ID: 1125932649

View in Genome Browser
Species Human (GRCh38)
Location 15:43611450-43611472
Sequence AAGAGGATAGAGACCTCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125932649 Original CRISPR AAGAGGATAGAGACCTCTGG CGG Intronic
906283013 1:44566752-44566774 GAGAGAAAAAAGACCTCTGGAGG + Intronic
906953070 1:50350010-50350032 ATGAGGGTAGATACTTCTGGAGG - Intergenic
907180779 1:52568242-52568264 AAGAGGAGAGAGACAGTTGGGGG - Intergenic
907748293 1:57237062-57237084 ATGGGGACAGAAACCTCTGGGGG - Intronic
910427484 1:87131739-87131761 AGGAAGAGAGAGACGTCTGGGGG + Intronic
911946186 1:104112466-104112488 AAGAGGATAAATCCCTCTGAGGG + Intergenic
913242957 1:116846081-116846103 AAGAAGGTGGAGAGCTCTGGGGG + Intergenic
913935465 1:125038227-125038249 GAGAGCTTAGAGAGCTCTGGTGG + Intergenic
916858697 1:168779308-168779330 AGGAAGATAGAGACTCCTGGAGG - Intergenic
917604246 1:176610088-176610110 AATAGGAAAGAGGCCTCTGAGGG - Intronic
919022113 1:192119483-192119505 AAGAGGAAAGATATCTTTGGAGG - Intergenic
919658285 1:200218400-200218422 AAGAGGCTAGAGAGCTCTCTGGG + Intergenic
1063315768 10:5004156-5004178 AAGAATATAGAAACCTCTAGCGG + Intronic
1066261212 10:33731275-33731297 AAGAGCATATATACCTATGGGGG + Intergenic
1066279979 10:33906898-33906920 AAGAGGAAGGAGGACTCTGGGGG - Intergenic
1066805615 10:39249026-39249048 AAGAGCATTGAGGCCTATGGTGG + Intergenic
1070787063 10:79168067-79168089 CAGAGGGTAGAGGGCTCTGGAGG - Intronic
1071528366 10:86371557-86371579 TCCAGGAAAGAGACCTCTGGAGG - Intergenic
1071774980 10:88776793-88776815 AAGAAGATAGAGACATTTTGAGG - Intronic
1075048839 10:119166746-119166768 AAGAGGAGATAAACCCCTGGAGG - Intergenic
1077417631 11:2432266-2432288 AAGAAGACAGAGGCCGCTGGAGG - Intergenic
1079567719 11:21903159-21903181 ATGAACATAGAGATCTCTGGAGG + Intergenic
1081553255 11:44133531-44133553 AAGTGGATGGAGACCTCTGCTGG - Intronic
1082102535 11:48184876-48184898 AGGGGGATAGTGACCTTTGGTGG + Intergenic
1082187891 11:49207186-49207208 AAGAGGATGGAGGCCTGTAGGGG + Intronic
1082317984 11:50753521-50753543 AAGCGCTTAGAGACCTATGGTGG - Intergenic
1086678423 11:89638200-89638222 AAGAGGATGGAGGCCTGTAGGGG - Intergenic
1088917382 11:114237990-114238012 AAGGGGAGAGAGACCACTGTAGG + Intronic
1089199349 11:116714444-116714466 GAGGGGAGAGAGGCCTCTGGAGG - Intergenic
1089587641 11:119520407-119520429 TAGAGGATACAGACCTCTTCTGG + Intergenic
1090794243 11:130120814-130120836 AAGAGGTAAGAGAACTCGGGGGG + Exonic
1091015508 11:132047705-132047727 AAGAGGAAGGAGGCCTGTGGAGG - Intronic
1092400314 12:8170206-8170228 AAGGAGAGAGAGACATCTGGAGG + Intronic
1092576761 12:9792727-9792749 AACAGTATAGGGAGCTCTGGAGG - Intergenic
1095032360 12:37307181-37307203 AAGAGCTTAGAGGCCTATGGTGG + Intergenic
1095600192 12:44004457-44004479 AAGAGAATGGAGCCCTCTGCAGG + Intronic
1095612040 12:44140759-44140781 AAGAGAATACAGCCCTCTGGAGG - Intronic
1096028348 12:48387747-48387769 AAGAGGATAGAGACTGTGGGAGG - Intergenic
1097224271 12:57467850-57467872 AGGAGGATGGAGGCCTCCGGTGG - Intronic
1099234575 12:80068378-80068400 AAAAGGATAGAGTCCTGTGGAGG - Intergenic
1101226395 12:102692104-102692126 AGGAGGCAAGAGACCTCTGGAGG - Intergenic
1101677572 12:106932182-106932204 AATAGGATAGAGACTTGTGTGGG - Intergenic
1103798608 12:123522570-123522592 AAGATGATTGAGGCCTCAGGAGG - Intronic
1104678367 12:130731307-130731329 CTGAGGAGAGAGGCCTCTGGAGG - Intergenic
1105739193 13:23304490-23304512 AAGTGTATAGAGACATTTGGTGG - Intronic
1105962185 13:25352230-25352252 AGAAGGATAGAGACTGCTGGGGG + Intergenic
1108573267 13:51770376-51770398 CAGATGATAGAGCCCGCTGGTGG + Intronic
1109072550 13:57787538-57787560 AAGAGGATTGAGCTCTCAGGGGG - Intergenic
1109155568 13:58905745-58905767 AACAGCATAGACACATCTGGAGG - Intergenic
1111048725 13:82849926-82849948 AACTGGATAGAGAGCTCTGATGG - Intergenic
1113627393 13:111856996-111857018 AAGAGGAGAGAGACTGCAGGAGG - Intergenic
1114000655 14:18239434-18239456 AAGAGGATTGAGGCCTATGGTGG - Intergenic
1114616835 14:24072863-24072885 TAGAGGATAGACCCCTCTGCTGG + Intronic
1115160745 14:30390728-30390750 ACGAGGATAGAAGCCTCTTGTGG - Intergenic
1115375507 14:32671102-32671124 AAGAGGATAGGGATTTCTAGGGG + Intronic
1115812679 14:37127361-37127383 AAGATGATAGATACCTATGCAGG + Intronic
1115965668 14:38884760-38884782 AAGAGCATGGAGACCTCTATAGG - Intergenic
1117630509 14:57685860-57685882 CAGATGATAAAGACTTCTGGTGG - Intronic
1117970695 14:61248158-61248180 AAGAAGATAAAGACATCTAGAGG - Intronic
1118333508 14:64832649-64832671 ATGAGGATAGATTCCACTGGGGG - Intronic
1119108475 14:71947227-71947249 AAGTGGATAGATACATCTTGGGG + Intronic
1119488491 14:75009081-75009103 AAGAGGGTAATGAGCTCTGGGGG - Exonic
1120051628 14:79873875-79873897 AAGAAAATAGAGAACTCTGGGGG - Intergenic
1122551183 14:102550872-102550894 AAGAAGAAAGGGACTTCTGGGGG + Intergenic
1124013324 15:25856976-25856998 AAGAGAATAGAGTTTTCTGGGGG + Intronic
1124435737 15:29647761-29647783 AGGTGGATTGAGTCCTCTGGAGG - Intergenic
1125657226 15:41367828-41367850 CAGAGGCTAGATGCCTCTGGAGG + Intronic
1125932649 15:43611450-43611472 AAGAGGATAGAGACCTCTGGCGG + Intronic
1125945747 15:43710912-43710934 AAGAGGATAGAGACCTCTGGCGG + Intergenic
1128248059 15:66146586-66146608 ATCAGGATAGAGGCCTCTGTGGG - Intronic
1130181211 15:81630475-81630497 AAAAGCATAGAGAACTCTGTAGG - Intergenic
1133444467 16:5848283-5848305 TAGGGGATAGAGTCCACTGGTGG - Intergenic
1133790746 16:9007651-9007673 GACAGGCTAGAGTCCTCTGGAGG - Intergenic
1135803166 16:25518005-25518027 AAGATAATAGCGACCTTTGGAGG + Intergenic
1135981028 16:27147495-27147517 AGTAGGAAAGAGACCTCTGAAGG + Intergenic
1138497822 16:57419030-57419052 AAGAGCAGAGTGCCCTCTGGTGG - Intergenic
1138777923 16:59746971-59746993 AAGAGGAGAAAGACTTTTGGAGG - Intronic
1140432703 16:74918262-74918284 AAGAGGACAGAGACTGATGGTGG + Intronic
1143864774 17:9916172-9916194 AAGAAGACAGAGCCATCTGGGGG + Exonic
1147217586 17:38909631-38909653 AAGAGGATAGAGCCCACTAGGGG + Intronic
1147547779 17:41416293-41416315 AACAGAACAGAGTCCTCTGGAGG + Intergenic
1147737022 17:42645803-42645825 GTGAGGATAAAGACTTCTGGGGG + Intergenic
1148570392 17:48663723-48663745 GAGAGGAGAGAGACCCCTGATGG + Intergenic
1151070336 17:71203132-71203154 AAGAGGTAAGAGAGTTCTGGAGG - Intergenic
1152178618 17:78803742-78803764 AAGAGGAAAAAGACCTTTGTGGG - Exonic
1158859914 18:61582025-61582047 AGGAGGAGAGCGCCCTCTGGTGG - Intergenic
1159879214 18:73842590-73842612 GACAGGATAGAGACCTCATGGGG + Intergenic
1161718565 19:5891200-5891222 AAGAGCTTAGAGACCCCCGGCGG + Intronic
1163071277 19:14844089-14844111 TAGAGCATAGGGACTTCTGGAGG - Intergenic
1163813122 19:19447148-19447170 AAGGGGATAGAGACCCCCTGGGG + Intronic
1167409156 19:49334925-49334947 GGGAGGATAGAGACCCCAGGAGG + Intergenic
1167519863 19:49947904-49947926 AAAAGGAGAGAGACCTATGAAGG + Intronic
1167612350 19:50513615-50513637 GAGAGGACAGAGACCTGGGGTGG + Intronic
926332939 2:11840074-11840096 AAAAGGATAAAGACCTTTGTGGG + Intergenic
932626011 2:73296291-73296313 CAGAGGATGGCTACCTCTGGAGG + Intergenic
933966217 2:87431446-87431468 AAGAGGATAGTGATGGCTGGTGG - Intergenic
935125867 2:100222245-100222267 AAGAGGATAGAGTGCTTTAGGGG - Intergenic
936107314 2:109636035-109636057 AAGAGGAGAGGGAGCTCTCGGGG - Intergenic
936327580 2:111519040-111519062 AAGAGGATAGTGATGGCTGGTGG + Intergenic
936405135 2:112196030-112196052 GAGAGGAGAGAGAACTCTGGGGG - Intergenic
938200933 2:129372771-129372793 AAGAAGATAGAGACCTGCTGTGG - Intergenic
942826198 2:180179922-180179944 AAGAAAATAGAGAACTGTGGAGG + Intergenic
943368347 2:186985600-186985622 AAGGGGACAAAGGCCTCTGGGGG - Intergenic
945838789 2:214864102-214864124 AAGAGTACAGACAACTCTGGAGG + Intergenic
947344638 2:229178235-229178257 CTGAGGATAGAGAGCTCTGATGG - Intronic
1170129342 20:13001875-13001897 AAGAGGATCACGACCTCTGAGGG - Intergenic
1172164031 20:32887923-32887945 AATAGGATTCAGACCTATGGAGG + Intronic
1173072579 20:39783641-39783663 AGCAGGATAGAGAGTTCTGGAGG - Intergenic
1174735891 20:52965414-52965436 AAGAGGAAAGATAGATCTGGAGG + Intergenic
1177753154 21:25311073-25311095 AAGAGGTGAAAGACCTCTGAAGG + Intergenic
1179485440 21:41707217-41707239 AATAGGACAGAGAGCTCTGGAGG - Intergenic
1180425168 22:15170233-15170255 AAGAGGATTGAGGCCTATGGTGG - Intergenic
1181130160 22:20726528-20726550 AAGAGGATGGCGTCCTGTGGAGG + Exonic
1181528572 22:23503177-23503199 AAGAGGCAAGAGGCCTCTTGAGG + Intergenic
1181547168 22:23608667-23608689 GAGAGGATTGAGACCTCCAGGGG + Exonic
1181849233 22:25737959-25737981 AGGAGGCTAGAGACCGCTGGAGG + Intergenic
1183016129 22:34989053-34989075 AAGATGATGGAGACCTATGAAGG + Intergenic
1183271672 22:36866148-36866170 AAGAAGAAAGAGAACTTTGGGGG - Intronic
1185187913 22:49413928-49413950 CTGAGGAGAGAGGCCTCTGGAGG - Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949589770 3:5482038-5482060 AAGAGTATAGAGAACTGTGAAGG - Intergenic
950781843 3:15399011-15399033 GTGAGGAAAGTGACCTCTGGTGG + Intronic
952866085 3:37856003-37856025 AAGGAGATAGAGATCTCTAGGGG - Intergenic
953578265 3:44130334-44130356 GAGAAAATAGAGACTTCTGGAGG - Intergenic
954882311 3:53844501-53844523 AGGAGGATAGAGCCCTGGGGAGG - Intronic
956901201 3:73717690-73717712 AAGAGGACAGAGAACAATGGAGG - Intergenic
959632120 3:108518560-108518582 AAGAGGATGGAGAGCTCTATAGG - Intronic
960250779 3:115450179-115450201 AACAGGCAAGAGACTTCTGGTGG - Intergenic
960345698 3:116529422-116529444 GGGAGGATAGAGATCTCTGTGGG - Intronic
960358670 3:116684098-116684120 AAAAGGAGAGAGACCTCAGGAGG - Intronic
962013706 3:131419621-131419643 AAGAGAAGAGATACCTGTGGGGG - Intergenic
963789519 3:149569138-149569160 GTGAGGATAGTGCCCTCTGGTGG - Intronic
968600710 4:1508083-1508105 AAGGAGAGAGAGACCTCAGGAGG - Intergenic
968923683 4:3535874-3535896 CAGGGGATGGAGCCCTCTGGAGG + Intergenic
969779807 4:9391424-9391446 AAAAAGAGAGAGACATCTGGAGG - Intergenic
972153791 4:36130464-36130486 AAGAGGATAGGGACTCCAGGAGG - Intronic
972417923 4:38861026-38861048 AAGAAGATATAGACCACTAGAGG - Intergenic
972921304 4:43945807-43945829 AAGAGTATTCAGAGCTCTGGAGG + Intergenic
972936469 4:44142168-44142190 AAGAGGAGAGGGAGCTCTGTTGG - Intergenic
973879812 4:55258480-55258502 AAGAGGATAGATTTCTCTGAAGG - Intergenic
975249565 4:72162711-72162733 AACAGAATAGAGACCTATGATGG - Intergenic
976911933 4:90317813-90317835 AAAAAGAAAGAGATCTCTGGAGG + Intronic
977257208 4:94754504-94754526 AAGTAAATAGAGACCACTGGGGG - Intergenic
978582625 4:110247643-110247665 AAAAGGAAATAGACCTCAGGTGG - Intergenic
980084795 4:128380052-128380074 AAGAGGAAAGCACCCTCTGGTGG - Intergenic
980800858 4:137748184-137748206 AAGATTACAGAGAACTCTGGGGG - Intergenic
981400135 4:144303989-144304011 AAGTGGACAGAGAGCTCTAGAGG - Intergenic
983527180 4:168771123-168771145 AAGAACATTGAGACCTTTGGAGG - Intronic
984479077 4:180275760-180275782 AAGAGGACAGAGACCTAGAGAGG + Intergenic
989864395 5:46429882-46429904 GAGAGGATTGAGGCCTATGGTGG - Intergenic
990910438 5:60846230-60846252 AAGGGGATGGAGACTTTTGGAGG + Intergenic
990974801 5:61550058-61550080 AAGAGGAGACAGTCCTCTGATGG - Intergenic
991662380 5:68963054-68963076 AAAAGGAGAGAGCCCTCTGCTGG + Intergenic
992172657 5:74119740-74119762 AATAGGATAGAGGATTCTGGAGG - Intergenic
993049960 5:82915136-82915158 AAGGGGATAAAGACCTCAGGAGG - Intergenic
994008701 5:94874652-94874674 AAGAGGATAAAGACGATTGGAGG - Intronic
994510104 5:100691679-100691701 AAGAAGATAGATAGCTATGGAGG - Intergenic
995609087 5:113889841-113889863 AAGAGGAAAAAGACAACTGGGGG - Intergenic
998169417 5:139863862-139863884 AGGGGCATAGAGACCCCTGGGGG - Intronic
998471529 5:142387399-142387421 ATGAGGACAAAGAGCTCTGGTGG - Intergenic
999060764 5:148632475-148632497 AAGAGGATAGAGAGCTCATGGGG + Intronic
1002308359 5:178297572-178297594 AAGATGATAGAAACCAATGGGGG - Intronic
1002384541 5:178856442-178856464 GAGAGGATGGAGACTTTTGGGGG + Intergenic
1007529268 6:42526578-42526600 GAGGGGATAGAGGCATCTGGAGG - Intergenic
1007554629 6:42755607-42755629 AAGAGGACAGAGAACCCTGGTGG - Intronic
1007720304 6:43881209-43881231 AGGATGATAGAGAGATCTGGGGG + Intergenic
1008276289 6:49548317-49548339 TAGGTGATAGAGACATCTGGAGG - Intergenic
1009413697 6:63394338-63394360 GAGATGAAAGTGACCTCTGGAGG + Intergenic
1010287358 6:74094657-74094679 AATAGGATGTAGACATCTGGGGG - Intergenic
1013039577 6:106420269-106420291 AAGAGGAAAGAGCAATCTGGAGG + Intergenic
1014011595 6:116482339-116482361 AAGTGGCTAGAAACCACTGGCGG - Intergenic
1015152685 6:130056382-130056404 AAGGGGATAGAGCCTTGTGGGGG - Intronic
1015221251 6:130806055-130806077 AAGATGAGAGAGACCACAGGAGG + Intergenic
1015497268 6:133894624-133894646 CGGAGGAGAGAGACCTATGGTGG - Exonic
1017078117 6:150638602-150638624 GAGAGGATGGAGAGTTCTGGGGG + Intronic
1017200060 6:151743172-151743194 GAGAGGAGGGAGAGCTCTGGGGG + Intronic
1017647325 6:156551293-156551315 TAGAGCATAGACATCTCTGGTGG - Intergenic
1018592923 6:165447238-165447260 AAGAGAATAGAGACAGCTGCGGG - Intronic
1019201779 6:170322503-170322525 AAGAGGATTGAGTACTCTTGAGG + Intronic
1020273894 7:6613709-6613731 GAGAGGATAAAGACCTGAGGAGG + Intergenic
1020364404 7:7365127-7365149 AGGAGGAAAAAGAGCTCTGGAGG + Intronic
1020467025 7:8492023-8492045 AAAAAGATCGATACCTCTGGAGG - Intronic
1023033678 7:36112200-36112222 GAGAGGAGACAGACCTCTGCCGG + Intergenic
1023479320 7:40616008-40616030 AAAAATATAGAGACCTCTGAGGG - Intronic
1027814133 7:82947148-82947170 ATGAAGATTGAGACCTCTGCTGG - Intronic
1028485132 7:91349114-91349136 AAGAGGGTAGATGCCTCTGCAGG + Intergenic
1029432937 7:100543520-100543542 AAGGGGATAGAGTCGTCTGGGGG + Intronic
1036038194 8:5043178-5043200 AAGAGGAGACAGAGCTCAGGCGG + Intergenic
1036142356 8:6220005-6220027 AAGAGGATTGAAAGGTCTGGGGG - Intergenic
1036486968 8:9188270-9188292 AAGAGGGTAGAGTCTTCTGGAGG + Intergenic
1040442013 8:47453209-47453231 AAGAGGATACAGACAAATGGAGG + Intronic
1040910755 8:52516245-52516267 AAGAGAGTGGACACCTCTGGCGG - Intergenic
1041907961 8:63054306-63054328 AAGAGGATAGAGAGGACTTGAGG + Intronic
1042965295 8:74344877-74344899 AAAAGCCTAGAGACCTCTTGTGG + Intronic
1043191195 8:77225217-77225239 CAGAGGTTTCAGACCTCTGGGGG - Intergenic
1043594051 8:81863860-81863882 AAGAGGATTGGGAGCGCTGGGGG - Intergenic
1045918476 8:107501972-107501994 CAGAGGAAAGGGACCTCTGAAGG - Intergenic
1046312990 8:112463451-112463473 AAGAGAAGAAAGACCTCTAGTGG - Intronic
1047928979 8:129707852-129707874 AAGAGGATAGAATTCTTTGGTGG + Intergenic
1049213243 8:141396237-141396259 TAGAGGATTGAGACCTCTGGCGG + Intronic
1049253824 8:141603469-141603491 AAGAGGAAAGACAGCTGTGGAGG - Intergenic
1050477380 9:6054169-6054191 AAGGGGAAAGAGAACTCTGGAGG + Intergenic
1051013968 9:12452689-12452711 AAGAGCAGAGTGACCTCAGGTGG - Intergenic
1053799394 9:41754896-41754918 CAGGGGATGGAGCCCTCTGGAGG + Intergenic
1054145822 9:61560101-61560123 CAGGGGATGGAGCCCTCTGGAGG - Intergenic
1054187805 9:61966957-61966979 CAGGGGATGGAGCCCTCTGGAGG + Intergenic
1054465565 9:65491205-65491227 CAGGGGATGGAGCCCTCTGGAGG - Intergenic
1054650711 9:67621624-67621646 CAGGGGATGGAGCCCTCTGGAGG - Intergenic
1055632989 9:78243082-78243104 AAGTGTTTAGAGACCACTGGAGG + Intronic
1055956060 9:81774692-81774714 AAGATTATGGAGACCCCTGGAGG + Intergenic
1056277158 9:85004576-85004598 TAGAGGATAGAGACCTTGGGAGG + Intronic
1057150456 9:92791838-92791860 AAGAAGATGGAGACCACAGGTGG + Intergenic
1057157234 9:92853744-92853766 AAGAGGAGAAAGACCCCTGTGGG + Intronic
1057842299 9:98495807-98495829 AAGAAGACAGAGACCTCTCAGGG - Intronic
1058814740 9:108672656-108672678 ATGAGGACAGAGAACACTGGAGG - Intergenic
1059626175 9:116068909-116068931 AAGAGGAAAGAGACATTTGTTGG + Intergenic
1061562413 9:131414500-131414522 AACAGGATAGAGGCTTCTGGAGG - Intronic
1187298962 X:18029744-18029766 AATAGGAAAGAAACCACTGGAGG + Intergenic
1190426572 X:50338921-50338943 CAGAGGATAGAAACATTTGGAGG - Intronic
1195319750 X:103711943-103711965 AAGAGCATAATGACCTCTGGGGG - Intronic
1196142325 X:112277424-112277446 AAAAGGATAGAGAGAACTGGAGG + Intergenic
1197828455 X:130615472-130615494 AAGAGGATAGAGAATATTGGTGG - Intergenic
1197852816 X:130881900-130881922 AAGAGGAGAAAAACCTCTGGTGG + Intronic
1199497001 X:148463705-148463727 AATAGAAAAGAGAACTCTGGAGG - Intergenic
1201232722 Y:11880195-11880217 CCCAGGATAGAGACCTCAGGAGG + Intergenic
1201286680 Y:12384861-12384883 AAGTAGATAGAGATATCTGGTGG + Intergenic
1201634544 Y:16107945-16107967 AAGAGGACAGAGAGATATGGAGG - Intergenic