ID: 1125929570

View in Genome Browser
Species Human (GRCh38)
Location 15:43590592-43590614
Sequence AAATTTTAACAGATGTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125929569_1125929570 -5 Left 1125929569 15:43590574-43590596 CCAATAAATAAAGGTTGAAAATT No data
Right 1125929570 15:43590592-43590614 AAATTTTAACAGATGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125929570 Original CRISPR AAATTTTAACAGATGTAAAG AGG Intergenic
No off target data available for this crispr