTGCAAAACTGTGAGGG - Intergenic
953485728 3:43293217-43293239 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
953900578 3:46839695-46839717 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
954044857 3:47920801-47920823 CTCAGCTTCCCAAAGTGCTAGGG + Intronic
954237612 3:49269016-49269038 CTCAGCCTCCCAAAGTGTCGGGG + Exonic
954263750 3:49458172-49458194 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
955264489 3:57428178-57428200 CTCAGCTTCCCACAGTGTGCTGG + Intronic
955824447 3:62930376-62930398 CTCAGCTTCCCAAAGTGCCAGGG + Intergenic
956129631 3:66040685-66040707 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
956438581 3:69258215-69258237 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
956807016 3:72825050-72825072 CGCAGCCTCCCAAAGTGTGATGG + Intronic
958802702 3:98775225-98775247 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
959011681 3:101085146-101085168 CTTGGCCTCCCAAAGTGTGCTGG - Intergenic
959065925 3:101657252-101657274 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
959403748 3:105935423-105935445 CTCAGGTTCTCAGAGTCTTCTGG + Intergenic
959484173 3:106908554-106908576 CCCAGGATCCCCAAGAGTGCAGG - Intergenic
960376356 3:116906523-116906545 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
960579413 3:119262480-119262502 CTCGGCCTCCCAAAGTGTGCTGG - Intergenic
960736445 3:120785854-120785876 CTCGGCCTCCCAAAGTGTGCTGG + Intergenic
960740276 3:120825489-120825511 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
961502287 3:127345107-127345129 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
961577555 3:127850214-127850236 CTCAGCCTCCCAAAGTCTGTTGG - Intergenic
961854123 3:129852203-129852225 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
962513098 3:136122202-136122224 CTCAGCTTCCCAGAGTGTTGGGG - Intronic
963200587 3:142582008-142582030 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
963202968 3:142602936-142602958 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
963204670 3:142620376-142620398 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
963575778 3:147059396-147059418 CCCAGGTTCCTTAAGTGTACTGG - Intergenic
963742340 3:149093043-149093065 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
963800763 3:149673960-149673982 CTCAGCCTTCCAAAGTGCGCTGG - Intronic
963884698 3:150568662-150568684 CTCAGACTCCCAAAATGTGTTGG - Intronic
964192279 3:154016916-154016938 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
964678844 3:159315477-159315499 CTCAGCCTCCCAAAGTGTTTAGG + Intronic
965577668 3:170234280-170234302 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
965748758 3:171954898-171954920 CTCAGATTCTCAAAATGAGCAGG - Intergenic
966485524 3:180465083-180465105 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
966801321 3:183766924-183766946 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
967758108 3:193193246-193193268 CTGAAGGTCCCACAGTGTGCCGG - Intergenic
968011309 3:195280053-195280075 CCCAGCTTCCCAAAGTGTTGGGG - Intronic
969193392 4:5542198-5542220 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
970014073 4:11493069-11493091 CTCAGCCTCCCAAAGTGCTCTGG - Intergenic
970052520 4:11930828-11930850 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
970179762 4:13378957-13378979 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
970466308 4:16326412-16326434 CTCGGCTTCCCAAAGTGTTGGGG - Intergenic
971003578 4:22349879-22349901 CTCAGCCTCCCAAAGTGTTAGGG - Intronic
971288803 4:25315968-25315990 CTCAGCCTCCCAAACTGTGAAGG + Intronic
971544597 4:27869535-27869557 CTTGGCCTCCCAAAGTGTGCTGG + Intergenic
972051813 4:34744146-34744168 CTCAGAATCCCAAAGTGTCAAGG - Intergenic
972320528 4:37969594-37969616 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
972353295 4:38257628-38257650 CTCAGCCTCCCAAAGTGTCGGGG + Intergenic
973151834 4:46897922-46897944 CTCAGCTTCCCTAACTATGCTGG + Intronic
973985786 4:56351678-56351700 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
975135192 4:70867720-70867742 CTCAGTCTCCCAAAGTGTGCTGG + Intergenic
976240680 4:82953238-82953260 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
976466855 4:85379943-85379965 CTCAAGTTCTTAAAGTGTACAGG + Intergenic
977837126 4:101657937-101657959 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
978443359 4:108757848-108757870 CTCGGCTTCCCAAAGTGTTGGGG - Intronic
978509126 4:109496362-109496384 CTCGGCCTCCCAAAGTGTGCTGG + Intronic
979290267 4:118972187-118972209 CTCTGTCTCCCAAAGTGTACAGG - Intronic
980047388 4:128004198-128004220 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
980659257 4:135835427-135835449 CTCGGTTTCCCAAAGTGGGCGGG - Intergenic
981208776 4:142075787-142075809 CTCAGTTTCCTAACGTGTGAAGG - Intronic
981476154 4:145189150-145189172 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
981637754 4:146899770-146899792 CTATGGTTCCCTGAGTGTGCTGG + Intronic
981807629 4:148735162-148735184 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
981919583 4:150072817-150072839 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
983090869 4:163500460-163500482 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
983669337 4:170217306-170217328 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
984866734 4:184287056-184287078 CTCAGCCTCCCAAAGTGCTCTGG + Intergenic
985766729 5:1784026-1784048 CTCAGCCTCCCAAAGTGCGGGGG + Intergenic
986727116 5:10606980-10607002 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
986897565 5:12388393-12388415 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
987156165 5:15091644-15091666 CTCAGTTTCCCAAAGTGCTGGGG + Intergenic
988541194 5:32111636-32111658 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
989995759 5:50828626-50828648 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
990470844 5:56113899-56113921 CTTGGCTTCCCAAAGTGTGGAGG + Intronic
991335438 5:65541468-65541490 CTCTGGTTACCAAAATGTGTGGG - Intronic
992045084 5:72879934-72879956 CTCAGGCTCCCAAAGTGCTGAGG - Intronic
992718285 5:79533023-79533045 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
993488970 5:88523134-88523156 CTCAGCCTCCCAAAGTGCTCGGG - Intergenic
994071891 5:95612024-95612046 CTCAGCCTCCCAAAGTGCTCAGG + Intergenic
994190793 5:96867256-96867278 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
994725306 5:103428295-103428317 CTTGGCCTCCCAAAGTGTGCTGG + Intergenic
995174389 5:109158125-109158147 CTCAGGCTCCCAAAGTGCTGAGG - Intronic
996764626 5:127023477-127023499 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
996808368 5:127483652-127483674 CTCAGCCTCCCAAAGTGTCTGGG + Intergenic
997446165 5:133941910-133941932 CTCAGCCTCCCAAAGTGTCAGGG - Intergenic
997482800 5:134201158-134201180 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
997502560 5:134388053-134388075 CTCGGCCTCCCAAAGTGTTCAGG + Intronic
998353257 5:141514529-141514551 CTCAGGCTCCCAACCTCTGCTGG + Intergenic
998469612 5:142373317-142373339 CTCAGCTTCCCAAAGTGTCCGGG + Intergenic
999151039 5:149426353-149426375 CTCGGCTTCCCAAAGTGCTCAGG + Intergenic
999337869 5:150738940-150738962 CTCGGCCTCCCAAAGTGTTCGGG - Intronic
999705510 5:154269233-154269255 CTCAGCCTCCCAAAGTGCACAGG + Intronic
1000687209 5:164265869-164265891 CTCAGCTTCACAAAGTGGGCAGG - Intergenic
1001618848 5:173064958-173064980 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1002023112 5:176378011-176378033 CTCAGCTTCCCAAAGTGCTGGGG + Exonic
1002628663 5:180552388-180552410 CTCGGCCTCCCAAAGTGTGCTGG - Intronic
1003575194 6:7286658-7286680 CTTGGCCTCCCAAAGTGTGCTGG - Exonic
1003835926 6:10072628-10072650 CTCGGCCTCCCAAAGTGTACAGG - Intronic
1003875431 6:10432091-10432113 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1003903008 6:10672553-10672575 CTCAGCTTCCCAAAGTGTTGGGG - Intronic
1004198305 6:13525419-13525441 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1004656375 6:17666074-17666096 CTCAGCCTCTCAAAGAGTGCTGG + Intronic
1004684512 6:17929791-17929813 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1004695085 6:18025983-18026005 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1004803430 6:19176377-19176399 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1004972203 6:20923170-20923192 CTCCGCCTCCCAAAGTGTGGGGG + Intronic
1004977795 6:20987504-20987526 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1005288913 6:24359643-24359665 CTCAGTTTCCCAAAGTGCTGGGG - Intergenic
1005717770 6:28567933-28567955 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1005966843 6:30732601-30732623 CTCGGCTTCCCAAAGTGTTGGGG + Intronic
1006002548 6:30976692-30976714 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1006013437 6:31061672-31061694 CTCAGGTTCTCCAAGTGTAAGGG - Intergenic
1006117615 6:31783569-31783591 CCCAGCCTCCCAAAGTGTGGGGG - Intronic
1006129163 6:31858761-31858783 CTCAGCTTCCCAAAGTGCTGAGG - Intronic
1006631257 6:35431633-35431655 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
1006858558 6:37153698-37153720 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1006981397 6:38151054-38151076 CTGAGGTCCCCAGAGTCTGCTGG - Intronic
1007034603 6:38661810-38661832 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1007929755 6:45679441-45679463 CTCAGTTTCCCCAAATGAGCAGG - Intergenic
1008119243 6:47592085-47592107 CTCAGCCTCCCAAAGTGTTTGGG + Intronic
1008596755 6:53049970-53049992 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1008655480 6:53608221-53608243 CTCAGCCTCCCAAAGTGTAGGGG + Intronic
1009575700 6:65456199-65456221 CTCAGCTTCCCAAAGTGCTAGGG - Intronic
1009759905 6:67991993-67992015 CTTGGCCTCCCAAAGTGTGCTGG - Intergenic
1009996147 6:70897485-70897507 CTCGACCTCCCAAAGTGTGCTGG - Intronic
1010692796 6:78930678-78930700 CTCGGCCTCTCAAAGTGTGCTGG - Intronic
1011067920 6:83348734-83348756 CTCGGCCTCCCAAAGTGTGCTGG - Intronic
1011221771 6:85062141-85062163 CTTAGGCTCCCAAATAGTGCAGG - Intergenic
1011444106 6:87419215-87419237 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1011456397 6:87554849-87554871 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1011471089 6:87708548-87708570 CTCAGTCTCCCAAAGTGTTGGGG - Intergenic
1012193765 6:96314074-96314096 CTCAGCCTCCCAAAGTTTGGGGG + Intergenic
1012489374 6:99763793-99763815 CTGAGGTTGCCAAAGTAGGCAGG + Intergenic
1013039658 6:106421080-106421102 CTCAGATTCTCAAAGTGGGATGG - Intergenic
1014117764 6:117685601-117685623 CTCAGCCTCCCAAAGTGTTTGGG + Intronic
1014982650 6:127963638-127963660 TTCAGGTTCCCATTGTGAGCTGG + Intergenic
1015274122 6:131366975-131366997 CTCAACCTCCCAAAGTGTGTGGG - Intergenic
1015293380 6:131563028-131563050 CTCAGCCTCCCAAAATGTACAGG - Intergenic
1015795911 6:137010983-137011005 CTCAGCTTCTCAAAGTGTTAGGG - Intronic
1018104598 6:160471262-160471284 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1019084675 6:169464869-169464891 CTTGGCCTCCCAAAGTGTGCTGG - Intronic
1019084701 6:169465005-169465027 CTTGGCCTCCCAAAGTGTGCTGG - Intronic
1019665769 7:2251661-2251683 CTCAGCTTCCCACACTGTGCAGG - Intergenic
1019965138 7:4492501-4492523 CTCAGCCTCCCAAAGTGCTCGGG - Intergenic
1019981541 7:4625008-4625030 CTCAGACTCCCAAAGTGTTAAGG - Intergenic
1020054177 7:5105626-5105648 CTCAGCTTCCCAAAGTGTTAGGG - Intergenic
1020216108 7:6191961-6191983 CTCAGGCTCCCAAAGTGACTGGG - Intronic
1020363530 7:7355356-7355378 CTCAGCCTCCCAAAGTGTTTGGG - Intergenic
1020650157 7:10865267-10865289 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1021234222 7:18122868-18122890 CTCAGCCTCCCAAAGTGCTCAGG + Intronic
1022637418 7:32150158-32150180 CTCATATTCCCAAAGTGCCCTGG + Intronic
1023213061 7:37829314-37829336 CACAGCTTCCCAAAGTGGGCTGG + Intronic
1023752745 7:43387383-43387405 CTCAGGTTCCTCAAGTTTGAAGG + Intronic
1023926857 7:44675624-44675646 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1023934378 7:44729001-44729023 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1025085482 7:56019963-56019985 CTCAGCTTCCCAAAGTGTTTGGG - Intronic
1025114268 7:56244297-56244319 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1025605023 7:63033561-63033583 CTTGGGTGCCCAAAGTGCGCTGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026107945 7:67435840-67435862 CTCAGCCTCCCAAATTGTGGAGG + Intergenic
1026125484 7:67575942-67575964 CTCAGCCTCCAAAAGTGTGAGGG - Intergenic
1026297581 7:69068407-69068429 CTCAGCTTCCCAAAGTGCTGAGG - Intergenic
1026405031 7:70056234-70056256 CTCATCTTCCCAAAGTGCTCAGG + Intronic
1026535920 7:71238474-71238496 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1026748007 7:73027730-73027752 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026751655 7:73055875-73055897 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026755304 7:73084002-73084024 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026758954 7:73112016-73112038 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026795126 7:73361464-73361486 CTTGGCCTCCCAAAGTGTGCTGG + Intergenic
1027034211 7:74913044-74913066 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1027088452 7:75281457-75281479 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1027092095 7:75309385-75309407 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1027095738 7:75337352-75337374 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1027170677 7:75870012-75870034 CTCAGCCTCCCAAAGTGTTGTGG - Intronic
1027281166 7:76610399-76610421 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1027323602 7:77030334-77030356 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1028611050 7:92711935-92711957 CTCAGCCTCCCAAAGTGTCACGG - Intronic
1029230503 7:99063931-99063953 CTCGGCCTCCCAAAGTGTGCTGG - Intronic
1029289330 7:99490061-99490083 CTCAGCATCCCAAAGTGTTGGGG - Intronic
1029471745 7:100758970-100758992 CTCGGCTTCCCAAAGTGTTGGGG - Intronic
1029791016 7:102843190-102843212 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1029871586 7:103698764-103698786 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1031051464 7:116950144-116950166 CTCAGCCTCCCAAGGAGTGCTGG + Intergenic
1031507860 7:122608934-122608956 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1031670976 7:124544981-124545003 CTCAGTTTCCCAAAGTGGTGGGG + Intergenic
1032871573 7:135991642-135991664 CTCAGCCTCCCAAAGTGTAGAGG - Intergenic
1033360074 7:140632814-140632836 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1033926615 7:146469777-146469799 CTAGGCCTCCCAAAGTGTGCTGG + Intronic
1034077338 7:148244812-148244834 CTCAGCTTCCCAAAGTGCAGGGG + Intronic
1034163425 7:149008449-149008471 CTGGGCTTCCCAAAGTGTGCTGG - Intronic
1034282471 7:149863772-149863794 CTCAAGTTCCCACAGTGAACAGG - Intronic
1035000992 7:155611934-155611956 CTCAGCCTCCCAATATGTGCTGG + Intronic
1035111996 7:156491042-156491064 CCCAGGGTCCCAAATTGTGGTGG - Intergenic
1035195882 7:157219957-157219979 CTCAGCATCCCAAAGTGCCCGGG - Intronic
1035428618 7:158799876-158799898 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1035433465 7:158840064-158840086 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1035717493 8:1764646-1764668 GTAAGGTCACCAAAGTGTGCGGG + Intronic
1035826783 8:2653670-2653692 CTCAGGATTCCCACGTGTGCTGG - Intergenic
1035835785 8:2750153-2750175 CTCAGGTGCCCAGACTGGGCTGG + Intergenic
1036959497 8:13228489-13228511 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1037391123 8:18392694-18392716 CTCAAGTTTCCCAAGTGTGGTGG - Intronic
1037560183 8:20066379-20066401 CTTAGGTGCCCAGAGTGTGCAGG - Intergenic
1037705942 8:21315173-21315195 CTCAGTCTCCCAAAGTGTTGGGG + Intergenic
1037833987 8:22205521-22205543 CTCAGCTTCCCAAAGTGCTAGGG - Intronic
1038353746 8:26806828-26806850 CTCAGCTTCCCAGAGTGGGTGGG + Intronic
1038788257 8:30641916-30641938 CTCAGCCTCCCAAAGTGTGGGGG + Intronic
1039457858 8:37719871-37719893 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1039505604 8:38050161-38050183 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1039673840 8:39636235-39636257 CTCAGTCTCCCAAAGTGTTGGGG + Intronic
1040482968 8:47842911-47842933 CTCAGCTTCCCAAAGTGGTGGGG - Intronic
1040512848 8:48110378-48110400 CTCGGCTTCCCAAAGTGTTAGGG + Intergenic
1040522588 8:48191290-48191312 CTCCGGCTCCCAAAGTGTTGGGG - Intergenic
1040680896 8:49807305-49807327 TTCAGGTTTCCAAAGTATGCTGG - Intergenic
1041733419 8:61085770-61085792 CTCGGCCTCCCAAAGAGTGCTGG - Intronic
1042302211 8:67296901-67296923 CTCAGCCTCCCAAAGTGCGGGGG + Intronic
1042825288 8:72973540-72973562 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
1043325503 8:79045839-79045861 CTCAGGCTCCCAAAGTGTTAGGG - Intergenic
1043500792 8:80853112-80853134 CTCAGCTTCCCAACGTGTTGGGG - Intronic
1043812856 8:84764180-84764202 GCCATGTTCCCAAAGTGTGAAGG + Intronic
1044012304 8:87009549-87009571 CTCAGCCTCTCAAAGTGTGCTGG + Intronic
1044020738 8:87102863-87102885 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1044354303 8:91203112-91203134 CTCAGGCTCCCAGATTTTGCAGG - Intronic
1044715369 8:95095016-95095038 CTCAGCCTCCCAAAGTGAGGTGG + Intronic
1046417431 8:113936163-113936185 ATCAGGAGCCCAAAGTGTCCAGG + Intergenic
1046536951 8:115527017-115527039 CTTATGTTCCCAAAGGATGCTGG - Intronic
1046544809 8:115636660-115636682 CTCAGGCTCCCAAAGTGTTGGGG - Intronic
1047391835 8:124458759-124458781 CTCAGCCTCCCAAAGTTTACAGG - Intronic
1047608363 8:126496769-126496791 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
1047749574 8:127870053-127870075 CTCGGCTTCCCAAAGTGTTGGGG + Intergenic
1048432668 8:134384756-134384778 CTCAGCCTCCCAAAGTGTTAAGG - Intergenic
1049028601 8:140015249-140015271 CTCAGGTTCACACAGCTTGCAGG - Intronic
1049723713 8:144135233-144135255 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1050383969 9:5064276-5064298 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1050408986 9:5341497-5341519 CTCGGCCTCCCAAAGTGTCCAGG + Intergenic
1051301303 9:15653866-15653888 CTCAGCTTCCCAAAGTGACGGGG + Intronic
1051484507 9:17593444-17593466 CTCTGGTTACCAAAATGTGTGGG - Intronic
1051620679 9:19046933-19046955 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1051644554 9:19254878-19254900 CTCAGCCTCCCAAAGTGCGGGGG - Intronic
1051950546 9:22626340-22626362 CTCAGCCTCCCAAAGAGTGCTGG - Intergenic
1052844348 9:33321947-33321969 CTCAGCATCCCAAAGTGTGGGGG - Intronic
1052871004 9:33506563-33506585 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1052894378 9:33733750-33733772 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1053251771 9:36580277-36580299 CTCGGCCTCCCAAAGTGTGGGGG + Intronic
1053330961 9:37206601-37206623 CTCAGCTTCCTAAAGTGTTGAGG + Intronic
1053924208 9:43035550-43035572 CTCGGCTTCCCAAAGTGTTGGGG - Intergenic
1054570459 9:66805138-66805160 CTCAGCTTCCCAAAGTGCTAGGG - Intergenic
1055356891 9:75446997-75447019 CTCAGCCTCCCAAAGTGTCAGGG - Intergenic
1055464818 9:76554135-76554157 TTCAGCTTCCCAAAGTGTTGGGG - Intergenic
1057687511 9:97248786-97248808 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1058933304 9:109743775-109743797 CTCCTGTTATCAAAGTGTGCAGG - Intronic
1059011051 9:110460499-110460521 CTCAGCTTCCCAAAGTGCTGGGG - Intronic
1060397027 9:123323426-123323448 CTCGGCCTCCCAAAGTGTGCTGG - Intergenic
1060975924 9:127764958-127764980 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1061099189 9:128479170-128479192 CTCTGGTTCCCAAAGTTTCCTGG - Intronic
1061182531 9:129033340-129033362 CTCAGACTCCCAAAGTGTTGGGG + Intergenic
1061206115 9:129164476-129164498 CTCAGGGTCCCATATTGTTCAGG - Intergenic
1061311577 9:129766853-129766875 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1061657808 9:132106279-132106301 CTCAGTTTCCCAAAGTGCTGGGG + Intergenic
1061916281 9:133756133-133756155 CTCAGCCTCCCAAAGTGTCAGGG - Intergenic
1062314132 9:135957349-135957371 CTCATGATCCTAAAGTTTGCAGG + Intronic
1062650848 9:137576484-137576506 CTCAGCTTCCCAAAGTGTTGGGG - Intronic
1203612428 Un_KI270749v1:21613-21635 CCCAGGCTCCCCAAGAGTGCAGG + Intergenic
1185542824 X:917117-917139 CTCAGGTTGCCCAAGGATGCTGG + Intergenic
1185762356 X:2698418-2698440 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1186037752 X:5443217-5443239 CTCAGCTTCCCAAAGTGGTGGGG + Intergenic
1186429594 X:9493508-9493530 CTCAGCTTCCCAAAGTGCTTGGG - Intronic
1187056550 X:15746294-15746316 CTCAGCTTCCCAAAGTGCTGGGG + Intronic
1187444829 X:19352048-19352070 CTTGGCCTCCCAAAGTGTGCTGG + Intronic
1187936660 X:24342838-24342860 CTTAGTTTCCCAAAGTGCACAGG - Intergenic
1188409050 X:29849016-29849038 CTCAGACTCCCAAAGTGCGGGGG + Intronic
1189415409 X:40808578-40808600 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1189780935 X:44513852-44513874 CTCAGCCTCCCAAAGTGCGGCGG - Intergenic
1190040395 X:47066721-47066743 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1190075424 X:47313608-47313630 CTCAGCCTCCCAAAGTGTTAAGG + Intergenic
1190106129 X:47562230-47562252 CTCAGCCTCCCAAAGTGTCCTGG - Intronic
1190770299 X:53508505-53508527 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1191059596 X:56280485-56280507 CTCAGCTTCCCAAAGTGGTTGGG + Intronic
1192136084 X:68602157-68602179 CTCAGCCTCCCAAAAAGTGCAGG - Intergenic
1192364964 X:70464115-70464137 CTCAGCTTCCCAAAGTGCTAAGG + Intronic
1192398232 X:70806836-70806858 CTCGGCCTCCCAAAGTGTGTTGG - Intronic
1192860134 X:75059224-75059246 CTTAGACTCCCAAAGTGCGCTGG - Intronic
1195061649 X:101201304-101201326 CTCAGCTTCCCAAAGTGCTGGGG + Intergenic
1195684405 X:107572484-107572506 CTCAGGCTCCCAAAGTCTGAAGG - Intronic
1195819107 X:108923559-108923581 CTCAGCTTCCCAAAGTGCTGAGG + Intergenic
1196620280 X:117814763-117814785 CTCAGACTCCCAAAAAGTGCTGG - Intergenic
1196777804 X:119356366-119356388 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1197772213 X:130096433-130096455 CTCAGCTTCCCAAAGTGCTGAGG + Intronic
1198363641 X:135919882-135919904 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1198740973 X:139842281-139842303 CTCAGCCTCCCAAAGTGAGCAGG + Intronic
1200177072 X:154124579-154124601 CTCAGCTTCCCAAAGTGCTGGGG - Intergenic
1200185129 X:154177419-154177441 CTCGGCCTCCCAAAGAGTGCTGG + Intergenic
1200190782 X:154214557-154214579 CTCGGCCTCCCAAAGAGTGCTGG + Intergenic
1200196533 X:154252359-154252381 CTCGGCCTCCCAAAGAGTGCTGG + Intergenic
1200202188 X:154289477-154289499 CTCGGCCTCCCAAAGAGTGCTGG + Intronic
1200412303 Y:2872766-2872788 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1201325155 Y:12748448-12748470 CTCAGGGTCCCAAGTTGTGGGGG + Intronic
1201336892 Y:12891310-12891332 CTCAGCTTCCCAAAGTGACAGGG + Intergenic
1201526156 Y:14936621-14936643 CTTGGCTTCCCAAAGTGTGCTGG + Intergenic
1201667604 Y:16476590-16476612 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1201711841 Y:17000940-17000962 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1202365445 Y:24159440-24159462 CTCAGCCTCCCAAACAGTGCTGG - Intergenic
1202505336 Y:25510682-25510704 CTCAGCCTCCCAAACAGTGCTGG + Intergenic