ID: 1125929619

View in Genome Browser
Species Human (GRCh38)
Location 15:43591004-43591026
Sequence CTGTATATTCAGTAGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125929619_1125929626 25 Left 1125929619 15:43591004-43591026 CCCCGTCTCTACTGAATATACAG No data
Right 1125929626 15:43591052-43591074 ACCTGTAATCCCAGCTACTCGGG 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
1125929619_1125929622 -6 Left 1125929619 15:43591004-43591026 CCCCGTCTCTACTGAATATACAG No data
Right 1125929622 15:43591021-43591043 ATACAGAAATTAGCCGAGTGTGG 0: 10
1: 760
2: 11312
3: 57083
4: 101530
1125929619_1125929623 -3 Left 1125929619 15:43591004-43591026 CCCCGTCTCTACTGAATATACAG No data
Right 1125929623 15:43591024-43591046 CAGAAATTAGCCGAGTGTGGTGG 0: 10
1: 765
2: 12042
3: 68171
4: 154193
1125929619_1125929628 28 Left 1125929619 15:43591004-43591026 CCCCGTCTCTACTGAATATACAG No data
Right 1125929628 15:43591055-43591077 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1125929619_1125929625 24 Left 1125929619 15:43591004-43591026 CCCCGTCTCTACTGAATATACAG No data
Right 1125929625 15:43591051-43591073 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125929619 Original CRISPR CTGTATATTCAGTAGAGACG GGG (reversed) Intergenic
No off target data available for this crispr