ID: 1125916657

View in Genome Browser
Species Human (GRCh38)
Location 15:43493542-43493564
Sequence AAGAAGAAGCGGCTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125916653_1125916657 0 Left 1125916653 15:43493519-43493541 CCCAGCTTTCTCATAACAGGGCA 0: 1
1: 0
2: 3
3: 13
4: 193
Right 1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 267
1125916648_1125916657 28 Left 1125916648 15:43493491-43493513 CCCTCTTTCCTGGAAAAGGAGAG 0: 1
1: 0
2: 1
3: 34
4: 319
Right 1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 267
1125916649_1125916657 27 Left 1125916649 15:43493492-43493514 CCTCTTTCCTGGAAAAGGAGAGA 0: 1
1: 0
2: 3
3: 41
4: 520
Right 1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 267
1125916650_1125916657 20 Left 1125916650 15:43493499-43493521 CCTGGAAAAGGAGAGAGTTTCCC 0: 1
1: 0
2: 2
3: 23
4: 250
Right 1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 267
1125916654_1125916657 -1 Left 1125916654 15:43493520-43493542 CCAGCTTTCTCATAACAGGGCAA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125916657 Original CRISPR AAGAAGAAGCGGCTTGAGGA TGG Intronic
900754018 1:4421003-4421025 AAGAGGAAGTGGCTGGATGAGGG - Intergenic
901023032 1:6264658-6264680 GAGAAGAAGCGCTTTGAGGAAGG - Exonic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903790576 1:25890210-25890232 CAGAAGAAGGAGCTTGGGGAAGG + Intronic
904546820 1:31280808-31280830 AAGAAAAAGAGGCTTAAAGAAGG + Intronic
907925898 1:58954983-58955005 AAGGAGAGGAGGCTGGAGGAAGG - Intergenic
908356446 1:63328341-63328363 AGGAAGAAGCGGGATGAGAAAGG + Intergenic
908390927 1:63682893-63682915 AGGAAGCAGCTGCTTCAGGATGG - Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909362732 1:74782895-74782917 AAGAAGAAGCGGGAGGAGAAGGG - Intergenic
909714281 1:78689123-78689145 AAGAAAAAAAGGCATGAGGATGG - Intergenic
911768018 1:101702048-101702070 AATAAGAAGAGGCTAGAGGCCGG - Intergenic
912302050 1:108528197-108528219 AAGAAGCAGCAGCTTGATGCTGG - Intergenic
912550984 1:110485121-110485143 AGGAAGAAGAGGCGGGAGGAAGG - Intergenic
914887014 1:151593832-151593854 AAGCAGAAGCGGTTTGGGGAGGG + Intergenic
915470592 1:156123608-156123630 AAGAAGTAGTGCCTGGAGGAGGG - Intronic
915701233 1:157798577-157798599 CAGAACAAGCAACTTGAGGAAGG + Intronic
916875287 1:168962257-168962279 TAGAAGATGCAGTTTGAGGATGG + Intergenic
918582856 1:186152290-186152312 AAGGAAGAGGGGCTTGAGGACGG + Intronic
919240833 1:194914237-194914259 AAGAAGAAGCAGCTGGATGTTGG + Intergenic
920245648 1:204585669-204585691 AAGAAGAGGGGCCTGGAGGAGGG - Intergenic
921552638 1:216556661-216556683 AAGAAGATGTGACTTGAGGCTGG - Intronic
922995927 1:229961443-229961465 AAAAAGCAGGGGCTTGGGGAGGG + Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
1063649393 10:7918210-7918232 AAGGAGAAGGGGCGTGATGAAGG + Intronic
1065669133 10:28094634-28094656 AAAAAAAAGCGGGGTGAGGAGGG + Intronic
1067824837 10:49563316-49563338 ATAAAGAAGCCCCTTGAGGAGGG - Intergenic
1067831652 10:49614208-49614230 AAGAAGAGGGGGCTTGGGGGAGG + Exonic
1068004051 10:51371763-51371785 AAGAAGAAAGGGGTTGATGATGG - Intronic
1068594947 10:58892746-58892768 AAGCAGAAGCACCTTGAGGAAGG - Intergenic
1068877676 10:62014425-62014447 AAGAAGTAGCGGCTGAAGGTAGG + Intronic
1069824057 10:71244556-71244578 AAGAAGCAGGGGCCTGAGTAGGG - Intronic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1072627532 10:97122812-97122834 GAGAAGAAGCAGCTCTAGGACGG - Intronic
1073479687 10:103778716-103778738 AAGCAGAAAGGGCTGGAGGAGGG - Intronic
1073579418 10:104650728-104650750 AAGAACAAGTGTCTTGGGGATGG + Intronic
1073581996 10:104677096-104677118 CAGAATAAGCGGGTTGAGCAAGG + Intronic
1074065334 10:110008146-110008168 AAGGGGAGGGGGCTTGAGGAGGG - Exonic
1075040412 10:119103628-119103650 AAAAAGAGGCGTCCTGAGGATGG - Intergenic
1075764525 10:124882250-124882272 AAGAAGAAGCTGCTTAGGAAAGG - Intergenic
1076026842 10:127122484-127122506 AATGAGATGCTGCTTGAGGAAGG - Intronic
1077390942 11:2300389-2300411 AAGAGGAAGTGGCTTGTTGAGGG - Intronic
1078827839 11:14948175-14948197 CAGAAAAAGCTGCCTGAGGAGGG - Intronic
1078922813 11:15846066-15846088 AAGAAGAATGGAATTGAGGAGGG - Intergenic
1080395687 11:31887763-31887785 AAGTGGAAGAGGCTTAAGGAAGG - Intronic
1081565372 11:44257663-44257685 AAGACCAACAGGCTTGAGGAAGG - Intergenic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1083364223 11:62131656-62131678 CAAAAGAAGTGGCTTGATGATGG + Intronic
1083781312 11:64919354-64919376 AAGAAGAAACTGCTTGTGGAAGG + Intronic
1084010964 11:66347996-66348018 AAGAAGAAGCCGCGGAAGGAAGG - Exonic
1084050057 11:66593505-66593527 ATGAAGAAGGTGCTTGAAGAGGG + Intronic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1086500271 11:87445700-87445722 AAGGAGAAGGGACTTGAGGGGGG + Intergenic
1088346121 11:108827720-108827742 AAGAAGTTTCGGCTGGAGGATGG - Intronic
1088676458 11:112198334-112198356 AAGAAGAAGCCAGTGGAGGAAGG + Intronic
1089665452 11:120015060-120015082 AAGAAGAAGTGCCTTGAGAGGGG + Intergenic
1090865998 11:130701108-130701130 AAGAAGTAGCTTCTTGAGAAAGG + Intronic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091625876 12:2120440-2120462 AAAAAGCAGAGACTTGAGGATGG - Intronic
1092618420 12:10236548-10236570 AAGAAAAAGTGGATAGAGGAGGG + Intergenic
1093761802 12:22919382-22919404 AGGAATAAGTGACTTGAGGATGG + Intergenic
1093971782 12:25382564-25382586 GAGAAGAAGGGGCATGAGGACGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096231987 12:49901927-49901949 AAGAAGAAGGGCCTTCAGGGTGG + Intronic
1097114777 12:56689081-56689103 AAGAAGAAGCCGCTTAACGGTGG + Intergenic
1097119876 12:56723463-56723485 AAGTACAAGGGGCTTAAGGAAGG - Intronic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1098311257 12:69151403-69151425 AAGAGGAAACGGGTTGAAGAGGG + Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1101344961 12:103878500-103878522 GGGAAGAAGAGGCTTGAGGAGGG - Intergenic
1101551798 12:105770093-105770115 AACAAAAAGCAGCTTAAGGAGGG - Intergenic
1102188794 12:110970306-110970328 AAGAAGCAGCAGCTTCAGAAGGG + Intergenic
1102491525 12:113292256-113292278 AAGGAGAAGCCTCTGGAGGACGG - Intronic
1102753331 12:115315497-115315519 AAGATTAAGGGCCTTGAGGAGGG - Intergenic
1103126057 12:118423489-118423511 ATGAAAATGAGGCTTGAGGAGGG + Intergenic
1103345633 12:120248241-120248263 TAGAAGAGGGGGCTGGAGGATGG + Intronic
1108568846 13:51729520-51729542 GAGAAGAATGGGCTGGAGGAAGG - Intronic
1108758438 13:53532522-53532544 AAGAAGAAAAGGCTTGGGAATGG - Intergenic
1108813573 13:54262630-54262652 AAGAAGAAGCTTCCTAAGGAGGG + Intergenic
1109512314 13:63394331-63394353 AGGAAGAAGGGGATGGAGGAAGG + Intergenic
1113942916 13:114027938-114027960 AAGCAGAGGCGGCGTCAGGAGGG + Intronic
1118571838 14:67201876-67201898 TAGAAGAAGAGACTGGAGGATGG - Intronic
1119754188 14:77102792-77102814 AAGTAGATGAGGCTTGTGGATGG - Intronic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121510993 14:94513500-94513522 AAGATGAAGTAACTTGAGGAGGG - Intronic
1122662164 14:103303720-103303742 AAGAAGAAGCAGCTAGGGGAAGG + Intergenic
1122818118 14:104324042-104324064 CAGAAGAAGAGGCTTCCGGAAGG - Intergenic
1123573817 15:21644547-21644569 TAAAAGAAGCGGCTGGAGTATGG + Intergenic
1123610435 15:22087132-22087154 TAAAAGAAGCGGCTGGAGTATGG + Intergenic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG + Intronic
1125748220 15:42011761-42011783 AAGCAGAAGGGGTTGGAGGAAGG + Intronic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1127143910 15:56005604-56005626 GTGAAGAAGCAGCTTAAGGATGG + Intergenic
1127936449 15:63644159-63644181 AGGAAGAAGGAGCTTAAGGATGG - Intronic
1128339225 15:66808762-66808784 AAGAACAAGAAGCTGGAGGAAGG + Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1129877801 15:78988174-78988196 AAGAAACTGAGGCTTGAGGAGGG - Intronic
1130635844 15:85619170-85619192 AAGAAGAAGCGGGTTGGAAAAGG + Intronic
1135346691 16:21694725-21694747 AAGCAGATGGGGCTGGAGGATGG + Intronic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1137519211 16:49177852-49177874 AAAAACAACAGGCTTGAGGAGGG - Intergenic
1139490437 16:67283163-67283185 AGGCAGAAGAGGGTTGAGGATGG + Intronic
1141758308 16:86009851-86009873 AAGGAGAAGGGGCTTGGTGAAGG + Intergenic
1143180614 17:4981950-4981972 AAGAGAAAGGGGCTTGGGGATGG - Intronic
1143311315 17:5991768-5991790 ATGAAGAGGGGGCTTGTGGAGGG + Intronic
1146092355 17:29892449-29892471 AAGTAAAAGCTGCTAGAGGAAGG + Intronic
1146123961 17:30217699-30217721 TGGAAGAAGATGCTTGAGGAAGG - Intronic
1146234877 17:31149792-31149814 ATGAAGGAGGAGCTTGAGGAGGG + Intronic
1146475904 17:33162600-33162622 GAGGAGAAGTGGCTGGAGGAGGG - Intronic
1146716091 17:35088662-35088684 TAGAGGAGGCGGCTGGAGGAGGG - Intronic
1146726878 17:35163646-35163668 AAGAAGCTGAGGCTTGAGGAAGG + Intronic
1147636141 17:41965728-41965750 AAGAAGAAAGGGTTTCAGGAGGG + Intergenic
1150613123 17:66749362-66749384 AAGAGGAACTGGCCTGAGGATGG - Intronic
1152141020 17:78536794-78536816 GAGAAGAAGCTGCTTTGGGAAGG + Intronic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1155846790 18:30718277-30718299 AAGAAGAAGAGGCTGGAGACAGG - Intergenic
1157287741 18:46388663-46388685 ATGAAGAAGGGGCTTGGGGCTGG + Intronic
1157521134 18:48346400-48346422 TACAGGAAGCGGCTTGAGGCAGG - Intronic
1158349324 18:56549125-56549147 TAGGAGAAGCGGGTGGAGGATGG + Intergenic
1159168343 18:64730639-64730661 AGGAAGTATAGGCTTGAGGAAGG - Intergenic
1159258262 18:65976853-65976875 AAGAAGCAGCAGCTTGACGTTGG - Intergenic
1160393933 18:78558524-78558546 AAGACGAAGCAGCTACAGGAGGG - Intergenic
1161825261 19:6559552-6559574 AAGAATAACATGCTTGAGGAAGG + Intergenic
1162021943 19:7872115-7872137 GAGAAGGAGGGGCTAGAGGAAGG + Exonic
1162274929 19:9645516-9645538 TAGCAGAAGCCTCTTGAGGATGG + Intronic
1164149817 19:22541394-22541416 AAGAAGAGGAGGGTGGAGGAGGG - Intergenic
1166846578 19:45732138-45732160 AAGAAGAAGAAGCTCCAGGAGGG + Intergenic
1167666485 19:50825468-50825490 GAGGAGAAGCGGCTTGAAGCAGG - Intronic
1168643451 19:58044974-58044996 AAGAACAAGAAGCTGGAGGAAGG + Intronic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925287214 2:2723651-2723673 GAGAAGTTGCGGCTTGATGAGGG - Intergenic
927640321 2:24841659-24841681 AAGAGGATGCTGCATGAGGAAGG + Exonic
928584955 2:32750174-32750196 ATGAAGCAGGGGCTTGTGGAGGG + Intronic
928614404 2:33022251-33022273 AAAAAAAAGAGGATTGAGGAGGG - Intronic
930395392 2:50817027-50817049 AAGAAAAAGGGTCATGAGGAAGG + Intronic
931865785 2:66409651-66409673 AAAAAGAAGAGGGTAGAGGAAGG + Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934742422 2:96734447-96734469 AAGAAGAATCTGCATGGGGATGG - Exonic
935089213 2:99878144-99878166 AACAAGAAGCGGAAAGAGGAAGG + Intronic
937822478 2:126326392-126326414 AAGAAGAACAGGGCTGAGGAAGG - Intergenic
937884360 2:126889883-126889905 TAGAGGAAGCGGGTTCAGGATGG - Intergenic
939434169 2:142152652-142152674 AAGAAGAAGCGAAGGGAGGAAGG - Intergenic
939821901 2:146967826-146967848 AAGAATGAGAGGCTGGAGGATGG - Intergenic
940647477 2:156406794-156406816 AAGAAGAAAGAGCTTTAGGAAGG - Intergenic
943830984 2:192461603-192461625 AAGAAGATACTGCTTGAGGCTGG + Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
947956630 2:234197636-234197658 AAGAGGAAGGGACTTGAGGCTGG + Intergenic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
1169014490 20:2280558-2280580 AGGAAGAAGAGTTTTGAGGATGG + Intergenic
1170727899 20:18946378-18946400 AAAAAGAACCTGCTTGAGAATGG + Intergenic
1173730674 20:45326244-45326266 AAGAGGAAGCAGCTTCAGAAAGG + Exonic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1175019268 20:55827038-55827060 CAGAAGAAGGGGTTAGAGGAAGG - Intergenic
1175182485 20:57158467-57158489 AAAAGGAAGTGGCTTTAGGAAGG - Intergenic
1175311922 20:58018305-58018327 CGGAAGGAGAGGCTTGAGGAAGG - Intergenic
1175391019 20:58627466-58627488 AAGTGGAAGCGGCTTGAGCAAGG - Intergenic
1176242632 20:64082221-64082243 AGGGAGAAGGGGCTTGAGCAGGG - Intronic
1176658980 21:9616060-9616082 AAAAACAAGCACCTTGAGGATGG - Intergenic
1177788973 21:25701360-25701382 AAGAAGAAAGGGCTGGAGGGAGG - Intronic
1178576069 21:33792853-33792875 AGGAAGAAGGGGCTTCAGTAGGG - Intronic
1179541016 21:42083326-42083348 GAGAAGAAGAAGCTTCAGGAAGG - Intronic
1180671289 22:17555550-17555572 AAGAAGATCCTGCTTGGGGATGG - Intronic
1181558463 22:23685645-23685667 AAGAAGATGCGGCCTCAGTAGGG + Intergenic
1182522419 22:30892002-30892024 AAGAAGCAGCAGCTGGAGGGCGG + Intronic
1183299545 22:37052076-37052098 GGGAAGAAGCGGCAGGAGGAGGG + Intronic
1183330804 22:37220241-37220263 TGGAAGGAGCGGCTTGAGCAAGG + Intergenic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953169613 3:40495425-40495447 AAGAAGGAGAGGAGTGAGGAGGG - Intergenic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954894341 3:53963311-53963333 CAGCAGAAGAGGCTGGAGGAAGG + Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
959066844 3:101666109-101666131 AAGAAACAGCTGCTGGAGGATGG + Intronic
962681081 3:137801070-137801092 AAGAGGAAGAGGGTTGGGGAAGG + Intergenic
964337010 3:155665620-155665642 AGGAAGAAGAGGCTGGAGGCAGG + Intronic
964421861 3:156511696-156511718 AAGTAGAAAGAGCTTGAGGAAGG - Intronic
965734581 3:171807421-171807443 AAGATGAAGAGTCTTGTGGATGG + Intronic
968669522 4:1841531-1841553 AAGAACAAGAAGCTGGAGGAAGG - Exonic
969156964 4:5219415-5219437 AAAGAGAAGAGCCTTGAGGAAGG + Intronic
970652664 4:18195733-18195755 TAGAAGAAGCTGCTTTAAGAAGG - Intergenic
972885516 4:43481316-43481338 AAGAAGAAGCAGCTTGAGATAGG + Intergenic
973972293 4:56225496-56225518 AAGAAGAAACGGGTTCAGGGAGG - Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
976220752 4:82755108-82755130 AAGAAGATGGGGGGTGAGGATGG + Intronic
976361948 4:84190118-84190140 GAGGAGATGGGGCTTGAGGAAGG + Intergenic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978191693 4:105921295-105921317 AAGAAGTAGTGGATTGAGCATGG + Intronic
978214063 4:106176322-106176344 AAGAAGAATGGGCTGGGGGATGG - Intronic
978686848 4:111455427-111455449 AAGAAGATGCAGCTGGAAGATGG + Intergenic
981643351 4:146969990-146970012 AAGTGGAAGAGGCATGAGGAGGG + Intergenic
981736753 4:147961667-147961689 AAGAGGAAGCTGCTGGAGAAGGG - Intronic
983689871 4:170455521-170455543 AAGAAGAAGAGGGTAGAGAAAGG - Intergenic
984034553 4:174649258-174649280 AAACAGAAGCTGCTTGAGCAGGG + Intronic
985416346 4:189739373-189739395 AAAAACAAGCACCTTGAGGATGG + Intergenic
986342279 5:6800977-6800999 TAGAAGACGCCGCTAGAGGAAGG - Intergenic
986662111 5:10068504-10068526 AGGAAGAAGGGACTGGAGGATGG - Intergenic
986814573 5:11394398-11394420 AAGAAGAAGGGGTCTGTGGAGGG + Intronic
986927960 5:12781852-12781874 AAGGAGAAGTGGCCTGAGGTAGG - Intergenic
987611599 5:20211534-20211556 AAGACGAAGCTTCTAGAGGAAGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
992154768 5:73944439-73944461 AAGAAGAAGATGCTTGAGGCTGG + Intergenic
992616000 5:78547025-78547047 AAAAAGTAGGGGGTTGAGGAGGG + Intronic
995480454 5:112587090-112587112 GAGACGAAGCTTCTTGAGGAAGG + Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
996624434 5:125553017-125553039 AAGAAGGAGCAGCTAGAAGAGGG - Intergenic
998644688 5:144048861-144048883 AAGATGAAGCTTCTGGAGGAAGG + Intergenic
998678272 5:144434968-144434990 AAGAGGAAGGCGCATGAGGAAGG + Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000632245 5:163604055-163604077 AATATGAAGGGGATTGAGGAGGG + Intergenic
1001667375 5:173444573-173444595 GAGAAGAAGAGACCTGAGGAGGG + Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1002633721 5:180596875-180596897 AAGAGGACGCGGGCTGAGGAGGG - Intergenic
1002660440 5:180787900-180787922 AAGGCCAAGAGGCTTGAGGAGGG + Intergenic
1002781144 6:367228-367250 ACAAAGAAGAGGGTTGAGGAGGG - Intergenic
1004431701 6:15550872-15550894 AGGAAGATGCTGCATGAGGAAGG + Intronic
1004436429 6:15599352-15599374 AGGAAAATGGGGCTTGAGGATGG + Intronic
1005287178 6:24340371-24340393 AAGAAGTACCGGCTAGCGGAAGG + Intronic
1006339003 6:33435702-33435724 AAGGAGGAGAGGCTTGGGGAAGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1009352614 6:62701196-62701218 AATAAGATGAGGGTTGAGGAGGG + Intergenic
1012053057 6:94368202-94368224 AGGAAGAAATGGCCTGAGGATGG - Intergenic
1014255835 6:119159483-119159505 AAGCAGAACAGGCTTCAGGATGG + Intergenic
1015134340 6:129850911-129850933 GAGAAGATGAGGCTGGAGGACGG - Intronic
1015885129 6:137910081-137910103 AAGAAGAAAAGAATTGAGGAAGG - Intergenic
1016215727 6:141599930-141599952 AAGAAGACGCTCCTTCAGGAGGG + Intergenic
1018856641 6:167679704-167679726 AAGAAGAGACTGCTTGAGGATGG + Intergenic
1019157831 6:170050908-170050930 AGGAAGGAGAGACTTGAGGAGGG - Intergenic
1021316106 7:19149143-19149165 AAGAGGAAGGGACATGAGGAAGG - Intergenic
1023318308 7:38964994-38965016 AATAAGCAGGGGCTGGAGGAGGG - Intergenic
1023862695 7:44225629-44225651 CAGGAGCAGCGGCTCGAGGAGGG - Intronic
1024270402 7:47637143-47637165 AAAATGCAGCGGCTGGAGGAGGG - Intergenic
1029156291 7:98520430-98520452 GAGAAGAGGCGCCTTGAGGGTGG + Intergenic
1029870963 7:103692424-103692446 AAGAAGAAGAGGCAAGAGGCAGG - Intronic
1030114982 7:106056056-106056078 AGGAAGAAGCAACTTGAGGCCGG + Intergenic
1030403405 7:109081046-109081068 AGGAAGAAGAGGTGTGAGGAGGG + Intergenic
1031682919 7:124696462-124696484 AAGAAGAAACTGCTAGAGAATGG + Intergenic
1031869436 7:127076072-127076094 AAGAAGAAGAAACTTGAGAAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033056594 7:138060554-138060576 AGGAAGAAGCAGCTGCAGGATGG - Intronic
1035110283 7:156475950-156475972 AGGAAGGAGCTGCTTGAGCATGG - Intergenic
1035546007 8:483002-483024 AAGAAGAAGCCTCTTGGGGGTGG + Intergenic
1036047564 8:5160703-5160725 AAAAATAAGAGACTTGAGGAAGG - Intergenic
1037250102 8:16882077-16882099 AAGAAAAAGGGGGTAGAGGAGGG + Intergenic
1038293966 8:26274039-26274061 AAGAAGAGGTGGCAGGAGGAAGG - Intergenic
1038444181 8:27592299-27592321 GAAAGGAAGCGGCCTGAGGACGG - Intergenic
1041130269 8:54691610-54691632 GAGAAGAAGAGGCATGAGAACGG + Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1043745834 8:83872284-83872306 TAGAAGAAGCAGCTTTAGGACGG - Intergenic
1045173478 8:99696248-99696270 AAGAACAAGAAGCTTGAGGAAGG + Intronic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1046741037 8:117829306-117829328 AAAAAAAAGCAACTTGAGGACGG + Intronic
1048258194 8:132922272-132922294 AAGAAGAAACAGCTTGAACATGG + Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1053457794 9:38244326-38244348 AAAAACAAGAGGGTTGAGGAGGG + Intergenic
1053569322 9:39288023-39288045 AAGCAGCAGCACCTTGAGGACGG + Exonic
1053835279 9:42129053-42129075 AAGCAGCAGCACCTTGAGGACGG + Exonic
1054090954 9:60847007-60847029 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054112365 9:61122563-61122585 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054127820 9:61330987-61331009 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054595345 9:67059578-67059600 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054936952 9:70698250-70698272 ATGGAGAATCGGCTTGAAGAAGG - Intronic
1055152865 9:73024204-73024226 AAAAACAAGAGGCTTGAGGCAGG + Intronic
1055433958 9:76273435-76273457 AAGAAGAAACACCTTGAGAAGGG - Intronic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1057454092 9:95191651-95191673 ATGAAAAAGGGGCTTGGGGATGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1060078836 9:120621819-120621841 AAGGTGAGGCGGCTTGAGGGTGG + Intronic
1060290795 9:122300689-122300711 AAGAACATGGGGCTTCAGGAAGG - Intronic
1061059878 9:128245017-128245039 GAGAAGGAGGGGCCTGAGGAGGG + Intronic
1061779390 9:132986856-132986878 AAGAAGAGGCTGCTGCAGGAGGG - Intronic
1203793992 EBV:166437-166459 ACGAAGAAGCGGGCAGAGGAAGG + Intergenic
1203636725 Un_KI270750v1:119668-119690 AAAAACAAGCAGCTTGAGGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189947082 X:46190468-46190490 GAGAAGAAGGGGGATGAGGAGGG - Intergenic
1192430949 X:71111259-71111281 AAGAAGAAGTAGCGTGAGGCAGG + Intronic
1192523011 X:71817447-71817469 AAGAAGAAGCTTCTAGAGGAAGG + Intergenic
1195315338 X:103672152-103672174 AAGTAGAAGCTGCTTGAAGCCGG + Intergenic
1195491803 X:105479214-105479236 AAGAAGAAGCTGCTTGACTTTGG + Intronic
1196102812 X:111865315-111865337 AAAAAGAAGCTGCTAGAGGCCGG - Intronic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1199601697 X:149544976-149544998 TAGGGGAAGGGGCTTGAGGAAGG + Intronic
1201638574 Y:16153525-16153547 AAGAGGAAGGGGCTTGAGGTAGG + Intergenic