ID: 1125925389

View in Genome Browser
Species Human (GRCh38)
Location 15:43558883-43558905
Sequence CAGTGTTTCCAGAGGGTAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125925389 Original CRISPR CAGTGTTTCCAGAGGGTAGA TGG Exonic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
902108205 1:14055743-14055765 TAGAGATTCCAGAGGGTAGAGGG - Intergenic
902663312 1:17920437-17920459 CAGTGGAGCCATAGGGTAGAAGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903434669 1:23338062-23338084 CTGTGTTTTCCCAGGGTAGAAGG - Intronic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
907566291 1:55437362-55437384 CAGTGGTTCCATGGGGTAGGAGG + Intergenic
907879807 1:58537347-58537369 CAGTGATTCCACAAGGTACAAGG + Intronic
909000829 1:70215739-70215761 CAGGGTTCCCAGTGGGTAGCGGG + Intronic
909196244 1:72628167-72628189 CAGTGCTCCCAGAGAATAGAAGG - Intergenic
909417223 1:75420101-75420123 CTGTGTTTTCATAGGGTAGAAGG - Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
913075246 1:115336514-115336536 CAGTGTTTCCAGAGGGTCAGAGG - Intronic
913331826 1:117674088-117674110 CACTGTTGTCAGAGGGTAAAGGG - Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
917348727 1:174055911-174055933 CAAAGCTTCCACAGGGTAGAAGG + Intergenic
921898693 1:220427703-220427725 AATTGTTTCCAGAGACTAGAAGG + Intergenic
922568943 1:226620958-226620980 CAATTTTTCCAGAAAGTAGAAGG - Intergenic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
922982407 1:229838758-229838780 CATTGTTTCCAGAGGGGCGAGGG - Intergenic
923381447 1:233423534-233423556 CAGTGTGTGCAGAGGTTACATGG + Intergenic
923841475 1:237676411-237676433 CATTCTATCCACAGGGTAGAGGG + Intronic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
924481219 1:244436054-244436076 CAGTGTTTCCAGGGGAAAAAAGG - Intronic
1067271874 10:44798734-44798756 CAGTCTTGCCAGAGAGTAAAGGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1070036347 10:72728934-72728956 CTATGTTTCCAGTGAGTAGAGGG + Intronic
1070236439 10:74632448-74632470 TAGAGTTTTCAGAGGGTACAAGG - Intronic
1070787066 10:79168076-79168098 AATTGGCTCCAGAGGGTAGAGGG - Intronic
1070996114 10:80784470-80784492 CTGTGTTCCCACATGGTAGAAGG - Intergenic
1072228911 10:93396511-93396533 CAGTGTTTCCAAAGGGTGACTGG - Intronic
1074010396 10:109472942-109472964 CAGTGTTTTCTGAAGGTCGAGGG + Intergenic
1076391687 10:130108144-130108166 CACTGTTTCCAGTGGATACAAGG + Intergenic
1077219046 11:1407327-1407349 CGGTGTTGCCAGAGGGCATAGGG - Intronic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1080661258 11:34297961-34297983 CAGTGTTTGTATATGGTAGAAGG - Intronic
1082581986 11:54882416-54882438 CAGTGTTTCCAGAATGCTGAAGG - Intergenic
1083052522 11:59789901-59789923 CAGTTCTTCCAGAGCCTAGAAGG + Intronic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1087718497 11:101636193-101636215 CACTGATTCCAGAGGGGTGAGGG + Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1090216876 11:124975166-124975188 CAGTGTTTCCAGATGATGGAAGG + Exonic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG + Intergenic
1091305222 11:134532141-134532163 CATTGTTTCCTGAGGGTCCAGGG + Intergenic
1092069744 12:5623027-5623049 AAGTGTTTCCAGAGGCCAGGTGG + Intronic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1094053126 12:26242371-26242393 TAATGTTTGCAGAGGGCAGAGGG - Intronic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1097205138 12:57314601-57314623 CAGTTTTCCCAGAGGTTAGCAGG - Intronic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1098322099 12:69256197-69256219 TAGTGGTTCCATAGGGTACAGGG + Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1100443068 12:94635456-94635478 CAGTGTTTGCAAACTGTAGAAGG + Intronic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1102182508 12:110923084-110923106 TAGGTTTTCCAGAGGGTAAAAGG + Intergenic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102747836 12:115265565-115265587 TAGTGCTTCCAGAAGTTAGAAGG + Intergenic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1105454093 13:20525146-20525168 CGATGTTTCCAGAGGGGAGGTGG - Intronic
1105883125 13:24620974-24620996 CAGTGTTTCCAGAGGGGATTAGG + Intergenic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1110780986 13:79464734-79464756 CAGTGTTTTCAGACGGTGGTGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113229163 13:108194343-108194365 AAGTGTTTCCAGATCGTAGGTGG + Intergenic
1117034660 14:51715644-51715666 CAGTATTTCCAGAAGGCAAAGGG + Intronic
1118606797 14:67510123-67510145 CAGTGTTTCCAGCTGTGAGATGG + Intronic
1118866468 14:69708328-69708350 TAGTTTTTCCACAGGGTAAAAGG + Intronic
1120076433 14:80164106-80164128 AATTGTTTCCAGAAGATAGATGG + Intergenic
1120826795 14:88963353-88963375 CAGTGCTTTCAGAGGCCAGAGGG + Intergenic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1121582166 14:95039378-95039400 CAGGGCATCGAGAGGGTAGAGGG + Intergenic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1121885057 14:97535377-97535399 CAGAGATTCCACAGGGTAGTGGG + Intergenic
1122474578 14:101998161-101998183 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474597 14:101998255-101998277 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474615 14:101998349-101998371 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1125526902 15:40382347-40382369 CAGTGTTCTCAGTGGGTGGAAGG - Intergenic
1125583395 15:40803424-40803446 CAGTGTATCCAAAGTGTAAATGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1127299063 15:57634788-57634810 CTGTTTTCCCAGGGGGTAGAAGG - Intronic
1131659736 15:94501029-94501051 CATTGTTTCCAGGGGCTAGAGGG - Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133717027 16:8459595-8459617 CAGAGTTTCCAAGGGGGAGATGG - Intergenic
1135796379 16:25446903-25446925 GAGTGTTTCCAAACGGGAGATGG - Intergenic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1139698993 16:68695677-68695699 CAGAGTATCCAAAGGGTAGGGGG + Intronic
1140633542 16:76883280-76883302 CATTGATTCCAGAGAGTATATGG - Intergenic
1141344443 16:83232038-83232060 CGGGCTTTTCAGAGGGTAGAGGG + Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142422164 16:89978284-89978306 CTGTGTCTCCACAGAGTAGAAGG + Intergenic
1142549617 17:730549-730571 CAGTGTTTCCAGAGAGTGACAGG - Intergenic
1142666785 17:1467902-1467924 CAGAGATTCCTGAGGGGAGAGGG + Exonic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144400567 17:14895112-14895134 CAGGAACTCCAGAGGGTAGAGGG + Intergenic
1144934005 17:18883127-18883149 CAGTGGTTCCCTAGGGTGGAAGG - Intronic
1146874793 17:36400512-36400534 CAAAGTTTCCACAGGGGAGAGGG - Intronic
1147064594 17:37912367-37912389 CAAAGTTTCCACAGGGGAGAGGG + Intergenic
1148739286 17:49883159-49883181 CAGTGTTTCCTGAGAGTTGGGGG + Intergenic
1148939274 17:51193972-51193994 CAGTGTTTCTAGAGAGGGGAGGG - Intronic
1150119485 17:62588301-62588323 CAGTGTTTCAAAAGGCTAGATGG - Intronic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150981115 17:70142602-70142624 CTGTGTTTCCACAGGGTAGAAGG - Intergenic
1151104232 17:71593993-71594015 CAGTGTATACAGAGGTTAGCGGG - Intergenic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153215910 18:2821029-2821051 CTGTGTTTCCAGACTGTAGGTGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156179345 18:34584794-34584816 AAGTGTTTTCAGAGAGAAGAAGG + Intronic
1158502076 18:58011408-58011430 AAGTGTTTCCATAGGGAACAGGG - Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1161121759 19:2530935-2530957 CAGGGTTTCCTGAGGAGAGAAGG + Intronic
1162430866 19:10627643-10627665 GGGTGTTTGCAGAGGGCAGATGG + Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167985109 19:53308299-53308321 CAGGGTTTCCAGTAGCTAGAGGG - Intergenic
926782195 2:16483576-16483598 AAGTTTTTACAAAGGGTAGAAGG + Intergenic
927516705 2:23675789-23675811 CAGTGTTGCCTGAAGTTAGAGGG + Intronic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
933934287 2:87188501-87188523 CAGAGATCCCAGGGGGTAGAGGG - Intergenic
934519425 2:95010576-95010598 CACAGTCTCCAGATGGTAGAGGG + Intergenic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934557661 2:95296031-95296053 GACTGTTTCCAGAGGGGAGGTGG - Intergenic
935619005 2:105112621-105112643 CAGTGTTTCCTGGGGTGAGAGGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936249381 2:110855875-110855897 CAAAGTTTCCACAGGGTGGAAGG + Intronic
936358855 2:111777394-111777416 CAGAGATCCCAGGGGGTAGAGGG + Intronic
939473108 2:142650526-142650548 CATTATTTCCAGAGGTGAGAAGG + Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941046377 2:160680261-160680283 CAGTATTTCCAGATGGTTCAAGG - Intergenic
941339153 2:164284655-164284677 ACTGGTTTCCAGAGGGTAGAGGG + Intergenic
941615490 2:167713941-167713963 CATTGTTTCCAGTGGATACAAGG - Intergenic
942701792 2:178719502-178719524 CAATATTTCCAGGGGGTGGAGGG - Intronic
944308771 2:198208456-198208478 GAGTGTTTACAGATGGTACATGG + Intronic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
944889730 2:204104967-204104989 CAGTGGTTCCAGAGGGTTCTCGG + Intergenic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
946826344 2:223682197-223682219 TAATGCTTCCAGAGGGTACATGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
1168901880 20:1371681-1371703 CTGTGTTTCTAGAAGCTAGAGGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170816693 20:19720311-19720333 CAATGCCTCCAGAGGGGAGAGGG - Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173725745 20:45296345-45296367 CAGTGTTTTCAAAGGTTAAATGG - Intronic
1174553275 20:51376476-51376498 CCATCTTTACAGAGGGTAGAGGG + Intergenic
1177152911 21:17472576-17472598 CGGAGTTCCCAGAGGATAGAAGG - Intergenic
1178267806 21:31160300-31160322 AAGGGTATCCAGAGGGTAAAAGG + Intronic
1180590348 22:16931973-16931995 TTATGGTTCCAGAGGGTAGAAGG + Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1182757274 22:32690210-32690232 CTGTATCTCCACAGGGTAGAAGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
949119207 3:365414-365436 CAGTGTCTCCAGAGCCTAGAAGG - Intronic
950081930 3:10228797-10228819 CAGTGTTTCCTGAGGGCATTTGG + Intronic
950626133 3:14248513-14248535 GAGTGGTTCAAAAGGGTAGAGGG - Intergenic
950796860 3:15517171-15517193 GAGAGTTTCCAGAGGATAGGAGG + Intronic
953444918 3:42955027-42955049 CAGTGTTTCCAGTAGGCATAAGG + Intronic
954692091 3:52401051-52401073 CAGTATTTACAGGGGCTAGAGGG + Exonic
955910488 3:63854674-63854696 CAGTCTTTCCAGGAGCTAGATGG - Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956392044 3:68784668-68784690 CAAAGTTTCCACAGGGTGGAAGG + Intronic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
957635009 3:82771347-82771369 CTGTATTTCCAGAGCCTAGATGG + Intergenic
958576124 3:95951299-95951321 CAAAGCTTCCAAAGGGTAGAAGG + Intergenic
959374330 3:105569783-105569805 CAGTGTTTCCTTGGGGCAGATGG + Intronic
960608248 3:119530454-119530476 CTGTGTTTCCAGTAGCTAGAGGG - Intronic
961068749 3:123900308-123900330 CAGTTTTTCCAGTGGGTACATGG - Intronic
963960647 3:151305318-151305340 CAGTCATTCCTGAGGTTAGATGG + Intronic
966098275 3:176232972-176232994 CAGTGGTTACCAAGGGTAGAAGG + Intergenic
966402276 3:179560294-179560316 CAGGCTTTCCAGAGGCTAGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
967979007 3:195054338-195054360 CAGTTTCTCCAGAGAATAGAAGG + Intergenic
971059470 4:22951428-22951450 ATGTGTTTCCAGGTGGTAGAGGG - Intergenic
971118880 4:23681537-23681559 CAGTGTGTCCAGTGGGTCCAAGG - Intergenic
972645547 4:40964659-40964681 CATTGTTTCCAGTGGCTGGATGG - Intronic
974483398 4:62475067-62475089 CAGTGCTTTCAGAGGGAACATGG - Intergenic
979264646 4:118687094-118687116 CAGTGTTTGCACAGGGTTGTGGG - Intronic
982069705 4:151684554-151684576 TAATGTTTCCAGAGCTTAGAAGG - Intronic
982968991 4:161955934-161955956 CAGTGTTCCGAGAGTGTAGAAGG - Intronic
983636494 4:169902765-169902787 CATAATTTCCATAGGGTAGAAGG + Intergenic
984053831 4:174900881-174900903 CAGAGTTTCCAGAGAGGATATGG + Intronic
988704929 5:33716194-33716216 CTGTGTCTCCACATGGTAGAAGG - Intronic
991403463 5:66278015-66278037 CACTATTCTCAGAGGGTAGAAGG + Intergenic
992200436 5:74378631-74378653 CAGTGTTTCCCAAGTGTAGCTGG + Intergenic
993183436 5:84585271-84585293 CAGATTTTCTAGAAGGTAGAGGG + Intergenic
996676964 5:126187331-126187353 TAGTGGTTCCAGAGGCTGGAGGG + Intergenic
997084035 5:130775198-130775220 CTTTTTTTCCAGAGGGTTGAGGG + Intergenic
997150365 5:131487303-131487325 CAAAGCTTCCAGAGGGTGGAAGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997773305 5:136574490-136574512 TAGTCTTTTCAGAGGGTTGATGG - Intergenic
999527605 5:152424602-152424624 CAGAGCTTCCAAAGGGTAAAGGG - Intronic
1000257487 5:159554049-159554071 CAGAGCTTTCAGAGTGTAGAAGG + Intergenic
1001066497 5:168538915-168538937 AGGTGTTTTCAGAGGCTAGAAGG - Intergenic
1002273170 5:178086304-178086326 CAGTGTCTCCCGAGGGTACCTGG + Intergenic
1002522217 5:179798213-179798235 CAGTGCTTCCAGAGGGCCGAAGG + Exonic
1004835961 6:19531794-19531816 CAGGGTTTCCAGCTTGTAGATGG + Intergenic
1005835951 6:29709794-29709816 CACAGTTGCCAGAGGGTAAAAGG - Intergenic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1007362250 6:41367334-41367356 CAGTGTTTCCAGAGATCACATGG - Intergenic
1009063462 6:58425932-58425954 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009251127 6:61300518-61300540 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1015305985 6:131708885-131708907 CATTGTTTCCAGTGGATACAAGG - Exonic
1016021447 6:139240130-139240152 TAGTGTTTCTAGAAAGTAGATGG + Exonic
1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG + Intergenic
1018141659 6:160843765-160843787 CAGTGTACCCAGAGAATAGATGG - Intergenic
1018549716 6:164981782-164981804 CTGTGTTTGTACAGGGTAGAAGG - Intergenic
1018938105 6:168287192-168287214 CACTGTTTCCAGTGGATACAAGG - Intergenic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1023069554 7:36415887-36415909 CAGTGTTTCCAGATTGTTCATGG + Intronic
1023531739 7:41163956-41163978 AATTGTTTGAAGAGGGTAGAGGG + Intergenic
1025588970 7:62830946-62830968 CAGTGTTTCCAGACTGTTGAAGG - Intergenic
1025589609 7:62840538-62840560 CAGTGTTTCCAGACAATTGAAGG - Intergenic
1025590813 7:62858496-62858518 CAGTGTTTCCAAACTGTGGAAGG - Intergenic
1025599175 7:62973288-62973310 CAGTGTTTCCAGACTGCTGAAGG - Intergenic
1027729468 7:81851909-81851931 CAGTTTTTGCAGAGGATATAAGG - Intergenic
1028336163 7:89658725-89658747 AAGTTTTCCCAGAGGGTAGTTGG + Intergenic
1028649666 7:93137616-93137638 CAATTTTTCCACAGGGTAGTGGG - Intronic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033678992 7:143573928-143573950 CATTGTTTCCAGTGGATACAAGG + Exonic
1033692846 7:143755526-143755548 CATTGTTTCCAGTGGATACAAGG - Exonic
1033731565 7:144185614-144185636 CATTGTTTCCAGTGGATACAAGG + Exonic
1033740100 7:144267118-144267140 CATTGTTTCCAGTGGATACAAGG - Exonic
1034456938 7:151175727-151175749 CAGGGTTTGCACAGGCTAGAAGG + Exonic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038474390 8:27854207-27854229 CAGTGTTTGCTGAAGGTAAATGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040567751 8:48582487-48582509 CAGTGTTTCCAGATGGCCGCTGG - Intergenic
1040779147 8:51086395-51086417 CAGTGTTCACAGAGGCTAGTGGG - Intergenic
1041777290 8:61537210-61537232 CACTGTTTCCAGCTGGTAGGTGG - Intronic
1042549399 8:69980947-69980969 CACTGTTTCCAGAGTCAAGATGG - Intergenic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1044950515 8:97431409-97431431 CACTGTTTCTGGAGGCTAGAAGG - Intergenic
1045875613 8:106977541-106977563 CAGCGTATCCACACGGTAGATGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049832954 8:144713721-144713743 GAGTGCCTCGAGAGGGTAGAGGG + Intergenic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1055424804 9:76183219-76183241 CGTTGTTTCCAGAGCCTAGAAGG + Intronic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1056955272 9:91076090-91076112 CAGCCATTCCAGAGGGTGGAGGG - Intergenic
1057961274 9:99459606-99459628 CAGGGATTCCAGAGGATAGGTGG - Intergenic
1059935451 9:119305836-119305858 CACTGTTTCCTGGGGATAGAGGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186449578 X:9660960-9660982 CCGTGTTCCCACATGGTAGAAGG - Intronic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1186758625 X:12700041-12700063 CAGTCTTTACACAGGGCAGAGGG + Intronic
1187418534 X:19114471-19114493 CAGTGATTCCAGTGGGCAGCGGG + Intronic
1188368952 X:29345312-29345334 CAGTGCTTCCAAAAGATAGAGGG - Intronic
1189740264 X:44110678-44110700 CTGTGTTTGAAGAGTGTAGAAGG - Intergenic
1189808793 X:44761962-44761984 CACTGTTTCCTGTGAGTAGAGGG + Intergenic
1191669427 X:63735340-63735362 CTTTGTTTCCAGAAGGTAGGAGG + Intronic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1193835457 X:86337625-86337647 CAGTTTTTCCATAGTGTCGATGG - Intronic
1193888481 X:87013072-87013094 CAAAGTTTCCAGAGCGTGGAAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic