ID: 1125920537

View in Genome Browser
Species Human (GRCh38)
Location 15:43522979-43523001
Sequence CCTTCTGGGCTGGGGGTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 400}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125920537_1125920547 6 Left 1125920537 15:43522979-43523001 CCAGACACCCCCAGCCCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 400
Right 1125920547 15:43523008-43523030 TACCACTCCCAACCATCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 98
1125920537_1125920551 13 Left 1125920537 15:43522979-43523001 CCAGACACCCCCAGCCCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 400
Right 1125920551 15:43523015-43523037 CCCAACCATCAGTGGGCACAGGG 0: 1
1: 0
2: 0
3: 9
4: 185
1125920537_1125920549 12 Left 1125920537 15:43522979-43523001 CCAGACACCCCCAGCCCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 400
Right 1125920549 15:43523014-43523036 TCCCAACCATCAGTGGGCACAGG 0: 1
1: 0
2: 1
3: 18
4: 187
1125920537_1125920546 5 Left 1125920537 15:43522979-43523001 CCAGACACCCCCAGCCCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 400
Right 1125920546 15:43523007-43523029 GTACCACTCCCAACCATCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 94
1125920537_1125920554 19 Left 1125920537 15:43522979-43523001 CCAGACACCCCCAGCCCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 400
Right 1125920554 15:43523021-43523043 CATCAGTGGGCACAGGGAGCTGG 0: 1
1: 0
2: 0
3: 45
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125920537 Original CRISPR CCTTCTGGGCTGGGGGTGTC TGG (reversed) Exonic
900252025 1:1675845-1675867 CTTTCCGGGCTGGTGGTCTCAGG - Intronic
900262436 1:1738703-1738725 CTTTCCGGGCTGGTGGTCTCAGG - Intronic
900311017 1:2033164-2033186 TCTGCTGGGATGGGGGTGTACGG - Intergenic
900390297 1:2430920-2430942 CCTGCTGCACTGGGGGGGTCTGG + Intronic
900528443 1:3140762-3140784 CCTCATGGGCTGTGGGGGTCTGG - Intronic
900718104 1:4157958-4157980 CCTTATGGGATGGGGGTCCCAGG - Intergenic
900761220 1:4472397-4472419 CTTCCTGGCCTGGGGGTCTCAGG + Intergenic
901514880 1:9738392-9738414 CCTTTTGGGCTGCGGCTGTGCGG + Intronic
901830091 1:11886985-11887007 CCATCTGGGCTGGGGATACCAGG + Intergenic
902067443 1:13700142-13700164 CCTGCGGGGCTGGGGGGCTCCGG - Intergenic
903128989 1:21266168-21266190 GCTGCTGGGATAGGGGTGTCTGG + Intronic
903129000 1:21266204-21266226 GCTGCTGGGATAGGGGTGTCTGG + Intronic
903129011 1:21266240-21266262 GCTGCTGGGATAGGGGTGTCTGG + Intronic
903164964 1:21513950-21513972 CCTTCTGAGCTTGCGGTTTCTGG + Intronic
903210023 1:21812639-21812661 CCTTTTGAGCTGGGGGAGGCTGG + Intronic
903214638 1:21836967-21836989 CCTGCTGGGATGGAGGTGGCAGG + Exonic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
904495148 1:30882385-30882407 CCTTCTGGGCTGGGAGCCTGAGG - Intronic
904659486 1:32073684-32073706 GCTTCTGGTCTGGGGGTTTATGG + Intronic
904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG + Intergenic
904774040 1:32895877-32895899 CCTCCTGGGATGGGGCTGTGAGG - Intronic
905354546 1:37372296-37372318 TCCTCTGGGCTTGGAGTGTCAGG - Intergenic
905878365 1:41447967-41447989 CCATCTGGGCAGGGAGTGTCTGG + Intergenic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906196166 1:43931965-43931987 CCTCCTGGGCTAGGGGGGTAAGG + Intergenic
906367117 1:45219826-45219848 ACCTCTGGTCTGGGGGTGCCAGG + Intronic
906774407 1:48515969-48515991 CTTTTTGAGCTGAGGGTGTCTGG + Intergenic
907679845 1:56552903-56552925 AGTCCTGGGCTGGGGGTCTCAGG + Intronic
908640585 1:66218603-66218625 TCTTCTGGGCTGGGGGTGGCTGG - Intronic
910827166 1:91421604-91421626 CAATCTGGGCTGGGGGTGGGGGG - Intergenic
911027271 1:93448469-93448491 CCTTCTCGGCCGGGGGTCTAGGG + Intronic
911089638 1:94008269-94008291 ACTGCTGGGCTGGAGGTGCCTGG + Exonic
912519025 1:110232830-110232852 CCTTCTGGGGTTGGGGGGACAGG - Exonic
912553692 1:110500695-110500717 CCACATGGGCAGGGGGTGTCTGG + Intergenic
912554079 1:110503654-110503676 CCTCCTGGGGTGCCGGTGTCTGG + Intergenic
915019938 1:152769640-152769662 TCTTCTGGGGTGTGGGAGTCAGG + Intronic
915111844 1:153568875-153568897 GCTTCTGGGCAGGGACTGTCCGG - Intergenic
915349891 1:155217735-155217757 AATTCTGGGCAGGGGGTGACAGG + Intergenic
916717386 1:167456660-167456682 CCTTCTGGGTTGGATGGGTCTGG + Intronic
917024928 1:170631437-170631459 CATTCTGGGGTGGGGGTGCTAGG + Intergenic
917439635 1:175055655-175055677 CCTTCTAGGCTGGGGATGATGGG - Intergenic
917928865 1:179810276-179810298 GCTTCAGGGCTGGGGCAGTCAGG + Intronic
920046441 1:203135914-203135936 CCTTCTGGGCTGGGTTGGGCAGG + Intronic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
921391107 1:214614605-214614627 CTTTCTAGGATGGGTGTGTCTGG + Intronic
921620971 1:217325865-217325887 CCTTCTGGGCTAAGGCTGACTGG - Intergenic
921713378 1:218394987-218395009 CCTTCAAAGCTGGGGATGTCAGG + Intronic
922501031 1:226096993-226097015 CTGTGTGGGGTGGGGGTGTCGGG + Intergenic
922603971 1:226877535-226877557 CCTGGTGGGGTGGGGGTGACAGG - Intronic
924584482 1:245350117-245350139 ACTGCTGGGCTGGAGTTGTCCGG + Intronic
924706757 1:246508606-246508628 GTTTCAGGGCTGGGGGTGTTGGG + Intergenic
1065302755 10:24338373-24338395 CCTTCAGGACTGGGGGTCTAGGG - Intronic
1069630414 10:69894124-69894146 ACTTCTGGCCTGGGGGTGCTGGG - Intronic
1069656666 10:70094842-70094864 GATTCTGACCTGGGGGTGTCTGG - Intronic
1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG + Intergenic
1070385209 10:75918010-75918032 CTTTCAGCTCTGGGGGTGTCAGG - Intronic
1070829548 10:79410009-79410031 CCCTCTGAGCTGGAGCTGTCAGG + Intronic
1071456514 10:85855402-85855424 CCTTCTGGGCCAGGTGTTTCTGG - Intronic
1071728019 10:88218962-88218984 CCTTGAGAGCTGGGGATGTCTGG - Intergenic
1072215669 10:93285434-93285456 GTGTCTGGGCTGGGGGTGTTGGG + Intergenic
1073043461 10:100622533-100622555 CTTTGTGTGCTGGGAGTGTCAGG + Intergenic
1073179920 10:101577554-101577576 CCTCCAGGGCTGGGGGTGGAGGG - Intronic
1074121324 10:110496342-110496364 CCCTCTGGGCTGGGGGCAGCTGG + Intergenic
1076405306 10:130208214-130208236 GTTTCTGGGCTGGGGGTGCACGG + Intergenic
1076634569 10:131873960-131873982 CCTTCTGGGGTGGGCGTGGTTGG - Intergenic
1076664298 10:132077284-132077306 GGTTCTGGGCAGGGGGTGTCCGG + Intergenic
1076719472 10:132386932-132386954 CCTGGTGGATTGGGGGTGTCTGG + Intergenic
1076946841 10:133657370-133657392 CCATCTGGGCTGGGGCTGTTGGG - Intergenic
1077240850 11:1509776-1509798 GCTTCTCGGCTGGGGGTGCCTGG - Intergenic
1077279020 11:1733608-1733630 CCTTCTGGGCTGGAGACGTGGGG - Exonic
1077836869 11:5933792-5933814 CCATCTTGGCTGGGGGAGTCAGG - Intronic
1078260422 11:9701494-9701516 CCTTCTTGGCTGGGCGTGTTAGG + Intronic
1078408390 11:11091397-11091419 GTTTCTGGGTTGGGGGTTTCAGG - Intergenic
1078476172 11:11632435-11632457 CCTTCACAGCTGGGGGCGTCGGG - Intergenic
1081622338 11:44625987-44626009 CCTTGTGGGTAGGGGGTGCCTGG - Intergenic
1081672548 11:44950068-44950090 CCTTCTGGGGTGGGGGCCTGGGG - Exonic
1082783056 11:57301806-57301828 CCTTCAGGGCTGAGGGGCTCAGG + Exonic
1083333554 11:61910364-61910386 CCTTCTGGAAAGGGGGTTTCTGG - Intronic
1083414610 11:62517486-62517508 GCTCCTGGGCTGAGTGTGTCTGG - Exonic
1083611755 11:64007728-64007750 CCCTCTGGCGTGGGGCTGTCTGG - Intronic
1083865098 11:65449324-65449346 CCTTTTGGGCTGAGGGAGTGAGG - Intergenic
1083923671 11:65793519-65793541 CCTGCTGGGGTGGGGGTGGGAGG + Intronic
1084714259 11:70863659-70863681 CATCCTGGGCTGGGGGTATGGGG + Intronic
1084919914 11:72460740-72460762 CCGTCTGGGCTGGCAGTGTCAGG - Intergenic
1085127540 11:74011869-74011891 CCATGTGGGCTGGGGCAGTCAGG - Intergenic
1085308790 11:75503878-75503900 CATTCAGGGCTGGGGGAGGCAGG - Intronic
1086888144 11:92226395-92226417 TCTTGTGGGCGGGGGGTGGCGGG + Intergenic
1087297215 11:96390491-96390513 CCTCCCGGGCTGGGGTTGGCTGG - Exonic
1088261506 11:107948495-107948517 CCCTCTCGGCTGGGGGTGGTCGG - Intronic
1088406719 11:109489324-109489346 CCTTATGGGCTTGGGGTGATTGG - Intergenic
1088893783 11:114063243-114063265 CCTTCTGGGCTCTGCGTGGCGGG - Exonic
1089130083 11:116205401-116205423 CCTTCTGGGTTTGGGGTATCTGG + Intergenic
1090416360 11:126543303-126543325 CCTCCTAGGCTGGGCGTCTCCGG - Intronic
1090643695 11:128750248-128750270 CCAGCTTGGCTGGAGGTGTCTGG - Intronic
1090847898 11:130546140-130546162 GATTCTGGGCTTGGGGTGTGGGG - Intergenic
1095089049 12:38087191-38087213 CCACCTGGGCTGGGGCTGTAGGG + Intergenic
1096469590 12:51867985-51868007 GCTTCTGGGCTGGGGTTGGAGGG - Intergenic
1097064489 12:56310870-56310892 GTTTCTGGGATGGGGGTGTATGG + Intronic
1097196136 12:57243336-57243358 CCATCTGGGCTGAGGTTGGCGGG - Intergenic
1098387549 12:69934921-69934943 CACTCTGGGCTGTGGGTTTCAGG + Intronic
1098904070 12:76143790-76143812 CCTTCTGGCCTGTGGCTTTCTGG - Intergenic
1098943002 12:76559299-76559321 CGTTCTGAGCTCGGGCTGTCGGG - Intronic
1100496082 12:95126284-95126306 CCTTCTGGCCTGTGGCTTTCTGG - Intronic
1101708569 12:107243585-107243607 CCAGCTGGGCTGGGAGTGTCGGG - Intergenic
1102722404 12:115028676-115028698 CCTGCCTGGCTGAGGGTGTCAGG + Intergenic
1103604533 12:122077392-122077414 CAGTCTGGGGTGGGGGTGGCAGG - Intergenic
1103702624 12:122855629-122855651 CCGACTGGGCTGGGGGTGGTTGG + Intronic
1103912922 12:124362129-124362151 CCTTGTCGGCGGGGGGTGCCGGG + Exonic
1104775948 12:131390172-131390194 CCCTCTGGCCTGGGGGTTGCAGG + Intergenic
1104977711 12:132559723-132559745 CCTTCTGGGAGCGGGGTGGCAGG + Intronic
1105824670 13:24111408-24111430 GTTTCTGGGGTGGGGGTGGCGGG - Intronic
1108699339 13:52930502-52930524 CCTTCTGGGGTGGAGGTGGAGGG + Intergenic
1112576885 13:100644071-100644093 CGTTCTGGCCTGGGGGTGGGAGG + Intronic
1112620755 13:101051667-101051689 TCTTGTGGGCTGGGGGTATCTGG + Intergenic
1113904735 13:113813916-113813938 CCTCCAGGGCTGTGGGTGCCTGG + Exonic
1114374831 14:22133010-22133032 ACTTCTGTGCTGTGGGTGACAGG + Intergenic
1116425616 14:44786776-44786798 CCTTAGTGGCTGAGGGTGTCAGG - Intergenic
1117992088 14:61443943-61443965 CCTTCTGAGATGGGTGTGTGAGG - Intronic
1118718392 14:68576394-68576416 TCCTCTGGGTTGGGGGTGGCAGG - Intronic
1118726186 14:68630622-68630644 CCATCTGGGCAGGAGGTGCCAGG + Intronic
1119236499 14:73024478-73024500 CCTTCTCTGCTGGGGAAGTCTGG + Exonic
1119442877 14:74640554-74640576 CCTTGTGTGCTGGGGGAGTTGGG + Intergenic
1121123850 14:91393337-91393359 CCTGCAGGGCTGGGGGTTTAGGG - Intronic
1121181308 14:91931184-91931206 CCTTCTGGGGTGGAGGGGACTGG - Intronic
1121248733 14:92483845-92483867 CCTTCTCTGCTGCTGGTGTCAGG - Intronic
1121929632 14:97960625-97960647 CCTTCTGCGCTTGGGCTGCCAGG + Intronic
1122198967 14:100110519-100110541 CCTGCAGGGCTGGGGGTGAATGG + Intronic
1122622883 14:103069902-103069924 CCTTCTGGTCTAGGGGCGACAGG + Intergenic
1122847046 14:104505825-104505847 CCTGCTGGGCTGGGGGGCTGGGG + Intronic
1122970732 14:105151169-105151191 GCTGCTGGGCTGCGGGTGCCAGG - Intronic
1122984907 14:105207564-105207586 CCTTCCGGGCTGGGCCTGCCAGG - Intergenic
1202920918 14_KI270723v1_random:29925-29947 CCATCTGGGCTGGGGCTGTTGGG - Intergenic
1202923997 14_KI270724v1_random:7656-7678 CCTTCTGGGCTGGGGCTGTTGGG + Intergenic
1123626096 15:22227761-22227783 CCTGAGGGCCTGGGGGTGTCAGG + Intergenic
1124625596 15:31306057-31306079 CCATCTGGGCTGGTGGGGTGGGG + Intergenic
1125518871 15:40337503-40337525 GCTTCGGGGAGGGGGGTGTCAGG - Intronic
1125920537 15:43522979-43523001 CCTTCTGGGCTGGGGGTGTCTGG - Exonic
1127913984 15:63440470-63440492 CTTTCTGGGCTGGTGGTGGGTGG - Intergenic
1128842436 15:70860922-70860944 CCTTCTGGGTTGTGTGTCTCTGG + Intronic
1129301322 15:74627228-74627250 CCTGCTGAGGTGGGGGTGTGAGG + Intronic
1129392214 15:75226146-75226168 ACTTCAGGGCTGGGGGTGCCTGG + Intergenic
1129682774 15:77667322-77667344 CCTTCTAGGCTGTGGGTGCTCGG + Intronic
1129868465 15:78926097-78926119 GCTTCTGGGTTGGGGGTGGCTGG + Intronic
1130933371 15:88448816-88448838 ATTTCTGGGGTGGGGGTGTTGGG - Intergenic
1131110047 15:89759233-89759255 CCTTCTGGGCTGAGCATGTGCGG + Intergenic
1131228726 15:90645631-90645653 CCTGCTGGGATGGGGGTCTGGGG - Intergenic
1132244471 15:100283758-100283780 CCCTCTGGTCTGGGAGTGACAGG - Intronic
1132409335 15:101564878-101564900 CCTTCTGGGCTGTGGTCATCAGG - Intergenic
1132553982 16:564729-564751 CCCTCAGGGCCGGGGGTCTCAGG - Exonic
1132833721 16:1942398-1942420 CCTTCTGGGCTGGGCTCGCCTGG - Intronic
1132888799 16:2194387-2194409 CCTTCAGGGCAGGGCGAGTCGGG + Intronic
1133924072 16:10180348-10180370 CCTTCTGGTCTGGCGCGGTCCGG - Exonic
1133978902 16:10619293-10619315 CCTTCTGGGCTGGAGGAGGTGGG - Intergenic
1134211312 16:12279768-12279790 TCTCCTGGGATGGGGATGTCTGG + Intronic
1135993671 16:27232573-27232595 CCTTCGGGGCTGGGTGTGTCAGG - Intronic
1136373190 16:29848757-29848779 CCTTCCCAGGTGGGGGTGTCAGG + Intergenic
1136535367 16:30896386-30896408 ACCTCGGGGCTGGGGGTGTCAGG - Intergenic
1137062386 16:35803047-35803069 CTTTCTAGGCTTGGGCTGTCTGG + Intergenic
1137893564 16:52186978-52187000 CCTTCTGGGCTAGTGGTTTCTGG - Intergenic
1139505565 16:67396557-67396579 CCTGCTGGGGTGGGGGTGGGTGG + Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1140475262 16:75236778-75236800 TCTGCAGGGCTGGGGGTGGCGGG - Intronic
1141373837 16:83511818-83511840 CCTTATGTGCTATGGGTGTCGGG - Intronic
1141555398 16:84833849-84833871 GCTGCTGGGCTGGGGGAGTCAGG - Intronic
1141622110 16:85241871-85241893 CAGTGTGGGCTGGGGGTGCCCGG - Intergenic
1141792102 16:86243829-86243851 CCTGCTGGGCTGGGGATGGCAGG + Intergenic
1141996767 16:87640986-87641008 CCTTCCAGGCTGGGGTTGTGAGG - Intronic
1142177345 16:88651218-88651240 CCGCCTGGGCTGGGGCTGCCGGG - Intergenic
1142426683 16:90005376-90005398 CCCTCTGCTCTGGGGGTGTCTGG - Exonic
1142755692 17:2015226-2015248 GCTCTTGGGCTGGGGGTGGCTGG + Intronic
1142871162 17:2821956-2821978 CCTTCTGGCCTGGGGGTCCAGGG - Intronic
1142965420 17:3577810-3577832 CCTTTTGTTCTGGGGGTGCCAGG - Intronic
1143487308 17:7261980-7262002 CCTGCTGGGCTGGGTGGGTCTGG - Exonic
1144638739 17:16926350-16926372 ACCCCTGGGCTGGGGGTGCCGGG + Intergenic
1144768410 17:17745681-17745703 CCTTCAGGGCTGGGTGTGGTTGG - Intronic
1144949287 17:18985391-18985413 CCTTTTGACCTTGGGGTGTCAGG - Intronic
1146055567 17:29579091-29579113 CCTTCTGGGCCGGGTGTGCGTGG - Intronic
1146884968 17:36464553-36464575 CCTCCTGGGCTGGGTCTGCCTGG + Intergenic
1148048661 17:44758908-44758930 CCTGCGGGGCTGGGGGGGCCGGG + Intergenic
1148792831 17:50183333-50183355 CCCCCTGGGCTGGGGTGGTCTGG - Exonic
1148906425 17:50915239-50915261 CCTTCTGGGCTGGGCATGGCAGG + Intergenic
1149380896 17:56092824-56092846 CCTTGTTGGCTGTGGGTGTGGGG + Intergenic
1151520818 17:74628123-74628145 TGTTCTGGGCTGGGGCAGTCCGG - Intergenic
1152016446 17:77754008-77754030 GCTTCAGGGCTGGGGGTGGGAGG - Intergenic
1152356243 17:79809071-79809093 CCTTGGGGCCTGTGGGTGTCGGG + Intergenic
1152744521 17:82032647-82032669 CCAGCAGGGCTGGGGGTTTCTGG + Intronic
1203170766 17_GL000205v2_random:146363-146385 CCATCTGGGCTGGAGCTGTTGGG - Intergenic
1154141261 18:11826451-11826473 TCTTCAGCCCTGGGGGTGTCTGG - Intronic
1154216770 18:12421192-12421214 AGTGCTGGGGTGGGGGTGTCAGG - Intronic
1155099049 18:22590404-22590426 CATTCTAGGCTGGGAGTTTCAGG - Intergenic
1155394476 18:25372504-25372526 TCTTTTGGGGTGGGGGTGGCCGG - Intergenic
1156213869 18:34977120-34977142 GCTTCAGTGCAGGGGGTGTCGGG - Intronic
1160406480 18:78649778-78649800 GCTCCTGGGCTTGGGGTGTCAGG - Intergenic
1160512398 18:79459855-79459877 GCATCTGGGCTGGGGGCTTCTGG + Intronic
1161046416 19:2137173-2137195 GCTTCTGGGCTGGCGCTGCCTGG - Intronic
1161297781 19:3528298-3528320 CCCGCTGGGGTGGGGGTTTCAGG + Intronic
1161307963 19:3577847-3577869 GCTCCTGCGCTGGCGGTGTCCGG + Intronic
1161467469 19:4439653-4439675 CATTCTGATCTGGAGGTGTCTGG - Intronic
1161794899 19:6380954-6380976 CCCTCTGCGCTGGGCGTGCCTGG + Exonic
1162128287 19:8511052-8511074 TCTTCTGGGCTGGGGGAGCCCGG - Intronic
1163333881 19:16659501-16659523 CCTTCTGAGCTGGGGGTCAGGGG - Intronic
1163369247 19:16892862-16892884 AGCCCTGGGCTGGGGGTGTCAGG + Intergenic
1163389527 19:17021944-17021966 CCTTCAGGGCTGGGGCAGTGTGG - Intronic
1163390236 19:17026494-17026516 CCTTCTGGGGTGGGGGTCGCGGG - Intronic
1164245007 19:23421062-23421084 CTATCTGGGCTAGGGCTGTCAGG + Intergenic
1165160601 19:33813508-33813530 CCTGCAGGGCTGGGGCTCTCGGG + Exonic
1165955333 19:39498950-39498972 CCTTCTGGTGGGGGGGTCTCGGG - Exonic
1166340461 19:42133905-42133927 CCTGCTTGCCTGGGTGTGTCTGG - Intronic
1167038570 19:47008687-47008709 CCATCTTGGCTGGGGGAGTCAGG - Intergenic
1167282194 19:48576087-48576109 CCTGCCGGGCTGCGGGCGTCGGG + Intronic
1167420013 19:49397314-49397336 TCTGCTGGACTGGGGGTGACAGG + Intronic
1167460431 19:49621631-49621653 GGGTCTGGGCAGGGGGTGTCTGG + Intronic
1167471509 19:49678416-49678438 CCTCTGGGGCTGGGGTTGTCTGG + Intronic
1167476108 19:49701740-49701762 CCTTGGGGGCTGGGGGCGTGTGG - Intronic
1168165671 19:54545799-54545821 CCTTCTTGGCGGGGGGTGGGTGG - Intergenic
1168313493 19:55473374-55473396 CCTCCTGGGATGGGGGTGGATGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925310663 2:2879258-2879280 CATTCTGGGGTGGGGGTCCCTGG - Intergenic
925905876 2:8539511-8539533 CCTGCTGGCCTGGGAGGGTCTGG - Intergenic
926800412 2:16655257-16655279 GCCTCTGGGCTTGGGGTGTGGGG + Intronic
926806921 2:16719621-16719643 CCTTCTTAGCTGCAGGTGTCTGG - Intergenic
928366329 2:30706054-30706076 CCTTGAGGGGTGGGGGTGGCAGG + Intergenic
928878763 2:36072850-36072872 TCTTTTGGGCTGGGAGTGTTGGG + Intergenic
929814696 2:45221541-45221563 ACTTCTGGGCTGGGGGCTGCAGG - Intergenic
931376145 2:61710157-61710179 CCTTCTGGCCTGTGGCTTTCTGG + Intergenic
932092556 2:68819202-68819224 TTTTCTGGGCAGGGGGTGACAGG - Exonic
932304654 2:70693457-70693479 CTTTCTGGGGTGGGGGTGATGGG - Intronic
932400225 2:71475403-71475425 CCAACTGGGCTGGGAGTTTCTGG - Intronic
932737408 2:74264050-74264072 CCTTAGGGGCTGGGAGTTTCTGG - Intronic
933688497 2:85161516-85161538 CCTCCTGGGATGGGGATGGCTGG + Intronic
933749781 2:85595889-85595911 GTTTCTGGGCTGGGGCTGGCTGG + Intronic
933825593 2:86157424-86157446 CTCTCTGGGCTGAAGGTGTCAGG - Intronic
933988973 2:87619917-87619939 CCTTGGGAGATGGGGGTGTCTGG + Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
934708685 2:96501812-96501834 CTTTCTGGGCTGGGGGAGGGAGG + Intronic
935132996 2:100275269-100275291 CTTTCTTGGCTGGTGGTCTCAGG + Exonic
935155086 2:100477581-100477603 CCCTCTGGGCTGGGGGTGGTAGG + Intronic
935393939 2:102585892-102585914 CCTTCAGGCCTGGGGGTGGCAGG + Intergenic
936304870 2:111330909-111330931 CCTTGGGAGATGGGGGTGTCTGG - Intergenic
938685347 2:133732514-133732536 CATTCTGGTCTGGGGTAGTCAGG - Intergenic
942652433 2:178182711-178182733 CTCTCTTGGCTGGGGGTCTCTGG - Intergenic
944768781 2:202891259-202891281 CCTCCTGGGCTGGGCGTAGCTGG + Intronic
945032677 2:205680419-205680441 ACTTCTGGTCTTGGGGTCTCAGG - Intergenic
945935818 2:215901846-215901868 GCTTCTGGGATGGCTGTGTCTGG - Intergenic
946827779 2:223696330-223696352 CTTTCTGGGATGGGGGTCTGGGG - Intergenic
947800329 2:232925603-232925625 CCTTCTGCACTGTGGGTGTGTGG - Intronic
948425906 2:237886435-237886457 CCTGCTGGGCTGGGGGGCTCTGG + Intronic
949010697 2:241676764-241676786 CCTGGTGGGCTGGGTGGGTCTGG - Intronic
1169136307 20:3199909-3199931 CCTTCTAGGTTGGAGGTGCCAGG + Intronic
1169262692 20:4149483-4149505 CCCTCTGGGCTCCGGGCGTCCGG + Intronic
1172136376 20:32689522-32689544 GATTCTGGGCTTGGGGTGTGGGG - Intergenic
1172511425 20:35503793-35503815 CCCTCTGGGCTAGGGCTCTCTGG - Exonic
1172617628 20:36299516-36299538 CCTTGTGGCCTGGGGGTGAATGG + Intergenic
1172846385 20:37931949-37931971 CCTCCTGGGGTGGGGGTTTTAGG + Intronic
1173443389 20:43096808-43096830 CCCTCTGGGATGTGGGTGGCAGG + Intronic
1174338993 20:49884392-49884414 GCTCTTGGGGTGGGGGTGTCTGG + Intronic
1175055197 20:56191463-56191485 CCACCTGGGCTGGGGGTCCCTGG - Intergenic
1175348829 20:58303053-58303075 CCTGCCAGGCTGTGGGTGTCAGG + Intergenic
1175775642 20:61651867-61651889 CCATCGGGGCTGGGCGTGCCAGG + Intronic
1175911216 20:62406402-62406424 CCCACAGGGCTGGGGGTCTCAGG + Intronic
1176127315 20:63481857-63481879 CCTCCAGGGGTGGGGGTTTCTGG - Intergenic
1176288593 21:5032715-5032737 CCTTCTGGCTTGGCAGTGTCAGG - Intronic
1176330957 21:5548017-5548039 CCATCTGGGCTGGAGCTGTTGGG + Intergenic
1176396800 21:6272934-6272956 CCATCTGGGCTGGAGCTGTTGGG - Intergenic
1176440357 21:6716170-6716192 CCATCTGGGCTGGAGCTGTTGGG + Intergenic
1176464619 21:7043239-7043261 CCATCTGGGCTGGAGCTGTTGGG + Intergenic
1176488180 21:7425018-7425040 CCATCTGGGCTGGAGCTGTTGGG + Intergenic
1178486235 21:33021419-33021441 TCTCCTGGGGTGGGGGTGTGGGG + Intergenic
1178589414 21:33896535-33896557 CGATCTGGTCTGCGGGTGTCTGG + Exonic
1179180255 21:39038397-39038419 CCTTCTAGGCTGGGCATGGCAGG - Intergenic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1179561696 21:42219606-42219628 GCTTCTGGGCGGGGGGCGTGGGG + Intronic
1179617808 21:42593311-42593333 CCTGCTGGGCTGGTGGCCTCAGG + Intergenic
1179868591 21:44230760-44230782 CCTTCTGGCTTGGCAGTGTCAGG + Intronic
1180052606 21:45338488-45338510 GGTTCTGGGCTGGGTGTGGCAGG + Intergenic
1180787147 22:18553480-18553502 CCCTCTGGGTGGGGGGTGTGAGG + Intergenic
1180911364 22:19453126-19453148 CCTTCTGGGATGGGGGAGGGAGG + Intronic
1180985227 22:19900232-19900254 CCTGCTTGGCTGGGGGTCCCAGG - Intronic
1181234593 22:21441826-21441848 CCCTCTGGGTGGGGGGTGTGAGG - Intronic
1181244056 22:21493005-21493027 CCCTCTGGGTGGGGGGTGTGAGG + Intergenic
1181412367 22:22733263-22733285 CCTTCAGGTTTGGGGCTGTCTGG + Intergenic
1181420000 22:22791185-22791207 CCTTCAGGTTTGGGGCTGTCTGG + Intronic
1181424041 22:22821460-22821482 CCTTCAGGTTTGGGGCTGTCTGG + Intronic
1181436103 22:22911936-22911958 CCTGGTGGGATGGGGGTGTTTGG - Intergenic
1182695574 22:32197359-32197381 GCTTCTGGACTGTGGGTGTGAGG - Intronic
1183353838 22:37348263-37348285 CCTTGGGGGCTAGGGGTGCCAGG + Intergenic
1183368378 22:37418998-37419020 CCATCTGGGCTGGTGGGGTGTGG - Intronic
1183382454 22:37496985-37497007 CCTCCTGAGCTGGGGGGGTAGGG - Intronic
1183619520 22:38964511-38964533 CCCTCTGGGCTGTAGGGGTCGGG + Intronic
1184067950 22:42130828-42130850 CCTGGTGGGGTGGGGGTGCCAGG - Exonic
1184070687 22:42144501-42144523 CCTGGTGGGGTGGGGGTGCCAGG - Intergenic
1184783880 22:46662546-46662568 TGTCCTGGGCTGGGGGTGCCTGG - Intronic
1184817502 22:46883472-46883494 CCTTTAGGGATGGGAGTGTCAGG + Intronic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
950084718 3:10249111-10249133 CCTCCTGGGCCCGGGGTGGCGGG + Intronic
950380824 3:12613425-12613447 CCTTCTGGGGGCGGGGTGTGGGG - Intronic
950742708 3:15063130-15063152 CCTTCTGGGGTTGGAGAGTCAGG - Intronic
950965076 3:17140300-17140322 CCTTCTGGGGTTGGGATGTGGGG + Intergenic
953019476 3:39104521-39104543 CCCTCTGGGCTGGGTCTGGCTGG - Intronic
953032849 3:39189352-39189374 CCTCCAGGGCTGGGGGTGGAGGG + Exonic
954287205 3:49627345-49627367 CCTTCTCTGCTGGGGTTTTCAGG + Intronic
954387506 3:50252010-50252032 CCTCCTGGGCTACAGGTGTCTGG + Intronic
955466663 3:59243978-59244000 CCTTCTGTGCTGGGAGTTCCTGG + Intergenic
958692722 3:97488490-97488512 CCTGCTGGGTTGAGGGTGGCAGG - Intronic
961278015 3:125742772-125742794 CCTTCTGGGCTGAAGTGGTCTGG - Intergenic
961349063 3:126287529-126287551 CCTTTTGAGCTGGGGCTGGCAGG + Intergenic
961473306 3:127131988-127132010 CCTTCTGAGCCCTGGGTGTCTGG + Intergenic
967105899 3:186254837-186254859 ACTTCTGGGATGGGGCTGTGTGG + Intronic
968518167 4:1023487-1023509 GATTCTGGGCTGTGGGTGTGTGG + Intronic
968554995 4:1242371-1242393 GCTGCTGGGCTGGTGGTGGCCGG - Intronic
968622051 4:1608268-1608290 CCGCCTGGGGTGGGGGTCTCAGG - Intergenic
968939049 4:3628563-3628585 CTGGCTGGGGTGGGGGTGTCTGG + Intergenic
969306218 4:6327644-6327666 CCCTGTCTGCTGGGGGTGTCTGG + Intronic
969451260 4:7274809-7274831 TCTTCTGGGGGAGGGGTGTCAGG + Intronic
969535936 4:7756134-7756156 CCTTCTGGGGTTGGCGGGTCAGG + Intergenic
969686205 4:8675678-8675700 GCCTTTGGGCTGGCGGTGTCTGG - Intergenic
973699381 4:53521425-53521447 CCTTCTGGGCTGGGTGTCACAGG + Intronic
976122490 4:81798744-81798766 GCTTCTGGGCTGGGGCTCTTAGG - Intronic
978482020 4:109203550-109203572 CCCTCTGGACTGGTGGTCTCTGG - Intronic
978852598 4:113356230-113356252 TCTTCAGAGCTGGGGGTGTCAGG - Exonic
978920534 4:114177794-114177816 CCTTCTTATCTGGGAGTGTCTGG - Intergenic
981056368 4:140366316-140366338 CCTTCTGGCCTGTGGCTTTCTGG + Intronic
982758288 4:159250866-159250888 CTCTCTGGGCTGGGCGTGGCCGG + Intronic
985450296 4:190058169-190058191 CCATCTGGGCTGGGGCTGTTGGG - Intergenic
985590539 5:762213-762235 CCATCTGGGCTGTGAGTGGCTGG - Intronic
985626061 5:988886-988908 CCTTATGGGGTGGAGGTTTCTGG + Intergenic
985650664 5:1105814-1105836 TGGGCTGGGCTGGGGGTGTCTGG - Intronic
985915455 5:2915005-2915027 TCTCCGGGGCTGGGGGTGTGAGG + Intergenic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
986404386 5:7411295-7411317 CCCTCTGAGGTGGGGGTGTGTGG + Intronic
991168571 5:63593401-63593423 CCTGCTTGGCTGGGCGTGGCTGG - Intergenic
991929909 5:71744139-71744161 CATTCCTGGCTGGGGGTGGCAGG - Intergenic
992089905 5:73307488-73307510 CCCCCTGGGCTGGGGGTGACAGG + Intergenic
996282958 5:121754115-121754137 TCTGGTGGGCTGGGGGTGACTGG + Intergenic
997334452 5:133096133-133096155 CCTTCTTGGCTTGGGGTGGTTGG - Exonic
997690611 5:135825452-135825474 CCTGCTGGGAGGGGTGTGTCTGG - Intergenic
998403876 5:141862920-141862942 CCTTATGGGTTGGGGGTGGTAGG - Intronic
998953361 5:147413911-147413933 CCTTCTGGGCTAGGGGATGCTGG - Intronic
999820888 5:155227127-155227149 TGTTGTGGGGTGGGGGTGTCGGG + Intergenic
1001567842 5:172712021-172712043 GGTTCTGAGCTGGGGGTGACAGG - Intergenic
1006135826 6:31896318-31896340 CCCTCTGGGCTCGTGGTGGCTGG + Exonic
1006358220 6:33573145-33573167 GATTCTGGGCTTGGGGTGTGGGG - Exonic
1006359479 6:33579434-33579456 CCTACTGTCCTGGGGGTGCCGGG - Intronic
1006401685 6:33821483-33821505 CCATCTGGCCTGGGGGTGGGTGG - Intergenic
1006474698 6:34246536-34246558 CCTTCTGGGATGGGGGCGGCTGG - Exonic
1006716498 6:36123937-36123959 CCTTCTGGGTTCGGGATGACAGG - Intergenic
1007431857 6:41781076-41781098 CCTTCAGGGCAGCGGGTGTTGGG + Intronic
1007878985 6:45140657-45140679 CCTGCTGTGCTGGAGGTGGCAGG - Intronic
1010556205 6:77282280-77282302 CATTTTGGGCTGTGGGTTTCAGG + Intergenic
1012464832 6:99505549-99505571 CCTCCTGGGCTGGGAGTAGCTGG - Intronic
1013013721 6:106142841-106142863 CATCCTGAGCTGGGGGTGGCAGG + Intergenic
1013543182 6:111131677-111131699 CCTTCTGGGTTGGGAGCGTTGGG + Intronic
1014925741 6:127267415-127267437 CCTTCTGGCCTCGAGGTGTAGGG + Intronic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017713576 6:157191220-157191242 CCCTCTGTGCTGCTGGTGTCCGG - Intronic
1019414747 7:922120-922142 CCTCCAGGGCTGTGGGAGTCGGG - Intronic
1019911951 7:4106149-4106171 CCTTCTGAGCAGCGAGTGTCTGG - Intronic
1020054167 7:5105537-5105559 CCTTTTGGGGTGTGGGTGCCAGG + Intergenic
1020815815 7:12904175-12904197 CCTGCTGGGGTGGGGGTGCAGGG + Intergenic
1022240199 7:28503881-28503903 CCTTCTGCTCTGGGGGTGGGAGG - Intronic
1022520089 7:31000556-31000578 CCTTCCAGGCTGGGGGTAGCAGG + Intergenic
1022521943 7:31014103-31014125 CCTCCTGGGCTGGGGCAGTGAGG - Intergenic
1023986468 7:45100017-45100039 CCTCTTGGGCTGGGCGTGGCGGG + Intergenic
1024059606 7:45687940-45687962 CCCTCTGGGCTGTGCCTGTCTGG - Intronic
1024205053 7:47151021-47151043 CAATCTGGGCTGGGCTTGTCAGG - Intergenic
1025009579 7:55385243-55385265 CTTTCTGGGCTGGTGGTGTGGGG + Intronic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026237048 7:68535517-68535539 CCTTCTGGGCTGGCTGAGACCGG - Intergenic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1026950022 7:74340778-74340800 ACTTCTGGGCCTGGGGTGTGAGG + Intronic
1027138488 7:75640362-75640384 CCTTCTGGGCTTGGGCTGGATGG - Intronic
1028903391 7:96126023-96126045 CCTTCATGGCTGGGGATCTCTGG + Intronic
1029369115 7:100136527-100136549 CTTTCTGGGCTGGGCGTGGTGGG - Intergenic
1031213394 7:118859064-118859086 CCTTCTGGGCTGGCTGAGGCCGG - Intergenic
1032080598 7:128856678-128856700 CCTTCCGGGCTGGGGCCTTCTGG + Intronic
1032275110 7:130447428-130447450 GCTTCTGGGGTGGGGGTGGGAGG + Intergenic
1033002692 7:137524805-137524827 TCTACTGGGCTGGAGGTATCAGG + Intronic
1033562602 7:142546756-142546778 CCTTCTGGGCTGTGGATTTTGGG - Intergenic
1033854460 7:145541660-145541682 CCTTCTAAGATGGTGGTGTCTGG + Intergenic
1034443749 7:151101311-151101333 CCTCCTGGGCTGGAGGGGACAGG + Intronic
1034530466 7:151693255-151693277 CCTCCTGTGCTGCGGGTCTCAGG - Intronic
1035046278 7:155969367-155969389 GATCCTGGGCTGGAGGTGTCTGG + Intergenic
1036953323 8:13161661-13161683 CCTTCTGGTTTGAGGGTGACTGG + Intronic
1037817087 8:22118023-22118045 TCTTCTGGGCTGGGTGTGGCTGG - Intronic
1037913144 8:22756339-22756361 TCTCCTGAGCTGGGGCTGTCCGG - Intronic
1039889404 8:41673978-41674000 AACTCTAGGCTGGGGGTGTCTGG - Intronic
1041467324 8:58169692-58169714 CCCCCTGGGCTGTGGGTATCTGG + Intronic
1041787203 8:61648279-61648301 CAGTCTGGGCTGGGGTTGTGGGG - Intronic
1045105371 8:98887627-98887649 CATACTGGGGTGGGGGTGTGTGG - Intronic
1045315046 8:101036592-101036614 CATTGTGAGCTGGGGTTGTCAGG + Intergenic
1047251055 8:123182437-123182459 CCAGCTGGGCTGGTGGTGCCAGG + Exonic
1047605859 8:126473537-126473559 CTATCTGGGCTGGTGGTGTGGGG - Intergenic
1049204996 8:141359519-141359541 CCTTGTGTGGTGGGGGTGGCAGG - Intronic
1049236453 8:141514712-141514734 CCTGCTGGGCTGGGGGTCCCAGG - Exonic
1049248225 8:141574222-141574244 CCCTCTGAGCTGGGGGCTTCTGG + Intergenic
1049275643 8:141718809-141718831 CCTCCTGGGCTGTGGGGGTCTGG + Intergenic
1049427953 8:142545646-142545668 CCTTCTGGGCTGGTGGGGGATGG - Intergenic
1049509751 8:143021610-143021632 CCTTCTGGGATGGGGCAGGCCGG - Exonic
1049519609 8:143081140-143081162 CGGGCTGGGCTGGGGGCGTCGGG + Intronic
1049578235 8:143399291-143399313 CCGTGAGGGTTGGGGGTGTCAGG + Intergenic
1049785323 8:144448064-144448086 CCTTATGGCCTGGGGGAGCCAGG - Intergenic
1049865045 8:144929830-144929852 CCAGCAGGTCTGGGGGTGTCAGG - Intergenic
1052972118 9:34382994-34383016 CCGGCTGGGCTTGGGGTCTCTGG - Intronic
1052999493 9:34569805-34569827 CCTACTGGGCTGGGGGTCCCAGG - Intronic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054451697 9:65406757-65406779 CTGGCTGGGGTGGGGGTGTCTGG - Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1057299095 9:93866158-93866180 GGTTCTGGGCTGGGGCCGTCAGG - Intergenic
1057728892 9:97591484-97591506 CCACCTGTGCTGGGGATGTCAGG + Intronic
1058781386 9:108339517-108339539 CCTTTTGGGGTGGGGGTGGGAGG + Intergenic
1058827987 9:108792307-108792329 CATTTTGGGCTGTGGGTTTCAGG - Intergenic
1059407399 9:114109751-114109773 TCCTCTGGGGTGGGGGTGGCGGG - Intergenic
1059417187 9:114169285-114169307 CTGACTGGGCTGGGGCTGTCTGG - Exonic
1059609549 9:115878026-115878048 CCTACTGGGGTGGAGGTGGCGGG + Intergenic
1060778146 9:126391845-126391867 CCTTCTCAGCAGGGGGTGTCTGG + Intronic
1061368563 9:130185421-130185443 CCTCCTGGGCTGGGGGAGGGGGG + Intronic
1061706475 9:132457132-132457154 TCTTCAGGGGTGGGGGTGACCGG - Intronic
1061896361 9:133650285-133650307 CCTTCAGGGATGGGGCTGTCGGG + Intronic
1062213808 9:135378348-135378370 CCTTCTTGCCTGCTGGTGTCTGG + Intergenic
1062396352 9:136354396-136354418 TCTCCTGGGCTGTGGGGGTCAGG + Intronic
1203431142 Un_GL000195v1:92309-92331 CCATCTGGGCTGGAGCTGTTGGG - Intergenic
1203435365 Un_GL000195v1:132314-132336 CCATCTGGGCTGGAGCTGTTGGG + Intergenic
1185529122 X:803163-803185 CCTTCTGAGCAGGGGGTATCTGG + Intergenic
1185554405 X:1009127-1009149 CCTTCTGGCCTGCGGCTTTCTGG + Intergenic
1185592084 X:1283957-1283979 CCCTCTTGACTGAGGGTGTCAGG + Intronic
1185604343 X:1359240-1359262 CCTGCTGGACTGGGGCTGCCTGG - Intronic
1186768199 X:12791920-12791942 CCTTCCGGGCTGGGGACGCCAGG - Intronic
1188003502 X:25002594-25002616 CTCTCTGGGCTGGGGCCGTCGGG - Intergenic
1189075208 X:37907214-37907236 CATTTTGGGGTGGGGGTGGCAGG - Intronic
1189281891 X:39824880-39824902 TCTTCTGGGATGGGGGTGTCCGG - Intergenic
1189803666 X:44714786-44714808 ACTTCTGGGCTAGGTGTGTTTGG - Intergenic
1192177320 X:68894267-68894289 CTTCCTGGGCTGGTGGTGGCGGG + Intergenic
1192502895 X:71665081-71665103 CCTCCTGGCCTGGGGCTGACTGG - Intergenic
1192606452 X:72524255-72524277 ACTTCTAGGCTAGGGATGTCCGG - Intronic
1194212080 X:91082078-91082100 CCTTCTGAGTTGGGGGAGTGGGG + Intergenic
1196767949 X:119266305-119266327 CATTCCTGGCTGGAGGTGTCTGG - Intergenic
1197079790 X:122398358-122398380 CCTGCTGTGGTGGGGGTGGCAGG - Intergenic
1197817319 X:130511694-130511716 TCTTCTGGACTCGGGGTGTATGG + Intergenic
1199503572 X:148536350-148536372 CCTGGAGGGCTGGGGGTGCCTGG + Intronic
1200043105 X:153384207-153384229 CCTGGTGGGGTGGGGGTTTCTGG - Intergenic
1200077315 X:153557557-153557579 CCTTCTGGGCTACGGGTGCTGGG - Intronic
1200107419 X:153723013-153723035 CTGTCTGGGGTGGGGGTGGCAGG - Intronic
1200397631 X:156000540-156000562 CCAGCGGGACTGGGGGTGTCAGG + Intronic
1201771563 Y:17621430-17621452 CCATCTGGGCTGGGGTTGTGGGG - Intergenic
1201829992 Y:18284556-18284578 CCATCTGGGCTGGGGTTGTGGGG + Intergenic