ID: 1125934009

View in Genome Browser
Species Human (GRCh38)
Location 15:43619001-43619023
Sequence TAGGAGCCAGTGATGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125934004_1125934009 9 Left 1125934004 15:43618969-43618991 CCCTCAGAGAAACCCAAGGAGAT 0: 2
1: 0
2: 2
3: 26
4: 223
Right 1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG No data
1125934001_1125934009 17 Left 1125934001 15:43618961-43618983 CCAGGGGCCCCTCAGAGAAACCC 0: 2
1: 0
2: 0
3: 22
4: 248
Right 1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG No data
1125934003_1125934009 10 Left 1125934003 15:43618968-43618990 CCCCTCAGAGAAACCCAAGGAGA 0: 2
1: 0
2: 4
3: 19
4: 236
Right 1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG No data
1125934007_1125934009 -4 Left 1125934007 15:43618982-43619004 CCAAGGAGATTGCTTGAGTTAGG 0: 2
1: 0
2: 0
3: 8
4: 104
Right 1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG No data
1125934005_1125934009 8 Left 1125934005 15:43618970-43618992 CCTCAGAGAAACCCAAGGAGATT 0: 2
1: 0
2: 2
3: 24
4: 260
Right 1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG No data
1125934006_1125934009 -3 Left 1125934006 15:43618981-43619003 CCCAAGGAGATTGCTTGAGTTAG 0: 2
1: 0
2: 0
3: 4
4: 108
Right 1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG No data
1125934000_1125934009 18 Left 1125934000 15:43618960-43618982 CCCAGGGGCCCCTCAGAGAAACC 0: 2
1: 1
2: 0
3: 18
4: 173
Right 1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125934009 Original CRISPR TAGGAGCCAGTGATGCAGAA AGG Intergenic
No off target data available for this crispr