ID: 1125923717

View in Genome Browser
Species Human (GRCh38)
Location 15:43543572-43543594
Sequence CTCCTTTAGCAACTAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125923717 Original CRISPR CTCCTTTAGCAACTAGATTT TGG (reversed) Intronic
900278265 1:1847484-1847506 CTCCTTCAGCCTCTAGATTAGGG + Intronic
905744992 1:40408004-40408026 CAACTTTAGCAACTGGATTTGGG - Intronic
910651712 1:89575244-89575266 CTCCTTTGGCCAGTAGATTTTGG + Intronic
912019297 1:105086609-105086631 CTCTCTTAGAAATTAGATTTAGG - Intergenic
916176073 1:162039798-162039820 CCCCTTTAACACCTTGATTTTGG + Intergenic
917719293 1:177770924-177770946 TACCTTTAGCAGCTAGATTAGGG - Intergenic
921322839 1:213959819-213959841 TTCCTTAAGTCACTAGATTTAGG + Intergenic
922108596 1:222534630-222534652 CACCTCTAGAAACTTGATTTGGG - Intronic
924199175 1:241641167-241641189 CTCCTATACCTGCTAGATTTAGG - Intronic
924888723 1:248250277-248250299 CTCCATAAGCAACTAAATTGAGG + Intergenic
1064370462 10:14748136-14748158 CTATTTTAGCAACTAGATTGTGG + Intronic
1065027199 10:21550206-21550228 ATCCTTTAGATAATAGATTTTGG + Intronic
1065088643 10:22206835-22206857 ATCCATTAGCAGCTGGATTTAGG + Intergenic
1066590379 10:36988079-36988101 CTTCTTTCTCAACTAGGTTTGGG + Intergenic
1070868234 10:79723545-79723567 CTCTTTTAACAACTAGCTCTTGG + Intergenic
1071635146 10:87245746-87245768 CTCTTTTAACAACTAGCTCTTGG + Intergenic
1071660099 10:87492246-87492268 CTCTTTTAACAACTAGCTCTTGG - Intergenic
1071742448 10:88375683-88375705 CTCCTTTTGCACAAAGATTTAGG + Intronic
1072916886 10:99542685-99542707 CTCCCTTAGGAACTAGACCTAGG + Intergenic
1074738719 10:116463746-116463768 ATCTTTGAGAAACTAGATTTTGG - Intronic
1075324402 10:121519201-121519223 CTCCATGAGCAACTAGACATGGG + Intronic
1076178370 10:128386306-128386328 CTCCTCTAGGAACTTGATTCAGG - Intergenic
1079297134 11:19243088-19243110 CTGCTTTAGCCACTAGCTGTTGG + Intergenic
1080224044 11:29940084-29940106 CTGCTTTGGCAAGTAGATATTGG + Intergenic
1081071434 11:38615072-38615094 CTGCTTTATCAACTAAGTTTAGG + Intergenic
1082230114 11:49753754-49753776 CTGCTTTATCAACTAGATTTAGG - Intergenic
1085897719 11:80660004-80660026 CTTCTTTCTCAACTAGGTTTGGG - Intergenic
1086619936 11:88875194-88875216 CTGCTTTATTAACTAGATTTAGG + Intronic
1087149316 11:94844371-94844393 ATCCTTAACCAACTGGATTTGGG - Intronic
1087647334 11:100823409-100823431 CTTTTTCAGCAACTAGAGTTAGG + Intronic
1087952603 11:104241641-104241663 TTCCTTCAGGAAATAGATTTTGG + Intergenic
1088157043 11:106819274-106819296 CTGCTTTATCAACTAATTTTAGG - Intronic
1088684981 11:112277118-112277140 TCCCTTTCTCAACTAGATTTTGG + Intergenic
1088765153 11:112968047-112968069 CTTCTTTAGCAACTATCCTTTGG + Intronic
1089569079 11:119390600-119390622 TTTTTTTAGCCACTAGATTTTGG - Intergenic
1091043514 11:132304581-132304603 CTCCTTTAGGAACCTGATTTTGG + Intronic
1092811209 12:12272919-12272941 TTCCTTTAACAATAAGATTTGGG - Intergenic
1096440552 12:51639353-51639375 CTACTTTATCAACTAAGTTTAGG - Intronic
1096964540 12:55615324-55615346 CTGTTTAAGCCACTAGATTTTGG - Intergenic
1097336208 12:58386232-58386254 CACCTTGAGCAAGTTGATTTTGG + Intergenic
1098049734 12:66441011-66441033 CTGCTTTAGGAACTGGATTTTGG - Intronic
1098878269 12:75889833-75889855 CTCAAATAGCAACTAGAATTTGG - Intergenic
1099252658 12:80275788-80275810 CTCCTTCAGCAAAAAGATTATGG + Intronic
1099745460 12:86697204-86697226 CTACTTTAGCGAATATATTTAGG - Intronic
1099793745 12:87369594-87369616 CTCTTTTAGCAAGTAGAACTAGG - Intergenic
1100371750 12:93975098-93975120 TTCCTTTAGCAACTCCATTTGGG - Intergenic
1100927675 12:99568006-99568028 CTCATTTAACCACTGGATTTTGG - Intronic
1106564868 13:30875419-30875441 GTCCTTCAGCAACTAGATATCGG + Intergenic
1107284788 13:38778877-38778899 CTCCGGTATCACCTAGATTTTGG - Intronic
1107460190 13:40594481-40594503 CTCTTTCAGTAACTAGATTTAGG - Intronic
1107662345 13:42651543-42651565 CTCCTTCTGCAGGTAGATTTGGG + Intergenic
1111146211 13:84184059-84184081 CTTCCTTATCAACTAGGTTTAGG + Intergenic
1111343191 13:86914462-86914484 GTCCTTTAGCCCCTTGATTTTGG + Intergenic
1112060422 13:95734169-95734191 GTCCTTTTGCATCTAGGTTTAGG + Intronic
1112242795 13:97698681-97698703 CAACTTTAGCAACTAGACTGTGG - Intergenic
1112492437 13:99879598-99879620 CTCCTTAAGAAACTAGACTCAGG - Intronic
1114515910 14:23300426-23300448 CTCCTTGGGAAACTGGATTTAGG - Intronic
1115285973 14:31712838-31712860 CTCCTTGACCAACTAAAATTGGG + Intronic
1117835150 14:59796834-59796856 CTCTTTCACCAACTAGATTGTGG + Intronic
1118616786 14:67579489-67579511 CTCCTTTACCAACAATCTTTTGG - Intronic
1120977278 14:90260137-90260159 CTCCTGTACCAACTAGAGTGGGG + Exonic
1125923717 15:43543572-43543594 CTCCTTTAGCAACTAGATTTTGG - Intronic
1126213446 15:46127006-46127028 CTGCTTTATCAACTAAGTTTAGG - Intergenic
1128001431 15:64196291-64196313 GTCCTTTAGGAACCATATTTGGG + Intronic
1130039744 15:80396109-80396131 CTCATTGAGGAATTAGATTTCGG - Intronic
1131022312 15:89109263-89109285 CTCCTTTGGTGACTAGATGTTGG + Intronic
1132035706 15:98482030-98482052 ATCCATTAGAAATTAGATTTGGG + Intronic
1137009283 16:35307531-35307553 TTGCTTTAGTAACTAGACTTAGG - Intergenic
1139783107 16:69368019-69368041 CTGCTTTAGGAACTGGTTTTGGG + Intronic
1141301892 16:82823941-82823963 CTTCCTTAGCAAATAGATTATGG + Intronic
1141304624 16:82850541-82850563 CTGCTTTATCAACTAAGTTTAGG - Intronic
1141843797 16:86593293-86593315 ATCCTTTAGCAAGTAGTTTTGGG - Intergenic
1143518821 17:7434087-7434109 CTCCTTCAGCAACCAGAGCTGGG - Intergenic
1144277458 17:13687441-13687463 CACATCTAGCATCTAGATTTTGG - Intergenic
1144909121 17:18665960-18665982 CTCTTTTACAAACTAGATTACGG + Intronic
1149206693 17:54255838-54255860 CTCCTTTAGAAATTTAATTTGGG - Intergenic
1149976142 17:61268256-61268278 CTACTTTCCCAACTAGATTGAGG - Intronic
1153403211 18:4704648-4704670 CTCCTACACTAACTAGATTTAGG + Intergenic
1159656981 18:71041837-71041859 CTGTTTTATCAACTAAATTTAGG - Intergenic
1160399113 18:78596306-78596328 CTCCTCTAGCCAATCGATTTTGG + Intergenic
1165640584 19:37382595-37382617 CAAATTTACCAACTAGATTTAGG + Intronic
1168060819 19:53891139-53891161 CTCCATTAGGAACCAGAGTTTGG - Intronic
925168453 2:1734938-1734960 CTGCTTTATCCACTAGGTTTAGG + Intronic
926993091 2:18701291-18701313 CTCATTTAGCAATTTGGTTTAGG - Intergenic
935366331 2:102295108-102295130 CTCCTTTTCCAAGTAGCTTTTGG - Intergenic
937809941 2:126187849-126187871 CTCTTTCAGCTACAAGATTTAGG + Intergenic
939256630 2:139751915-139751937 CTGCTTTAACAACTAGAATATGG - Intergenic
939585931 2:144005681-144005703 CTCTTTAAGCAACTAACTTTAGG + Intronic
940091571 2:149925406-149925428 ATCTTTTATCAACTAGATATTGG - Intergenic
940306644 2:152234179-152234201 CTTCTTGAGCACCTACATTTTGG + Intergenic
941055604 2:160784560-160784582 ATCCTTTAGCCAATAGATTCTGG - Intergenic
941244202 2:163076993-163077015 CTGCTTTATGAACTATATTTGGG - Intergenic
942127158 2:172838600-172838622 CTCTTTTATCACCTAGATATGGG + Intronic
942185452 2:173420918-173420940 CTCCTTTGACAATTAGATTGAGG + Intergenic
943169469 2:184378711-184378733 CAACTTTATCAACTAGATTATGG - Intergenic
943213315 2:184997702-184997724 CTGCTTTAGCAGCTAAGTTTAGG + Intergenic
944214424 2:197239782-197239804 TTGCTTTAGTAACTAGTTTTTGG + Intronic
946742180 2:222813668-222813690 CTACTTTGGCACCTAGGTTTGGG - Intergenic
947360721 2:229342754-229342776 ATCCTCTAGGAGCTAGATTTGGG + Intergenic
1169337903 20:4772255-4772277 CTCCCTGAGCAACTAAAATTAGG - Intergenic
1169944960 20:10978632-10978654 CTCCTTGAGCAACATAATTTGGG + Intergenic
1170010928 20:11723334-11723356 CTCCTTTAGCCAATAGAATTTGG - Intergenic
1170468979 20:16649343-16649365 CTTCTTTAGCAACTATCTTAAGG - Intergenic
1172539797 20:35702431-35702453 CTCTGGTAGCAACTAAATTTTGG + Intergenic
1172623974 20:36336963-36336985 CTCCTACAGCAAATACATTTTGG + Intronic
1173350123 20:42237222-42237244 CTCTTTAAGCCATTAGATTTTGG + Intronic
1177413647 21:20766385-20766407 CTGCTTTATCAACTACATTATGG + Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1183289223 22:36988991-36989013 CTGCTTTAGCCACAAGACTTTGG + Intergenic
1183559690 22:38562055-38562077 CTGATTCAGAAACTAGATTTTGG + Intronic
950140149 3:10609659-10609681 CTCCTCTGCCAACTAGGTTTTGG + Intronic
951466888 3:23010558-23010580 ATCCATTAGCAACTTGATCTTGG + Intergenic
951720950 3:25697522-25697544 CTCGTTTAGTAACTATTTTTGGG + Intergenic
953100146 3:39816657-39816679 CTCCATTAGCCACTCCATTTGGG - Intronic
953911781 3:46896844-46896866 CACCATTAGCACTTAGATTTGGG + Intronic
956377950 3:68635784-68635806 CTCCTGTACCAACTAGAGTGGGG + Intergenic
957645417 3:82915967-82915989 CTGCTTTATCAACTAAGTTTAGG + Intergenic
957645433 3:82918017-82918039 CTGCTTTATCAACTAAGTTTAGG - Intergenic
962003351 3:131323559-131323581 CTCCTTTGGCAACTACAAATGGG - Intronic
962029039 3:131579903-131579925 CTGCTTTATCAACTAAATTTAGG - Intronic
963326663 3:143870585-143870607 CTCCATTAGCATATAGCTTTTGG + Intergenic
963786691 3:149542000-149542022 CTATTTAAGCAACTACATTTTGG + Intronic
964141014 3:153399333-153399355 TTTCTTTATCAACTGGATTTTGG - Intergenic
964887287 3:161499160-161499182 CTCCTTTAGGACCTAGAAATGGG - Exonic
967550709 3:190792000-190792022 TTCCTTTAGCAAGGAGAATTGGG - Intergenic
969911209 4:10448101-10448123 TTCATCTAGCAACTAGAATTAGG + Intronic
970955054 4:21801355-21801377 CTCTTTTGGCAACTAGAGGTTGG - Intronic
971708959 4:30086486-30086508 CTGCTTTATCAACTATGTTTAGG + Intergenic
973233755 4:47872978-47873000 CTGCTTTATCAACTAAGTTTGGG + Intronic
974991426 4:69095220-69095242 CTCCTTGAGGAGCTGGATTTAGG - Intronic
975133877 4:70855425-70855447 CTGCTTTATCAACTAAGTTTAGG - Intergenic
975256454 4:72241729-72241751 CTTCTTTTGAAACTAAATTTTGG + Intergenic
975916978 4:79336844-79336866 CTTTTTAAGCAACTAAATTTTGG - Intergenic
976601661 4:86943508-86943530 CTCCTTTGGAAACTAGATTGTGG + Intronic
976850514 4:89540129-89540151 TTCCATCAGCAACAAGATTTTGG + Intergenic
977742101 4:100497674-100497696 CTTCTTTAAAAACTTGATTTGGG - Intronic
984196421 4:176663112-176663134 CTCCTTCATCATCTTGATTTTGG + Intergenic
985900554 5:2786519-2786541 CTGCTTTATCAACTAAGTTTAGG - Intergenic
986950007 5:13071531-13071553 CTGCTTTAGCAAGGAGATTGGGG - Intergenic
987822206 5:22980295-22980317 ATCCTATAGAAACTAGCTTTTGG + Intergenic
988475159 5:31578232-31578254 CTCCTTTAGAAAATAGTTTCTGG + Intergenic
988503478 5:31802163-31802185 GTCTTCTAGCAACTAGCTTTGGG + Intronic
989025202 5:37060089-37060111 CTCCTTTGGCAACAAGCTTATGG - Intronic
990248535 5:53889005-53889027 TTCCTTTATGTACTAGATTTTGG - Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991999954 5:72426410-72426432 TTCCTTAAGCAACTAAGTTTTGG + Intergenic
992015415 5:72570263-72570285 GTCTTTTAGCAAATAAATTTGGG + Intergenic
997396940 5:133568595-133568617 CTCCTTCAGGAACCAGAGTTTGG - Intronic
1000048855 5:157544797-157544819 CTTCTCTAGCAACCAGTTTTTGG + Intronic
1000130541 5:158293370-158293392 TTCCTTAAGCCACTTGATTTTGG - Intergenic
1000679251 5:164162134-164162156 ATCTTTGAGCAACTATATTTAGG + Intergenic
1000915710 5:167078665-167078687 CTCCTCTGGCAAATAGAGTTAGG + Intergenic
1002175153 5:177397482-177397504 ATCCTTTAGCTGCTGGATTTTGG + Intronic
1004246802 6:13985812-13985834 CTCCTTTAACAACCAGCTCTTGG - Intergenic
1004466814 6:15893161-15893183 CTCCTTTCTCAATTAGTTTTGGG - Intergenic
1005376859 6:25191685-25191707 ATCCTCTAGCACCTAGATTGTGG - Intergenic
1005972810 6:30774725-30774747 CTCCTTTAGCATCTAAGTCTCGG + Intergenic
1009313872 6:62193029-62193051 CTCCCTTAGCATCAATATTTTGG + Intronic
1010202280 6:73293172-73293194 TTCTTTTAGAAGCTAGATTTTGG + Intronic
1010869399 6:81019465-81019487 ATCCTTTATCAACAACATTTTGG + Intergenic
1013047427 6:106500828-106500850 ATATTTTAGAAACTAGATTTTGG + Intergenic
1013286253 6:108684709-108684731 CTCTTTTACAAACTAGATTACGG - Exonic
1014670330 6:124296295-124296317 TTCCTCTAGCAACTCCATTTAGG - Intronic
1014814464 6:125920434-125920456 CTCTTTTAGCCTTTAGATTTAGG - Intronic
1015086476 6:129299228-129299250 CTCCTTCAGTAACTAGTTCTGGG + Intronic
1015642750 6:135354138-135354160 TTCTTTTAGCAAATGGATTTTGG - Intronic
1015992588 6:138962204-138962226 GTCCTTTAGCAAGTAGGTTAAGG + Intronic
1017219067 6:151944756-151944778 CTCATTTACCAAAAAGATTTAGG + Intronic
1017634230 6:156427731-156427753 TTCTTTAAGCAACTAGATTTGGG + Intergenic
1021016904 7:15547153-15547175 GTTCTTTAGCACCTAGATTTAGG + Intronic
1021061797 7:16121779-16121801 TTGCTTTAGCAACTTGATTCTGG - Intronic
1021221616 7:17980777-17980799 CTGCTTTATCAACTAAGTTTAGG + Intergenic
1021632306 7:22659328-22659350 CTCCTTTAGTCAGTAGATTCTGG - Intergenic
1022981037 7:35605208-35605230 CTAATTTAGGTACTAGATTTTGG - Intergenic
1023753530 7:43394517-43394539 CTCCTTGAGCAACTAAAATTGGG + Intronic
1028065040 7:86373618-86373640 CTGCTTTATCAACTAAGTTTAGG - Intergenic
1028294922 7:89116729-89116751 TTCCTCTAGCAACTACATTTCGG + Intronic
1029377853 7:100191878-100191900 CTGCTTTATCAGCTAAATTTAGG + Intronic
1032934565 7:136713950-136713972 CTCCTGTACCAACTAGAGTGGGG + Intergenic
1036190237 8:6663371-6663393 CACCTTTAGCAACAAGAACTTGG - Intergenic
1037648480 8:20815423-20815445 CTCCTCTAGCAAATAGAATATGG + Intergenic
1038856038 8:31334487-31334509 CACCTTTAGCAACTAGTTTCTGG + Intergenic
1039146497 8:34452697-34452719 CTCCTTGAGGAAAGAGATTTCGG + Intergenic
1039239270 8:35537376-35537398 CTCCTTTTGAAAATAAATTTAGG + Intronic
1041086805 8:54264193-54264215 TTCCTTTATAAACTAGATGTAGG - Intergenic
1043615848 8:82124674-82124696 CTAGTTTAGAAAATAGATTTGGG - Intergenic
1046324562 8:112623947-112623969 CTCTCTTAACATCTAGATTTGGG - Intronic
1048129195 8:131674785-131674807 CTGCTTTATCAACTAAGTTTTGG + Intergenic
1051063394 9:13072280-13072302 CTTTTTTAGCAAGTAGATTATGG - Intergenic
1052396686 9:27947552-27947574 CTTCCTTACCAATTAGATTTTGG - Intergenic
1056959233 9:91107183-91107205 CTCCATTAGCAACAAGATTATGG - Intergenic
1057936448 9:99243439-99243461 ATCATTTAGAAACTATATTTTGG + Intergenic
1058098965 9:100897142-100897164 TTCACTTAGCAACTAGATTCTGG - Intergenic
1187136873 X:16556398-16556420 CTCCTTGACCAACTAAAATTGGG - Intergenic
1199392267 X:147294402-147294424 CTACTTTAGCTATTATATTTTGG + Intergenic
1202167327 Y:22003792-22003814 CACCTTTAGTAACTACATTGAGG + Intergenic
1202224033 Y:22582577-22582599 CACCTTTAGTAACTACATTGAGG - Intergenic
1202319082 Y:23613084-23613106 CACCTTTAGTAACTACATTGAGG + Intergenic
1202551687 Y:26056973-26056995 CACCTTTAGTAACTACATTGAGG - Intergenic