ID: 1125927696

View in Genome Browser
Species Human (GRCh38)
Location 15:43576742-43576764
Sequence GCACCCTGAAATGCTCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125927693_1125927696 14 Left 1125927693 15:43576705-43576727 CCGATACATGCAGAAACTTCTCT 0: 2
1: 0
2: 0
3: 12
4: 233
Right 1125927696 15:43576742-43576764 GCACCCTGAAATGCTCCAACTGG 0: 2
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125927696 Original CRISPR GCACCCTGAAATGCTCCAAC TGG Intronic
907416789 1:54319994-54320016 CCCCTCTGAAATGCACCAACAGG + Intronic
912945817 1:114083226-114083248 CCAGCCTGAAATGTTCCCACAGG + Intergenic
913171667 1:116238626-116238648 GGATCCTGAAACACTCCAACTGG - Intergenic
914934594 1:151967484-151967506 GCAACCTAAAATGCTCCAAAAGG - Intergenic
920799358 1:209173029-209173051 GCACCTTGAAGTGCTGCACCTGG - Intergenic
922368037 1:224884398-224884420 GAACCCTGAAATTATCCATCTGG + Intergenic
922970827 1:229736411-229736433 GGAAGCTGAAATGCTCCAATAGG + Intergenic
1067431243 10:46247486-46247508 TCACCCTGAAATTCTCCAGCAGG - Intergenic
1068324518 10:55466969-55466991 GCAGCCTGAAAGGCTCCCAGTGG - Intronic
1071300521 10:84252983-84253005 GCACCCTGGACTACTCCAAGGGG + Exonic
1074250596 10:111741791-111741813 GCACACTTAAATTCTCCATCAGG + Intergenic
1082072300 11:47948973-47948995 GTTCCCGGAAATGTTCCAACAGG + Intergenic
1086988264 11:93273667-93273689 GTATCCATAAATGCTCCAACTGG - Intergenic
1089327291 11:117666076-117666098 GAACCCTGTAATGCTCCGAGGGG + Intronic
1092282000 12:7104652-7104674 GCATCCTGAACTGCTGCAACAGG + Intronic
1093266925 12:17015264-17015286 TCACCCTGAAGTGCTCCACAAGG + Intergenic
1101905244 12:108819861-108819883 ACACACTCAAATGCTCCAAAAGG + Intronic
1103703725 12:122860566-122860588 GAACCCCAAACTGCTCCAACTGG - Intronic
1104092860 12:125530358-125530380 GCATCCTGTAAAGCTCCATCTGG + Intronic
1106960105 13:34988450-34988472 GCAGCCGGAAAAGCTCGAACTGG - Intronic
1107815220 13:44238741-44238763 GGACCCTGCAATTCACCAACTGG + Intergenic
1113720651 13:112553500-112553522 GCCCCCTGTCAGGCTCCAACAGG + Intronic
1114756188 14:25262866-25262888 GGACCCTGACATGCTGCATCTGG + Intergenic
1116791042 14:49340464-49340486 GCACCATGAAATGCTACGAATGG - Intergenic
1118344807 14:64930203-64930225 GGACTCTCAAAGGCTCCAACTGG - Intronic
1122184340 14:99978845-99978867 GCTTCCTGAGATGCTCCAAAAGG - Intronic
1125927696 15:43576742-43576764 GCACCCTGAAATGCTCCAACTGG + Intronic
1125940839 15:43676307-43676329 GCACCCTGAAATGCTCCAACTGG + Intergenic
1127326271 15:57898156-57898178 GAACCCTGCAATGCTCCCAGAGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134184096 16:12069656-12069678 GCACCCAGATATGCCCCAAAAGG - Intronic
1137310927 16:47257588-47257610 GAACCCTGAAGTGCTCCATTTGG + Intronic
1140277170 16:73520544-73520566 GCACCTTCAAATTCTCCATCTGG + Intergenic
1140689453 16:77467730-77467752 CCATCCTGAAATGCTCCAGTTGG + Intergenic
1141711945 16:85704881-85704903 GCACCTTGAAATTCTCAATCAGG - Intronic
1144957119 17:19024352-19024374 GCACCTTGAAGTGCTGCACCTGG + Exonic
1149192969 17:54086036-54086058 TCAACCTGAAATGCTGCAGCTGG + Intergenic
1153171243 18:2318485-2318507 AGAGCCTGAAATACTCCAACAGG + Intergenic
1155466673 18:26143394-26143416 GTACCCTGAACTGCTGCAATAGG + Intronic
1157338546 18:46758135-46758157 GCACCCTAGAATCTTCCAACCGG - Intronic
1158077323 18:53545720-53545742 GAAATCTGAAATGCTCCAATGGG - Intergenic
1164783934 19:30914446-30914468 GCACCCTGGCAGGCTTCAACTGG - Intergenic
1165367856 19:35380411-35380433 ACACCATGAAATGCACCCACTGG - Intergenic
1165427024 19:35752033-35752055 GCAGCCTGAAAGGGTGCAACAGG - Intronic
1166951240 19:46429231-46429253 CCAGCCTGAAATGCTCCCACTGG + Intergenic
930729509 2:54713872-54713894 GCATCCTGGAATAGTCCAACGGG - Intergenic
932851194 2:75188711-75188733 GTACCCTTGAATCCTCCAACTGG - Intronic
937918262 2:127111183-127111205 CCACCCCGAATTGCTCCACCTGG - Intergenic
947707218 2:232286040-232286062 GCCCTCTGCCATGCTCCAACAGG + Intronic
948386545 2:237584276-237584298 GCACCCTCCTACGCTCCAACCGG + Intronic
1179095489 21:38310878-38310900 GCACCCTGTAATGGCCCACCTGG - Intergenic
1182263584 22:29094366-29094388 ACACTCTGAAATACCCCAACGGG + Exonic
1182369036 22:29798097-29798119 GCACCATGGAATGGTCCAAAGGG + Intronic
1183740699 22:39666984-39667006 AGACCCAGAAATGCTCCAAAGGG - Intronic
950427010 3:12929806-12929828 GCCCCCTAAAATGCCCCAGCAGG + Intronic
951747831 3:25999079-25999101 GCAGCCTGAGATGCTCGAATTGG - Intergenic
953006163 3:38981307-38981329 GCACTCTGAATTTCTCCAACAGG - Intergenic
955136833 3:56227345-56227367 GCACACTGACAGCCTCCAACAGG + Intronic
961464725 3:127074318-127074340 GCACACGGATATGCTCCTACAGG - Intergenic
966987215 3:185192321-185192343 GAACCCTGATATTCCCCAACTGG - Exonic
967703680 3:192623803-192623825 GCACCATGAAAAAATCCAACAGG - Intronic
975448520 4:74497107-74497129 GCACCAAAAAAAGCTCCAACTGG - Intergenic
978663326 4:111153933-111153955 GCTCCCTGAAAGGCTGCAGCTGG + Intergenic
979292244 4:118990985-118991007 GCAGCCTGAACTGGGCCAACAGG + Intronic
983433979 4:167688250-167688272 GCAGCCTAAGAGGCTCCAACAGG - Intergenic
985502447 5:257517-257539 TCACACAGTAATGCTCCAACAGG - Intergenic
986073022 5:4306115-4306137 GCACCCCTAAAAGCTCCAAAAGG + Intergenic
987772179 5:22319759-22319781 GAACCCTGAAATGATCCCAATGG - Intronic
990331638 5:54732832-54732854 ACACCCAGAAATGCCACAACTGG - Intergenic
990617597 5:57523206-57523228 GCACACTAAAATGTTCCTACTGG - Intergenic
993861746 5:93145033-93145055 GCACCCAGAAAAGCTCCCAGTGG - Intergenic
995187021 5:109282014-109282036 TCACCCTGAAGTGTTCCAAAAGG - Intergenic
995413207 5:111881315-111881337 GCAGCCTGGGAAGCTCCAACTGG + Intronic
995423334 5:111991616-111991638 GCAGCCTGGGAAGCTCCAACTGG - Intronic
1001601867 5:172934283-172934305 GCACCTTGAAGTGCCCAAACTGG + Intronic
1007302158 6:40875709-40875731 GCACCACAAAATGGTCCAACTGG - Intergenic
1009324102 6:62328790-62328812 GCACCCTGAAACCCTCAAAGTGG + Intergenic
1012471365 6:99576224-99576246 GCACCATGTGCTGCTCCAACAGG + Intergenic
1015859115 6:137656843-137656865 GGACCCAGAAAAACTCCAACCGG + Intergenic
1019326777 7:442382-442404 GCACTCAGAAATGCCCCCACAGG + Intergenic
1021451853 7:20789852-20789874 GCACCCTGAAATGCTTTGCCAGG - Intergenic
1024175219 7:46833463-46833485 CCAGCCTGAAATGCTACATCTGG + Intergenic
1026653669 7:72237593-72237615 CCAACCTGAAATGCTCTAACAGG - Intronic
1044786600 8:95800501-95800523 GCACCCTACAATACACCAACTGG + Intergenic
1053181598 9:35976287-35976309 GAACCCAGAACTGGTCCAACTGG - Intergenic
1054810218 9:69428435-69428457 GCTCCCTGAAATGCTCACACTGG + Exonic
1055182117 9:73401565-73401587 TCACCCTGAATTGTTCCAAGAGG + Intergenic
1055940832 9:81647857-81647879 ACACCATGAAATGGACCAACAGG + Intronic
1057453679 9:95188350-95188372 GCTCCATGAAAAGCTCCCACTGG + Intronic
1194261347 X:91699784-91699806 GCAGCCTCAGATGCTCAAACTGG - Intergenic
1196147422 X:112333611-112333633 GAAATCTGAAATGCTCCAACTGG + Intergenic
1200579998 Y:4938585-4938607 GCAGCCTCAGATGCTCAAACTGG - Intergenic