ID: 1125921247

View in Genome Browser
Species Human (GRCh38)
Location 15:43527090-43527112
Sequence GTGCCCCAAGAGAAGGGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125921247_1125921257 18 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921257 15:43527131-43527153 GGTGGCTGCAGTGCAGGAGGGGG 0: 1
1: 2
2: 7
3: 86
4: 913
1125921247_1125921256 17 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921256 15:43527130-43527152 TGGTGGCTGCAGTGCAGGAGGGG 0: 1
1: 1
2: 4
3: 60
4: 455
1125921247_1125921255 16 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921255 15:43527129-43527151 GTGGTGGCTGCAGTGCAGGAGGG 0: 1
1: 1
2: 7
3: 61
4: 519
1125921247_1125921253 12 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921253 15:43527125-43527147 CAGTGTGGTGGCTGCAGTGCAGG 0: 1
1: 0
2: 3
3: 37
4: 390
1125921247_1125921254 15 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921254 15:43527128-43527150 TGTGGTGGCTGCAGTGCAGGAGG 0: 1
1: 0
2: 3
3: 53
4: 510
1125921247_1125921250 -3 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921250 15:43527110-43527132 CACAGCCGAGTATGACAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1125921247_1125921258 30 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921258 15:43527143-43527165 GCAGGAGGGGGCAGCTGAGTTGG 0: 1
1: 0
2: 3
3: 68
4: 592
1125921247_1125921251 0 Left 1125921247 15:43527090-43527112 CCTGCACCCTTCTCTTGGGGCAC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1125921251 15:43527113-43527135 AGCCGAGTATGACAGTGTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125921247 Original CRISPR GTGCCCCAAGAGAAGGGTGC AGG (reversed) Exonic
901443700 1:9293797-9293819 CGGCCCCGAGAGGAGGGTGCGGG + Intronic
901483254 1:9540093-9540115 AGGCCCCAGGAGAAGGGGGCGGG - Intronic
901624736 1:10617531-10617553 GGACCCCAAGAGCAGGGTGCTGG - Intronic
901639593 1:10686607-10686629 GTGCACCAAGAGAGGGTGGCGGG - Intronic
907992950 1:59600570-59600592 GTGTCCAAAGAGCTGGGTGCAGG - Intronic
909477585 1:76097805-76097827 GTGCCCCAAGAGACAGGTACAGG - Intronic
910094244 1:83501933-83501955 GTGCAACTAGAGAAGGGTTCTGG + Intergenic
912449188 1:109758979-109759001 GTGCCCCAAGATATGGGGTCAGG + Intronic
914880281 1:151541214-151541236 GTGACCCAAGCGAAGGCTTCTGG + Intronic
915214005 1:154328400-154328422 GTGCCCGAAGATAAGACTGCAGG - Intronic
915534619 1:156527797-156527819 GTTCCTGAAGAGAAGGGTGGGGG - Intronic
915615313 1:157033281-157033303 GTAGCCCAAGAGAAGGGTAAGGG + Intronic
917625271 1:176839632-176839654 GTGCACCAGGAGAGGGGTGGAGG + Intronic
918325512 1:183406298-183406320 AAGCCGAAAGAGAAGGGTGCTGG + Intronic
920616054 1:207493903-207493925 ATAACCCAAGAGAAGGGTGAGGG + Intergenic
1063546222 10:6984623-6984645 TTGCCCCAAGAGATGAGTGCTGG - Intergenic
1065127941 10:22592426-22592448 GTGCCCCAGGAGGAGGAGGCAGG + Intronic
1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG + Intronic
1067349882 10:45466088-45466110 GTGCCCCGAGAGGAGGATGCTGG - Intronic
1069618283 10:69820245-69820267 GTGCCCCATGAGGATGGAGCAGG + Intronic
1070720344 10:78752635-78752657 GATCACCAACAGAAGGGTGCAGG + Intergenic
1070753344 10:78976701-78976723 GGGTCCCTGGAGAAGGGTGCTGG - Intergenic
1070965843 10:80529796-80529818 GTGCCCTAAGAGAGAGCTGCTGG - Exonic
1072657194 10:97338096-97338118 GTGCCCCCAGAAAATGGAGCTGG - Intergenic
1076109800 10:127851683-127851705 GTGCCCCAGGGGAAGGAGGCAGG + Intergenic
1076909510 10:133379924-133379946 GTGGCCCAGGAGAAGGGCTCGGG + Intronic
1078828351 11:14953450-14953472 GTGGCCAAAGAGAAGGGTCTTGG - Intronic
1080633836 11:34105920-34105942 GCGCCCCAAAAGAGGGGTGGAGG - Intronic
1083293011 11:61700159-61700181 GTGCCCCAACAGGAGGGCTCTGG - Intronic
1083338937 11:61946164-61946186 CTGGCCCAAGAGAGGGGTGTGGG + Intergenic
1083865017 11:65448971-65448993 CTGCCCTAAAAGAAGGGTGGGGG - Intergenic
1084091039 11:66879565-66879587 GTTCCCCAACACAAGGCTGCTGG + Intronic
1084328631 11:68416532-68416554 GTGCCCTGTGGGAAGGGTGCGGG + Intronic
1084564499 11:69921436-69921458 GTGTCCCAAGAGAAGGAGGAGGG + Intergenic
1084599189 11:70134837-70134859 AGGCCCCATGGGAAGGGTGCGGG + Intronic
1084957003 11:72696905-72696927 GTGCCACAAGGGAAGGGCGCAGG + Intronic
1090351324 11:126110315-126110337 GTGCCCCTAGAGAAGGAGGTGGG - Intergenic
1090835879 11:130453138-130453160 GTGCTCCAAGGGACGGGAGCAGG + Intronic
1091729022 12:2866061-2866083 GAGCCCCAAGAGAGGGGTCTGGG + Intronic
1098512340 12:71331465-71331487 GTGCCCAAAGAGAAGATTTCTGG - Intronic
1098590476 12:72205300-72205322 GTACACGAAGGGAAGGGTGCAGG - Intronic
1101777304 12:107806380-107806402 GTGCCCCTAGAGAAGGGAGCAGG + Intergenic
1102212270 12:111136153-111136175 GGACCCCATGAGAAGGATGCAGG + Intronic
1102567092 12:113803830-113803852 GTGCCATGAGAGAAGGATGCTGG - Intergenic
1103476651 12:121223572-121223594 GTCACTCACGAGAAGGGTGCAGG + Intronic
1105882676 13:24617723-24617745 GTGCCTGAAGAGTAGGGGGCAGG + Intergenic
1106421825 13:29591684-29591706 GTGCCCCCAGAAAAGGGAGGGGG + Intronic
1106753957 13:32802585-32802607 ATGCCCTAACAGGAGGGTGCAGG + Intergenic
1113541083 13:111110247-111110269 GTGGCCCAGGGGAAGGCTGCAGG + Intergenic
1114441136 14:22748927-22748949 GGGCACCAAGAGGAGGGTGCAGG + Intergenic
1115711430 14:36055266-36055288 GAGGCCCAAGAGGAGGGTTCAGG - Intergenic
1116804474 14:49479247-49479269 GTGCCTCAAATGAAGGGTGATGG - Intergenic
1118502862 14:66379453-66379475 CTGCCCCAAGGGTAGGGTGGTGG - Intergenic
1121105998 14:91280077-91280099 GTGGCCCAGGAGAGGTGTGCAGG - Intronic
1123627354 15:22236953-22236975 GTCCCCAAAGAGAGGGATGCCGG + Intergenic
1124036835 15:26061345-26061367 CTGCACCAAGAGAGGGGAGCGGG - Intergenic
1125921247 15:43527090-43527112 GTGCCCCAAGAGAAGGGTGCAGG - Exonic
1127351814 15:58160691-58160713 GTGCCACAAGACAAGGTTGCAGG + Intronic
1128803893 15:70516479-70516501 TTGCCTCATGAGAAGGATGCAGG + Intergenic
1129331732 15:74831378-74831400 GGGCCCCAAGAGAACAGAGCTGG - Exonic
1129739051 15:77981143-77981165 GGTCCCCAAGAGAGGGGTGATGG + Intergenic
1131205916 15:90446737-90446759 CTGCCCCAGGAGAAAGCTGCAGG + Intronic
1133313022 16:4863308-4863330 GTGCCCCAAGTGCAGGGCCCTGG - Intronic
1135587064 16:23679445-23679467 GAGCTGCTAGAGAAGGGTGCTGG + Intronic
1141497410 16:84419635-84419657 GGGCCCCAAGGGAAGGGAGGAGG - Intronic
1141976600 16:87520425-87520447 GTCCCCAAAGAGAGGGATGCCGG - Intergenic
1142184782 16:88689516-88689538 GTGCCCCCAGAGCATGGGGCAGG - Intergenic
1142604965 17:1076538-1076560 GGGACCCAAGAGAGGGCTGCGGG - Intronic
1143085484 17:4413015-4413037 TTGCCCCAAGGGAAGGGCCCTGG + Intergenic
1143303716 17:5929682-5929704 GAGGCCCAAGAGAAGTGAGCAGG + Intronic
1143759487 17:9090777-9090799 GGGAGCCAAGAGAAGGGGGCAGG + Intronic
1144198498 17:12918093-12918115 GTGCCTCAAAAGGAGGGTCCCGG + Intronic
1144439257 17:15266643-15266665 GTTCCACAACAGAAGGGAGCTGG - Intergenic
1147690631 17:42312628-42312650 GGGCCCCAAGAGGGAGGTGCAGG + Intergenic
1149030932 17:52081439-52081461 GCGGCCCAAGAGAAAGGTGGTGG + Intronic
1151943129 17:77305193-77305215 GGGCACCAAGAGGAGGATGCTGG + Intronic
1152269410 17:79315302-79315324 GTCCCCAGAGAGAAGGATGCAGG - Intronic
1152519346 17:80846187-80846209 GGGCCGCAAGAGGAGCGTGCTGG - Intronic
1152840124 17:82561865-82561887 GTGCCCCTAGGGCAGGGTGGTGG + Intronic
1154172921 18:12063773-12063795 GTACCCCTAGAGAAGGGAGCAGG + Intergenic
1156869768 18:41932015-41932037 GGGCTCCAAGAGAAGGATCCTGG + Intergenic
1158856315 18:61545948-61545970 GTGCCCAAAGAAGAGTGTGCTGG - Intronic
1160966548 19:1749313-1749335 GTGCCCGAGGGGAAGGGTCCGGG - Intergenic
1163183031 19:15617301-15617323 TGCCCCCAAGAGAAGGGAGCAGG + Intronic
1164740555 19:30572486-30572508 GTTCCCCAGGACAAGGCTGCTGG - Intronic
1165151994 19:33766412-33766434 CTGCCCCGAGTGCAGGGTGCTGG - Intronic
1168306384 19:55438287-55438309 GGGCCCCAAGAGGGGGGTACTGG + Intronic
927338010 2:21947787-21947809 GTCCTCCAAGAGATGGGTGCAGG - Intergenic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
931766515 2:65461472-65461494 GGGCCCAAAGTGAAGGGTGCGGG + Intergenic
932721468 2:74141544-74141566 GTGCACGCAGAGAAGGGTGGGGG + Intronic
934612458 2:95751394-95751416 CTTCCCCAAGAGGAGGCTGCAGG - Intergenic
934841694 2:97628050-97628072 CTTCCCCAAGAGGAGGCTGCAGG + Intergenic
934936857 2:98472009-98472031 GTGCCCCACAAGGAGGGTGTAGG + Intronic
936630150 2:114193317-114193339 GTGACCCAAGAGAAGGGAAGCGG + Intergenic
936935729 2:117836678-117836700 CTGCCCCCAGGGAAGGCTGCTGG + Intergenic
937908602 2:127064649-127064671 GGGACCCTAGAGGAGGGTGCAGG + Intronic
938310521 2:130285890-130285912 CGGCCCCTAGAGAAGGGAGCAGG - Intergenic
938444406 2:131366477-131366499 TGGCCCCTAGAGAAGGGAGCAGG + Intergenic
939096237 2:137836727-137836749 GTGCCAGAAGAGAAGGGTCCTGG + Intergenic
942050344 2:172134362-172134384 GTGCCCTAAGAGATGGATGTTGG + Intergenic
944337225 2:198549712-198549734 TTGCCCCAAGAAATGAGTGCTGG + Intronic
944454151 2:199876150-199876172 TTGCCCCCAGGCAAGGGTGCAGG - Intergenic
944913836 2:204337278-204337300 GAACCCCAAAAGAAGGATGCTGG + Intergenic
945184145 2:207122671-207122693 GTGCCTCCAAAGAAGTGTGCAGG - Intronic
945937414 2:215916984-215917006 GTACCCCAAGAGAAGGTTCTTGG - Intergenic
1172083772 20:32362205-32362227 CTGCCCAAAGAGAAGTGTTCAGG - Intronic
1174287002 20:49480970-49480992 GTGCCCGAAGTGCTGGGTGCTGG - Intronic
1174396887 20:50252174-50252196 ATGACCTAAGAGAAGGGTGCTGG + Intergenic
1174530950 20:51213611-51213633 GAGCCCCAAGAGAAGCAGGCAGG + Intergenic
1175334449 20:58186069-58186091 GAGCCCCAAGAGGAGGGTCCGGG + Intergenic
1180988134 22:19917596-19917618 GAGCCCCAGGAGAAGGTTGTAGG + Intronic
1181740811 22:24920009-24920031 GGGCCTCATGAGAGGGGTGCAGG + Intronic
1182030531 22:27155928-27155950 GAGGCCCAGGAGAAGGGTGTTGG - Intergenic
1182680274 22:32074086-32074108 GTGCACGTAGAGAAGGGTGCTGG + Intronic
1184508660 22:44919036-44919058 GCCCCCCAGGAGGAGGGTGCAGG - Intronic
950614967 3:14150909-14150931 GTGCACCATGGGGAGGGTGCGGG + Intronic
953715420 3:45313202-45313224 ATGCCCCAATAGAAGGCTGCTGG - Intergenic
953770682 3:45776887-45776909 GTGCCCCCATAGGAGGCTGCTGG + Intronic
954309039 3:49750372-49750394 GTGACCCAGAAGAATGGTGCAGG + Intronic
954535196 3:51354667-51354689 CAGCCCCAAGGGAAGGGTACAGG - Intronic
954782815 3:53073368-53073390 GTGCCGCAAGTGGAGGGGGCGGG + Intronic
961316056 3:126036413-126036435 CTGCCCCATAGGAAGGGTGCAGG - Intronic
961615193 3:128173857-128173879 GTGCCCCAAGTGAAGATAGCAGG + Intronic
961646957 3:128397813-128397835 GAGCCCCAAGGGAAGGGGCCAGG + Intronic
963680740 3:148372497-148372519 GTGACCCCAGAGAGAGGTGCTGG - Intergenic
964610427 3:158609269-158609291 TTGCCCAAAGAGAATGGTGGAGG + Intergenic
966925147 3:184639858-184639880 GTGGCCCAAGATGGGGGTGCTGG + Intronic
967174681 3:186852534-186852556 GTGCCCCAGGAGAGGGGTAGAGG + Intronic
969321714 4:6416838-6416860 GTGCCCCAGGGGAAGGCTCCTGG + Intronic
969613839 4:8241162-8241184 CTGCCCCCAGGGAAGGGAGCTGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972248939 4:37278684-37278706 ATGGCCCAAGAAAATGGTGCTGG - Intronic
976613587 4:87053950-87053972 GTGGCCCAAGTGAGGGGTGTTGG + Intronic
978443472 4:108758743-108758765 GAGCCCCAAGAGATGCGGGCTGG - Intronic
978845813 4:113271372-113271394 CTGTCCCAGAAGAAGGGTGCAGG + Intronic
979968597 4:127106647-127106669 GAGCTCCCAGAGGAGGGTGCAGG + Intergenic
982693333 4:158572131-158572153 GTGGCCCAAGAGAGGGTTTCCGG - Intronic
983933265 4:173476261-173476283 ATTCCCCAAGAGCAGGGTGCAGG - Intergenic
984970535 4:185185169-185185191 TTGCCCCAAGAAATGAGTGCTGG + Intronic
985781758 5:1875379-1875401 GTGCCCCAAGGGAAGGGTGTGGG + Intergenic
986666226 5:10107421-10107443 GTGCCCCAAGTGATGAGTTCTGG + Intergenic
986694524 5:10339930-10339952 GTGCCCTGAGTGAAGGCTGCTGG + Intergenic
986753636 5:10812801-10812823 GAGCTCCAAGAGAAAGGAGCAGG + Intergenic
997011250 5:129881001-129881023 ATTCCCCAAAAGAAGGATGCTGG + Intergenic
999493548 5:152074605-152074627 TTGCCACAATAGAAGGGTACTGG + Intergenic
1001285057 5:170416733-170416755 TTGCCCCAAGAAATGAGTGCTGG - Intronic
1001910139 5:175509800-175509822 TTTCCCCAAGAGAAGGGATCTGG + Intronic
1002107123 5:176885275-176885297 GTGCCCAAAGAGCAGGGCCCGGG + Intronic
1002175001 5:177396738-177396760 GTGACCCAGGTGAAGGGGGCAGG - Exonic
1003098728 6:3160898-3160920 GGGCCCAACGAGAAGGGTCCTGG + Intergenic
1003154466 6:3579307-3579329 CAGCCCCAAGGGAAGGATGCTGG + Intergenic
1005103556 6:22199417-22199439 GTGTCACATGAGAAGGGTGAGGG - Intergenic
1006068033 6:31476616-31476638 GTGCCCCCAGTGCAGGGGGCAGG - Intergenic
1006295120 6:33166822-33166844 GTGGCCCTAGAGAAGGGTGCAGG + Exonic
1006558600 6:34889644-34889666 GGGACCCAAGAGACGGGTGGGGG - Intronic
1006829209 6:36958633-36958655 GTGACCCAAGGGGAGGGTGGGGG + Intronic
1007295876 6:40820186-40820208 GTGCCCCATGACCAGGGTTCAGG + Intergenic
1010514765 6:76760014-76760036 GAGGCCCAAGAGCATGGTGCTGG + Intergenic
1010723990 6:79312696-79312718 GGGCCCCAAGAGAAGGCTCAGGG - Intergenic
1011524328 6:88246923-88246945 GTGCCTCAGGAGAAGGGAGGAGG + Intergenic
1016911175 6:149200665-149200687 GTGCCCCAATTGAAGGCTGTTGG - Intergenic
1017361239 6:153574428-153574450 GTGCCCTAAGAGTTGGCTGCTGG + Intergenic
1018643921 6:165930337-165930359 GTGGCCCAAGAGAAGAGAGAGGG + Intronic
1018712179 6:166505177-166505199 GTGCCCCAAGCTGAGGGGGCGGG + Intronic
1019262990 7:92648-92670 GGGCCCCAAGAGAAGGAACCTGG + Intergenic
1019435994 7:1022342-1022364 GTGCCCCATGAGAGGGCTGTGGG - Intronic
1020213668 7:6172735-6172757 GTACATCCAGAGAAGGGTGCAGG - Intronic
1022044815 7:26614202-26614224 GTGCCACAAGAAAGGCGTGCTGG + Intergenic
1022223003 7:28332594-28332616 CTGGCCCAGGAGAAGGTTGCTGG - Intronic
1024512504 7:50214690-50214712 GTGCCCCCAGAGCAGTGTGGTGG + Intergenic
1024542776 7:50492597-50492619 CTGCCACAAGAGAAGGGTGATGG - Intronic
1024775256 7:52777412-52777434 GTGCCTGGAGAGGAGGGTGCAGG - Intergenic
1025261125 7:57417860-57417882 GTGCCCCAAGCCAGGGCTGCTGG - Intergenic
1025734245 7:64132913-64132935 GTGCCCCAAGGGGCGGATGCAGG - Intronic
1026421189 7:70239212-70239234 CTGCCCCAAGACATGGGGGCTGG - Intronic
1027004861 7:74684535-74684557 CGTCCCCAAGTGAAGGGTGCAGG + Intronic
1027024414 7:74840604-74840626 CGTCCCCAAGTGAAGGGTGCAGG - Intronic
1027063351 7:75103518-75103540 CGTCCCCAAGTGAAGGGTGCAGG + Intronic
1027233981 7:76287094-76287116 GGGCCCCAGGAGGAGGGGGCTGG - Exonic
1029437505 7:100571361-100571383 GTGCCCCCAGAGAAAGGACCAGG - Intergenic
1029515545 7:101020936-101020958 CTGCCCCCAGAGAAGGGCGCAGG + Intronic
1031013494 7:116548155-116548177 GTGCTCCAAGGGCAGGGTCCAGG - Intronic
1031448257 7:121881601-121881623 GTGCCACAAGACAAAGGTCCTGG + Intronic
1031967525 7:128037764-128037786 ATGAGCCAAGAGAAGGGGGCAGG + Intronic
1032012730 7:128357489-128357511 GTGCCTCAGGGGAAGGATGCTGG - Intronic
1032478492 7:132228206-132228228 GCAGCTCAAGAGAAGGGTGCAGG - Intronic
1034921479 7:155086931-155086953 GTGCACCTAGAGAAGGCTGGAGG + Intergenic
1035035310 7:155890791-155890813 TTTCCCCAAGAGAGGGGCGCTGG + Intergenic
1037618815 8:20545041-20545063 AACCCCCAAGAGAAGGGTGGTGG + Intergenic
1037936318 8:22917301-22917323 GTCCCTCAAGAAAAGGGTGCGGG - Intronic
1040277804 8:46022844-46022866 GTTCCCCAAGAAAAGGGGACAGG - Intergenic
1045920019 8:107518579-107518601 CTGACCCAAGATAAGGGTACAGG - Intergenic
1046209383 8:111047689-111047711 GTGCTGCAACAGAGGGGTGCAGG - Intergenic
1047287533 8:123500919-123500941 CTGCCCCAAGAGAAGGGTTACGG - Exonic
1048987207 8:139741035-139741057 GAGCCCCAAGAGGAGGGTGGAGG + Intronic
1049254174 8:141605114-141605136 GTGCCCCAAGTGCAGGGGACAGG - Intergenic
1049280814 8:141743286-141743308 GTGGCCCTGGAGAAGGGTGACGG + Intergenic
1049280880 8:141743579-141743601 GTGGCCCTGGAGAAGGGTGATGG + Intergenic
1051831885 9:21288589-21288611 TTGCCCCAAGAAATGAGTGCTGG - Intergenic
1053553423 9:39108220-39108242 GAGCCCCCAGACAAGGGTCCGGG + Intronic
1053817527 9:41928377-41928399 GAGCCCCCAGACAAGGGTCCGGG + Intronic
1054107783 9:61072049-61072071 GAGCCCCCAGACAAGGGTCCGGG + Intergenic
1054613074 9:67259076-67259098 GAGCCCCCAGACAAGGGTCCGGG - Intergenic
1056717940 9:89048720-89048742 GTGTCCCCAGAGAATGGGGCTGG + Intronic
1058613281 9:106798316-106798338 CTCCCTCAAGAGAAGGGGGCTGG + Intergenic
1061030828 9:128081567-128081589 GTGCACCAAGAGTAAGGAGCAGG - Intronic
1062355153 9:136158393-136158415 GAGCCCCAAGTGAGGGGTGCTGG + Intergenic
1189304176 X:39974309-39974331 TTGCCTAAAGAGAAGGGGGCTGG - Intergenic
1190225105 X:48539430-48539452 GTTCGCCAAGAGAAGGGGGCGGG - Intergenic
1195707066 X:107744896-107744918 GTGCCACAGGAGAAGGGAGGAGG - Intronic
1200077029 X:153556357-153556379 GTGGCCCAAGCTGAGGGTGCTGG + Exonic
1200087842 X:153618456-153618478 GTGCTCCATGAGCAGGGTCCTGG + Intergenic
1201343155 Y:12955367-12955389 GTGCCCCATGAGAAGGCAACAGG + Intergenic
1202046854 Y:20744200-20744222 GTGCCCCAAGAGAAGAATCATGG + Intergenic