ID: 1125928275

View in Genome Browser
Species Human (GRCh38)
Location 15:43581388-43581410
Sequence CAGTGATGCTATGTACCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125928275_1125928280 27 Left 1125928275 15:43581388-43581410 CCTGCAGGTACATAGCATCACTG 0: 2
1: 0
2: 0
3: 8
4: 98
Right 1125928280 15:43581438-43581460 GAGAAGACAATATGAGCACTAGG 0: 2
1: 0
2: 1
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125928275 Original CRISPR CAGTGATGCTATGTACCTGC AGG (reversed) Exonic
901529961 1:9846657-9846679 CAGTGCTGGTATTCACCTGCAGG + Intergenic
902815150 1:18912166-18912188 CCTTGAAGCTGTGTACCTGCTGG - Intronic
904597554 1:31656407-31656429 CAGGGATTCTATGGACCTCCTGG - Exonic
905738645 1:40350157-40350179 CACTGATGCTATCTAGCTGTTGG - Intronic
912032642 1:105268601-105268623 TAGTGCTGCAATGAACCTGCAGG - Intergenic
914821576 1:151108467-151108489 CAGTGATGTTGTGTACCTTTTGG + Intronic
918123136 1:181557182-181557204 AAGTCCTGCTATGGACCTGCAGG - Intronic
1064352829 10:14592341-14592363 CAGAGTTGCTACGAACCTGCTGG - Intronic
1066639842 10:37544758-37544780 AAGAGATGCAATCTACCTGCTGG - Intergenic
1069945394 10:71981943-71981965 CAGTGATGCTGCATCCCTGCTGG - Intronic
1078436286 11:11328393-11328415 CAGGGAGGCTATCTATCTGCGGG + Intronic
1081417962 11:42838389-42838411 AAGTAATGCTATGTGCCTACTGG + Intergenic
1083836293 11:65270709-65270731 CAATGATGCTGTGGACCTGGTGG - Intronic
1084282676 11:68108800-68108822 CTGTGATTCTCTGTATCTGCCGG - Intronic
1085185272 11:74570714-74570736 CACTGATGGTATGTACCTACAGG + Intronic
1085837486 11:79972433-79972455 CACTGGTGCTGTGTACCTCCAGG + Intergenic
1085921624 11:80964367-80964389 CTGTGATTCTCTGTATCTGCTGG + Intergenic
1088899511 11:114104607-114104629 CAGTGAAGGGATGGACCTGCAGG + Intronic
1091666641 12:2423643-2423665 CAGTTATGCCATTTACTTGCTGG - Intronic
1098708463 12:73722396-73722418 CAGAGATGCTATATAACTGTTGG - Intergenic
1109180757 13:59211809-59211831 CAGTGATGCTCTTTAAATGCAGG - Intergenic
1115376130 14:32677755-32677777 CAGTGATTTTATTTACATGCAGG - Intronic
1121583219 14:95046009-95046031 CAGTGCTGCCATCCACCTGCTGG - Intergenic
1123956903 15:25346015-25346037 CAGTGCTGCTGTGTACTGGCAGG + Intronic
1125493263 15:40165050-40165072 CAGTGAAGCCATGTCCCTGGAGG + Exonic
1125928275 15:43581388-43581410 CAGTGATGCTATGTACCTGCAGG - Exonic
1125941441 15:43681223-43681245 CAGTGATGCTATGTACCTGCAGG - Intergenic
1134448578 16:14349042-14349064 CAGAGATACTAAGTAACTGCAGG + Intergenic
1145817544 17:27806229-27806251 GAGTGATGCTCTGGAACTGCTGG - Intronic
1150235934 17:63592720-63592742 CCGTGATGCTAGGTAACTGTGGG + Exonic
1150593456 17:66582954-66582976 CATTGATGTTATGTACATCCTGG + Intronic
1151586121 17:75009417-75009439 AAGGGATGCTATGTGCATGCAGG - Intergenic
1155895123 18:31315663-31315685 AACTGTTGCTATGTACGTGCAGG + Intergenic
1157622694 18:49025443-49025465 CAGTCATGCTGTGTTCATGCAGG - Intergenic
1159995842 18:74963035-74963057 CAATGATTCTATGTGGCTGCTGG - Intronic
1164905755 19:31966645-31966667 GAGTGGGGCCATGTACCTGCCGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166858644 19:45796479-45796501 CAGTCATGCTATGCACATGCTGG - Intronic
1167126877 19:47555589-47555611 CAGTGATTCTGTGAAGCTGCTGG - Exonic
928148367 2:28803951-28803973 CAGTGCTGCTGTTTACCAGCAGG + Intronic
928309856 2:30200531-30200553 CAGTGATGCAAGTGACCTGCAGG + Intergenic
930138230 2:47924317-47924339 CAGTGATGTTATTCTCCTGCTGG - Intergenic
932262541 2:70338703-70338725 CGGGCATGCTAAGTACCTGCTGG - Intergenic
933920059 2:87036534-87036556 CAGTGATGCTACATACATACAGG - Intergenic
933931565 2:87157252-87157274 CAGTGATGCTACATACATACAGG + Intergenic
934002936 2:87733364-87733386 CAGTGATGCTACATACATACAGG + Intergenic
936361555 2:111808182-111808204 CAGTGATGCTACATACATACAGG - Intronic
941317250 2:164008736-164008758 CATTGATGCTATGTGGCTGCAGG - Intergenic
944611984 2:201420087-201420109 CATTGTTGTTAGGTACCTGCAGG + Intronic
1174100650 20:48123963-48123985 CCGTGCTGCTATGTAACTGTGGG - Intergenic
1179936901 21:44611814-44611836 CAGTGATGCTGCGTGTCTGCTGG - Intronic
1184389830 22:44196952-44196974 CAGTGAAGCTGTGTCCCTGTAGG + Intronic
1185188661 22:49418723-49418745 CAGGGATGCGCTGCACCTGCTGG + Intronic
949133515 3:535269-535291 CAGTGAGGCCATGAACCTACCGG - Intergenic
949893399 3:8750177-8750199 AAGTGATGCCTTGTAGCTGCAGG - Intronic
950528654 3:13539866-13539888 CACTGAAGCTATGTTCCTGCTGG + Intergenic
951602986 3:24397655-24397677 CAGTGGTGCTATCTGCCTCCTGG + Intronic
956281744 3:67564530-67564552 CAGGGATGCATAGTACCTGCAGG - Intronic
964807040 3:160621652-160621674 CATTGGTGCTATGTATGTGCAGG + Intergenic
968330901 3:197869187-197869209 AAGCGATGCACTGTACCTGCAGG + Intronic
968330903 3:197869217-197869239 AAGCGATGCACTGTACCTGCAGG + Intronic
968330908 3:197869277-197869299 AAGCGATGCACTGTACCTGCAGG + Intronic
968330939 3:197869547-197869569 AAGCGATGCACTGTACCTGCAGG + Intronic
968330942 3:197869577-197869599 AAGCGATGCACTGTACCTGCAGG + Intronic
968330955 3:197869697-197869719 AAGCGATGCACTGTACCTGCAGG + Intronic
968330958 3:197869727-197869749 AAGCGATGCACTGTACCTGCAGG + Intronic
968330961 3:197869757-197869779 AAGCGATGCACTGTACCTGCAGG + Intronic
968330964 3:197869787-197869809 AAGCGATGCACTGTACCTGCAGG + Intronic
968330967 3:197869817-197869839 AAGCGATGCACTGTACCTGCAGG + Intronic
968330993 3:197870027-197870049 AAGCGATGCACTGTACCTGCAGG + Intronic
972170276 4:36337019-36337041 CAGGGATGCTAGGAACCTGTGGG + Intronic
977126673 4:93177683-93177705 GACAGATTCTATGTACCTGCTGG - Intronic
980722284 4:136714708-136714730 CATTGAAGTTATGTACTTGCTGG - Intergenic
982786766 4:159545364-159545386 GATTGATGCTATCTACTTGCTGG - Intergenic
984519040 4:180778424-180778446 CAGTGCTGCTATGAACGTGGGGG + Intergenic
984853199 4:184171381-184171403 AAGTGATGCTATGTAACTTCTGG - Intronic
987193551 5:15502198-15502220 CAGTGATTCTATGTACCCCTTGG - Intronic
991292739 5:65048481-65048503 CTGTGATGCTTTGTAACTGCTGG - Intergenic
994148892 5:96425251-96425273 AAGTGTTGCTGTCTACCTGCAGG - Intronic
997196200 5:131981701-131981723 CAGTGTTGCTATGAACATGATGG + Intronic
1002650179 5:180685749-180685771 CAGTGTTGCTGTGTTCCTTCTGG + Intergenic
1005186562 6:23168681-23168703 CAGTGAATGTATGTAGCTGCCGG - Intergenic
1011134529 6:84086008-84086030 CAGTGATTCTTGGAACCTGCAGG - Intronic
1013941469 6:115668033-115668055 CAGTGATGGTTTATACCTGAAGG - Intergenic
1014313415 6:119833116-119833138 CATTTATGCTTTCTACCTGCAGG - Intergenic
1014537814 6:122637400-122637422 CTGTGATGCTGTGTGCCTTCAGG - Intronic
1018078810 6:160240857-160240879 CAGTGCTGGTGTGTTCCTGCTGG + Intronic
1018303739 6:162431293-162431315 CATTGATGATATGTATCTGTTGG - Intronic
1018929761 6:168233415-168233437 CAGTGATGTTTTTTACATGCCGG - Intergenic
1020625264 7:10570139-10570161 GAGTGCAGCTGTGTACCTGCAGG - Intergenic
1021962032 7:25882506-25882528 CAGTGATGCTCAGTTCCTGGAGG - Intergenic
1023593363 7:41802259-41802281 CAGGGATGCTATTTCCCTTCTGG + Intergenic
1030529429 7:110694772-110694794 CAGTGCTACTATGAACATGCAGG - Intronic
1030715935 7:112806919-112806941 CAGTAATGCTGTGTTCCTGTAGG - Intergenic
1032954736 7:136957631-136957653 CAGTGCTGGTATGTACCTTGTGG - Intronic
1035894800 8:3387459-3387481 CAGTGAGGCAATGCACCAGCAGG - Intronic
1038485186 8:27930049-27930071 CGGTGATACTATCTGCCTGCAGG - Intronic
1039476199 8:37840609-37840631 CAGGGATGCAAGGTCCCTGCAGG - Intronic
1039600905 8:38836345-38836367 CAGAGATGCAATCTACCTGCTGG - Intronic
1039980229 8:42403419-42403441 CATTGCTGCTAAGTACATGCTGG + Exonic
1040837588 8:51748524-51748546 CAGTGATGCTGTGCTCCAGCTGG - Intronic
1042247419 8:66722050-66722072 CAGGAATGCTAGGTCCCTGCTGG + Intronic
1057279604 9:93700252-93700274 CAGTGGTGCTGTGAACCTGTTGG + Intergenic
1058901514 9:109446434-109446456 AAGTGATGCTGTGTTCCTGCTGG + Intronic
1061622381 9:131819231-131819253 CAGTGCTGCTATGAACATTCTGG + Intergenic
1194216922 X:91141763-91141785 TAGTGATGCAATGAACCTACAGG + Intergenic
1199032935 X:143022342-143022364 CTGTGATGATATCTACCTCCCGG + Intergenic
1201538999 Y:15085652-15085674 CTGTGGTGCTATGGACCTGGGGG - Intergenic