ID: 1125914668

View in Genome Browser
Species Human (GRCh38)
Location 15:43474894-43474916
Sequence CCCCAACAGCAACCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125914668 Original CRISPR CCCCAACAGCAACCTGAGGC TGG Intronic
900160301 1:1220138-1220160 CCCCAGCACCAACCTCAGGCTGG + Intronic
900677240 1:3895307-3895329 CCCCAACAACTGCCTGAGGTGGG + Intronic
901012523 1:6209696-6209718 CCCCACCACCAGCCTGCGGCAGG - Intronic
901293559 1:8143484-8143506 CCCCAGCGGCAGCCTGTGGCAGG - Intergenic
901792677 1:11662507-11662529 CCCCAACCCCAGCCTGTGGCTGG - Exonic
902542207 1:17163364-17163386 CCAGGACAGCAACCAGAGGCAGG - Intergenic
903127653 1:21258692-21258714 CTCCAACAGCAACGTGATCCAGG - Exonic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
904400095 1:30250559-30250581 TCCCAACAGCCCCATGAGGCAGG - Intergenic
905798046 1:40826533-40826555 TCCCACCAGCTACCGGAGGCCGG + Intronic
907744475 1:57199070-57199092 TTCCAACAGGAACCTGAGGCTGG + Intronic
909565038 1:77044458-77044480 CCCCAGCAGCTACATGCGGCGGG + Exonic
912078726 1:105910494-105910516 ACCCAACAGCTACATGGGGCAGG + Intergenic
912167432 1:107057297-107057319 CCCCATCAGCGACCAGATGCTGG + Exonic
912657764 1:111503168-111503190 CCCCAACAGCAATGTCAGCCAGG + Exonic
915304607 1:154970316-154970338 CCGGATGAGCAACCTGAGGCTGG - Exonic
915604289 1:156941046-156941068 CCCCAACAGTAACCCCTGGCTGG + Intronic
915626152 1:157115210-157115232 CCCCAACACCAACCCAGGGCAGG + Intergenic
916170047 1:161995126-161995148 CACCAACAGCAGCCAGAGGGAGG + Intronic
916624107 1:166534979-166535001 CCCCAACAGCAATCTGAGACAGG + Intergenic
916651902 1:166840570-166840592 CCCAAACAGGAATCAGAGGCAGG - Intronic
917335756 1:173922908-173922930 ACCAAAGAGGAACCTGAGGCAGG + Intergenic
917429276 1:174948769-174948791 TCCCAGCAGAAGCCTGAGGCAGG + Intronic
918553989 1:185777694-185777716 TCCCAGCAGGAAGCTGAGGCGGG - Intronic
919927812 1:202201530-202201552 CCCCACCAGCAACTAGTGGCAGG - Intronic
920151545 1:203913141-203913163 CCACAACAGCAACAGGAGGTGGG - Intergenic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920431481 1:205921772-205921794 CCCCAACAACAACCAGACCCCGG - Exonic
924815043 1:247434154-247434176 CCTCAGCAGCAACCAGAAGCTGG + Exonic
1062854679 10:773982-774004 CCCCTGCAGCAGCCAGAGGCTGG - Intergenic
1063423828 10:5935937-5935959 CCTCAGCAGCCACCTGAAGCAGG + Intronic
1066678511 10:37913743-37913765 CACCAACAAGAACCAGAGGCAGG - Intergenic
1067692863 10:48513646-48513668 CTACAACAGCAACCTGAGGAGGG + Intronic
1068967784 10:62930814-62930836 GCTCAACAGCCACCTGTGGCTGG + Intergenic
1069773666 10:70914730-70914752 GCTGACCAGCAACCTGAGGCGGG - Intergenic
1070244771 10:74720580-74720602 GCTCTACAGCAACCTGAGCCAGG - Intergenic
1070965533 10:80528134-80528156 CTCCAACAGCTACAGGAGGCTGG - Exonic
1071285862 10:84144465-84144487 CACCTACAGGAGCCTGAGGCAGG - Intronic
1074875350 10:117609324-117609346 CCCCAGCAGAGACCTGAGGCCGG - Intergenic
1076387346 10:130066825-130066847 CCACACCAGCCACCAGAGGCAGG + Intergenic
1076888647 10:133273749-133273771 CCGCCACACCCACCTGAGGCCGG + Exonic
1076985093 11:230405-230427 CCCCAACAGCAAACTGCAGAAGG + Intronic
1077401969 11:2363383-2363405 CCCCAACAACAACTTGAGCTTGG - Intergenic
1077503120 11:2918113-2918135 CCCCAACAGCGGCCAGAGCCTGG + Intronic
1077724481 11:4660844-4660866 CCCCATCAGCATCCTGAGGATGG + Intergenic
1079668931 11:23141891-23141913 CCCCACCACCACCCTGAGCCTGG + Intergenic
1080387980 11:31820674-31820696 CCCCATCAGCCAGCAGAGGCTGG + Intronic
1080592682 11:33737048-33737070 CCCCAGCAGCCACCAGAGGCAGG + Intergenic
1081490024 11:43560308-43560330 CCTCAACAGCAAGCTGAAGGTGG - Intronic
1084218226 11:67663091-67663113 CAGCTCCAGCAACCTGAGGCTGG + Exonic
1085136786 11:74097520-74097542 CCCTAACAACTACCTGAGGTGGG - Intronic
1085709339 11:78814906-78814928 CCACTACACCAGCCTGAGGCAGG + Intronic
1087179550 11:95128385-95128407 CCCCAACAGCAACCTTGAGGAGG + Exonic
1087273993 11:96141902-96141924 TCACCACAGCAATCTGAGGCAGG + Intronic
1088722159 11:112603572-112603594 CCCCAAATCCAACCTGAAGCAGG - Intergenic
1088754922 11:112877857-112877879 GCCCAACAGCAATCAGAGCCGGG - Intergenic
1088828163 11:113513263-113513285 ACCCACCAGCAACCAGATGCCGG + Intergenic
1089662641 11:119995600-119995622 CACCACGAGCAACCTGAGGATGG + Intergenic
1089681500 11:120121446-120121468 CCCCAACTCCACCCTGAGCCTGG + Intronic
1090438219 11:126704429-126704451 CCCCTACAGCCAGCTGGGGCTGG - Intronic
1090529856 11:127579170-127579192 CCCCAAAAAGAATCTGAGGCAGG + Intergenic
1090967736 11:131613440-131613462 CCCCAGGAGCCACCTGAGGATGG - Intronic
1091487907 12:907506-907528 CTCCATCAGCAACGTGATGCTGG + Intronic
1091826151 12:3514367-3514389 CCCCAACAGCAATCTGGTGCTGG - Intronic
1093053628 12:14532855-14532877 CCCCTCCAGCATCCTGAGACTGG - Intronic
1097144239 12:56929142-56929164 CCCCCACAGCATCATGATGCAGG - Intronic
1098340462 12:69445456-69445478 CTCCAACAGCAACCTTAGAAGGG + Intergenic
1102244699 12:111347951-111347973 CCCCAACAGGAGAGTGAGGCCGG + Exonic
1102525394 12:113508989-113509011 CCCCAAAAGCAATTTGTGGCAGG + Intergenic
1103546079 12:121702663-121702685 ACTCATCAGCAACCGGAGGCTGG - Intergenic
1103548544 12:121719336-121719358 TCCCAACAGGAGGCTGAGGCAGG + Intronic
1103867545 12:124064748-124064770 ACCCAACAGCCCCCTGGGGCAGG - Intronic
1104932563 12:132347555-132347577 CACCAACAGCCACCTGACCCTGG + Intergenic
1104982283 12:132578840-132578862 GCCCAGCAGCCACATGAGGCTGG + Intronic
1107360998 13:39617868-39617890 CCACAACAGCCATGTGAGGCAGG + Intergenic
1108201558 13:48049348-48049370 CCCAAATAGGAAGCTGAGGCAGG - Intergenic
1108810002 13:54211098-54211120 CCCCAAGACCATCCTCAGGCTGG - Intergenic
1109651812 13:65336881-65336903 CCCCAAGAGAGGCCTGAGGCTGG + Intergenic
1119654431 14:76407043-76407065 TCCCAACAGCCACTGGAGGCAGG - Intronic
1120961465 14:90128895-90128917 CCCCACCGCCAACCTGAGGACGG + Intronic
1121738348 14:96234405-96234427 CCCCAGCAGGAGCCTGAGGGAGG - Intronic
1122375450 14:101254026-101254048 CCACAACAGGAACAAGAGGCTGG - Intergenic
1124566961 15:30824868-30824890 CCCCAACAGCAACCTTGAGGAGG + Intergenic
1125669780 15:41462462-41462484 CCCCAGGAGGAAGCTGAGGCAGG - Intronic
1125914668 15:43474894-43474916 CCCCAACAGCAACCTGAGGCTGG + Intronic
1126312147 15:47329687-47329709 ACCCAACTGGAATCTGAGGCAGG - Intronic
1128067758 15:64775301-64775323 CACCATGAGCAACCTGAAGCCGG - Exonic
1128283156 15:66414037-66414059 TCCTAACAGAGACCTGAGGCAGG - Intronic
1128961292 15:72007640-72007662 ATCCAATAGCAAACTGAGGCAGG + Intronic
1129891254 15:79073392-79073414 CCCCAACAGGGAAGTGAGGCGGG + Intronic
1130933539 15:88449717-88449739 ACCCAAGACCATCCTGAGGCAGG + Intergenic
1131098582 15:89671225-89671247 CCCAAACAGGAGCTTGAGGCGGG - Intronic
1132026091 15:98405531-98405553 CAGCAACAGCAGCCTGGGGCAGG - Intergenic
1132782396 16:1634768-1634790 GCCCAACAGGAGCATGAGGCTGG + Intronic
1133784691 16:8964484-8964506 CCTCAAGAGCAACCCCAGGCGGG + Intronic
1134038259 16:11048682-11048704 CCCCAGCAGCACCCTGTGCCAGG + Intronic
1135473676 16:22754583-22754605 CCCCAACAGCTACCAGGTGCCGG - Intergenic
1138741156 16:59312243-59312265 CTTCAACAGCAATATGAGGCAGG - Intergenic
1139430501 16:66908596-66908618 CCTGGACAGCATCCTGAGGCTGG + Intronic
1141545063 16:84761362-84761384 CCCCAAGACCACCCTGAGGTTGG + Intronic
1141686205 16:85571403-85571425 CCCCAACAGCCACGTGCGGATGG + Intergenic
1142469183 17:153214-153236 CCACAGCAGCCACCTGTGGCAGG + Intronic
1142639803 17:1279395-1279417 CTGCAACAGAAACCGGAGGCTGG + Intergenic
1143027745 17:3951058-3951080 CCCCTACAGAAGCCTGAGACAGG + Intronic
1144006599 17:11106038-11106060 GCTGAGCAGCAACCTGAGGCTGG - Intergenic
1145759868 17:27420010-27420032 GCCTAACAACAACCTCAGGCTGG - Intergenic
1145799180 17:27672341-27672363 GCCTAACAGCAACCTCAGGCTGG + Intergenic
1146159831 17:30553934-30553956 GCCTAACAACAACCTCAGGCTGG - Intergenic
1147171280 17:38620579-38620601 CCCCAAGTGTAACCAGAGGCAGG + Intergenic
1147511055 17:41069217-41069239 CCCCAGCAGCAACCTGTGCCTGG + Intergenic
1150135264 17:62691958-62691980 CCCCCACAGTAACCAGAGGTAGG + Intronic
1150135442 17:62692709-62692731 CCCCCACAGGAACCAGAGGTAGG + Exonic
1150248180 17:63691399-63691421 CTCCCACTGCAACCTGAGGCAGG - Intronic
1150363817 17:64562811-64562833 TCCCAACAACAGCCTCAGGCAGG - Exonic
1151077218 17:71287614-71287636 CCCCTTCCCCAACCTGAGGCTGG + Intergenic
1151977544 17:77491009-77491031 CCCCAGCAGCCACCTGGGCCAGG - Intronic
1153279366 18:3399742-3399764 CCCCAAAAGCACTTTGAGGCTGG + Intergenic
1155876831 18:31100103-31100125 CCACAACAGCCACGTGAGGTTGG + Intronic
1161080966 19:2309949-2309971 CCCCCACAGCATCCTGTGGGGGG - Intronic
1161767095 19:6213929-6213951 GCCCAACAGCAAGGTGAGCCTGG - Exonic
1162470659 19:10870841-10870863 CTCCAGGAGCAACCTGAGCCCGG - Intergenic
1163018256 19:14469903-14469925 CCCCAACAGGGACCTGAAGTTGG + Exonic
1166095682 19:40537599-40537621 CCCCAACAGCCCCATGAGGGAGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1168081241 19:54012086-54012108 CCCCAACAGCAGGATCAGGCCGG - Exonic
1168138746 19:54370220-54370242 CCAAAAAAGCAACCTGAGGGTGG + Intronic
1168159282 19:54498277-54498299 CCAAAAAAGCAACCTGAGGGTGG - Intronic
925230141 2:2225799-2225821 CCACAATAGCAATCTGAGGAGGG + Intronic
926337812 2:11877355-11877377 TCCCACCAGCAATGTGAGGCTGG - Intergenic
926786360 2:16522212-16522234 CCCCAGCACCCACCAGAGGCAGG - Intergenic
927587207 2:24318720-24318742 CCCTAACAGCAACTGTAGGCAGG + Intronic
928877425 2:36056534-36056556 CCACAACAGCAACTTAAGGGAGG - Intergenic
929374444 2:41268581-41268603 CCCCAACAGCAACACAAAGCTGG - Intergenic
932666704 2:73704120-73704142 CCTCAGCAGAAACCAGAGGCTGG + Intergenic
934618888 2:95792150-95792172 TCCCCACAGAAACCTGAGCCGGG - Intergenic
934642005 2:96032407-96032429 TCCCCACAGAAACCTGAGCCGGG + Intronic
935817712 2:106862775-106862797 CCCAGGCACCAACCTGAGGCAGG + Intronic
936008564 2:108910425-108910447 CCCCAGCACCAAGCTGAAGCTGG - Intronic
936073027 2:109384058-109384080 CACCAACAGAAACCTAAGGGTGG - Intronic
937280824 2:120716190-120716212 CCCCATCAGAAAACTGGGGCTGG - Intergenic
938188287 2:129252747-129252769 CCCCAAGACAAGCCTGAGGCTGG - Intergenic
938252381 2:129825963-129825985 CTCCAACACCAGCATGAGGCAGG + Intergenic
938846136 2:135211242-135211264 TCCAAAAAGAAACCTGAGGCTGG + Intronic
942550851 2:177117449-177117471 TCTCAACAGCCACATGAGGCTGG + Intergenic
942936363 2:181561468-181561490 CCCCAACTCCAACCTGACTCTGG + Intronic
945053528 2:205848378-205848400 CCCCAAAACCAACCTGATTCAGG + Intergenic
945330329 2:208531776-208531798 CCCTAAGAACAGCCTGAGGCAGG - Intronic
946189707 2:218001931-218001953 GCCCAACAGTAACCTCAGCCAGG + Intronic
948284389 2:236772533-236772555 CACCAACAGAAACCTTAGGATGG + Intergenic
1169280035 20:4259220-4259242 CCCCAACACCCACATCAGGCAGG - Intergenic
1172188814 20:33049250-33049272 CCCCATCAGCACACTGAGCCTGG - Intergenic
1172784000 20:37454070-37454092 CTCCCACTGCAGCCTGAGGCAGG - Intergenic
1172969706 20:38864629-38864651 CCCCCACTGCAACCAGAGGTCGG + Intronic
1175816111 20:61884006-61884028 CCCCAACAGCAGGCCGAGGGAGG + Intronic
1175895052 20:62332467-62332489 CCCCCACAGCACCCTGTGCCGGG - Exonic
1178499103 21:33110969-33110991 TCCCAACAGCTCCCTGAGGTTGG + Intergenic
1179128514 21:38613828-38613850 CCCCAATACCAACCACAGGCTGG + Intronic
1180126709 21:45796402-45796424 CCCAAAGAGGAAACTGAGGCAGG - Intronic
1180303234 22:11054006-11054028 GCCCGACAGCCTCCTGAGGCTGG - Intergenic
1180706815 22:17815325-17815347 CCACCACAGCAACGTGAGGGAGG + Intronic
1180725624 22:17944792-17944814 CTCCAACAGCTATCTGAGGGTGG + Intronic
1180967265 22:19797211-19797233 CCCCACCAGCTCCCTGAGCCTGG + Intronic
1182687314 22:32131207-32131229 ACCAAACAGCTGCCTGAGGCCGG + Intergenic
1183743439 22:39680414-39680436 GCCCTGCAGCCACCTGAGGCTGG - Intronic
1184031458 22:41897317-41897339 CCCAAACAGCACTCAGAGGCAGG + Intronic
1184501808 22:44879096-44879118 CCCCAACTGCCAGGTGAGGCTGG - Intergenic
1184568763 22:45309485-45309507 CCCCAACCCAGACCTGAGGCTGG - Exonic
1185334158 22:50264065-50264087 CCACAGCAGCTTCCTGAGGCTGG - Exonic
950146249 3:10651978-10652000 CCCAAACAGAAACCTGAACCTGG - Intronic
952284176 3:31952495-31952517 GCCCACCAGCAACTTGGGGCAGG + Intronic
953657160 3:44862750-44862772 CCCCTATAGCAAGCAGAGGCTGG - Intronic
953681503 3:45042163-45042185 CCACAACAGCAGCGTGAGGGAGG - Intergenic
953910091 3:46888427-46888449 CCACAACAGGAATCTGAGGGAGG - Intronic
954255961 3:49406520-49406542 TCCCAGCAGGAAGCTGAGGCGGG + Intronic
955356962 3:58238989-58239011 CCCCAACAGCCCCTTGAGGTAGG + Intronic
955840543 3:63108308-63108330 CCCCAACAGCAACCACGGTCTGG - Intergenic
962529742 3:136267781-136267803 CCTCAAAAGCCACCAGAGGCTGG - Intronic
965629216 3:170713620-170713642 CCCCAACAGCCCCATGAGGTAGG - Intronic
967267458 3:187702964-187702986 CCCCAGCAGCCACCTTAGCCTGG - Intronic
969487512 4:7480570-7480592 GGCCAACAGCAGCCTGAGGGTGG - Intronic
969592335 4:8129074-8129096 CCCATCCAGGAACCTGAGGCTGG + Intronic
970427897 4:15962693-15962715 CCCAACCAGCAGCCTGAGGCTGG - Exonic
971512914 4:27449159-27449181 CTCCAATAGAAACCTGTGGCGGG + Intergenic
971803694 4:31326978-31327000 CCACACCAGCAACCAGAGGTGGG - Intergenic
973552659 4:52051439-52051461 CCCCAGCAGCCGCCTGAGCCCGG - Exonic
975471351 4:74772689-74772711 CCGCATCTGCAACCTGAGGATGG + Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
979066897 4:116149192-116149214 CCCCATCAGGAGCCTGAGGTGGG - Intergenic
980111323 4:128640094-128640116 CCACAGCAGCAGGCTGAGGCAGG - Intergenic
981366157 4:143905869-143905891 CCACAACAGCTACCTCAGCCTGG - Intergenic
981376272 4:144019649-144019671 CCACAACAGCTACCTCAGCCTGG - Intergenic
981386784 4:144140997-144141019 CCACAACAGCTACCTCAGCCTGG - Intergenic
984875616 4:184364996-184365018 CCCCAGCAGTAACCTCAAGCGGG - Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
989202716 5:38781147-38781169 CCCCAAGAGCATCCAGAGGCAGG + Intergenic
997936853 5:138119790-138119812 TCCCAACTGAAAACTGAGGCTGG - Intronic
998106511 5:139472432-139472454 CACCCAAAGGAACCTGAGGCGGG - Intergenic
998734465 5:145120041-145120063 CCCTAAAAGCAACCTGAAGCTGG - Intergenic
1001318132 5:170658876-170658898 CCCCAACAGGAACCTGAGAATGG - Intronic
1001834477 5:174820101-174820123 CACCCACACCCACCTGAGGCAGG - Intergenic
1003133878 6:3418193-3418215 CCCCGGCAGCAACCTGGGGTCGG - Intronic
1009948154 6:70364152-70364174 CCCCAACAGCAACATCTGGGAGG + Intergenic
1010807724 6:80258634-80258656 CCACATCAGCAACCTGGGGCTGG - Intronic
1016803331 6:148188613-148188635 CACCAACAGCAACCTAACGCAGG + Intergenic
1017399416 6:154042124-154042146 CCCAAACACCCACCTGTGGCAGG + Intronic
1018354734 6:163000936-163000958 CCTCAGCAGCTATCTGAGGCTGG - Intronic
1018429668 6:163713298-163713320 AGCCCACAGAAACCTGAGGCTGG - Intergenic
1021847833 7:24779809-24779831 CACCAACAGCATCCCTAGGCTGG + Intergenic
1025150294 7:56541955-56541977 CCCCAAGCACCACCTGAGGCTGG - Intergenic
1028949654 7:96620272-96620294 TCTCAACAGCAGCCTGCGGCAGG + Intronic
1029443205 7:100599642-100599664 CCCCAACACCACCCTGAGGAAGG - Intronic
1030228200 7:107176135-107176157 CCTACTCAGCAACCTGAGGCAGG - Intronic
1030329791 7:108259037-108259059 GCCCAACAGCCACATGGGGCTGG + Intronic
1032504970 7:132427870-132427892 TCCCAACAACCCCCTGAGGCGGG - Intronic
1035568063 8:654865-654887 CCCCAGCAGGAACCTGAGGCGGG + Intronic
1037771654 8:21804577-21804599 CCCTAACAACAACCAGAGGTGGG + Intronic
1037862083 8:22412483-22412505 TCACAACATCATCCTGAGGCCGG - Intronic
1038751877 8:30303688-30303710 ACACAACTGCAAGCTGAGGCAGG - Intergenic
1041491534 8:58438358-58438380 CGCCACCAGCAACCTGAGCCTGG + Intronic
1041872307 8:62648833-62648855 CCCCAAGATGAACCTGAGGGAGG + Intronic
1042918891 8:73902178-73902200 CCAGACCAGCAACCTGGGGCAGG - Intergenic
1043858661 8:85290171-85290193 TCCCAACAGGAGGCTGAGGCAGG - Intergenic
1045039936 8:98213819-98213841 GCTCCACAGCAACCTGAAGCTGG - Intronic
1047190575 8:122675471-122675493 TCCCACCAGCAACCTGAGGAAGG + Intergenic
1048202076 8:132382940-132382962 TTCCAACAGCTCCCTGAGGCAGG - Intronic
1048344088 8:133563514-133563536 CCCCAAATCCAAACTGAGGCGGG + Intronic
1049761156 8:144332581-144332603 CCCCAGAAGCAACCCGAGGGAGG + Exonic
1049848733 8:144819477-144819499 CCCCAACAGTGGCCTGGGGCAGG - Intergenic
1050388278 9:5112196-5112218 CCCCACCAGCAGCATGGGGCCGG - Intronic
1051773102 9:20601057-20601079 CCCCTAGAGCAATCTGAGTCTGG - Intronic
1055776858 9:79775685-79775707 CACCAACTCCAACCTGATGCTGG - Intergenic
1056653416 9:88488702-88488724 CCCAACAAGCAACCTGAGGCTGG - Intergenic
1058668022 9:107338081-107338103 CTCCACCAGCAACCTGGGGCAGG - Intergenic
1059486860 9:114633773-114633795 CACCAACACGGACCTGAGGCTGG + Exonic
1060198110 9:121636202-121636224 CCCCAAAAGACATCTGAGGCTGG - Intronic
1061076652 9:128345458-128345480 CATCAACACCAACCTGCGGCGGG + Exonic
1061855764 9:133441244-133441266 CCCCTACAGCAGCCAGAGACAGG + Intronic
1062005862 9:134238103-134238125 CCCCAAAGGGAAACTGAGGCTGG - Intergenic
1062036956 9:134386658-134386680 CAGCAACAGCAAACTGAGGCTGG + Intronic
1062434997 9:136543124-136543146 CCCCAGCCCCAGCCTGAGGCCGG + Intronic
1062685765 9:137812392-137812414 CACCAACAACAACCTGAGTGTGG - Intronic
1187279959 X:17850618-17850640 CAGAAACAGCAACCTGAGGAAGG - Intronic
1193353812 X:80492896-80492918 CCAAAACAGCAACCTGGGACAGG - Intergenic
1194286694 X:92019950-92019972 ACCCAAGAGCCACATGAGGCAGG + Intronic
1194913283 X:99673539-99673561 TCCCAACAGCAAACTAATGCAGG + Intergenic
1195524008 X:105865011-105865033 CCCCAACAGGAGCCTGAAGGGGG - Intronic
1196465802 X:115970358-115970380 CCTCTACACCAACCTGAGGAGGG + Intergenic
1196483313 X:116176637-116176659 CCCCCACAGGAATCTGAGGATGG + Intergenic
1199301374 X:146218196-146218218 CCTCAACAGGAGGCTGAGGCAGG - Intergenic
1200533385 Y:4362723-4362745 ACCCAACTGCAACCTGACTCTGG + Intergenic
1200604240 Y:5244510-5244532 ACCCAAGAGCCACATGAGGCAGG + Intronic