ID: 1125937546

View in Genome Browser
Species Human (GRCh38)
Location 15:43649424-43649446
Sequence GCGAGGCACCTCCAGCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125937546_1125937551 -5 Left 1125937546 15:43649424-43649446 CCCGGGAGCTGGAGGTGCCTCGC 0: 1
1: 1
2: 1
3: 23
4: 228
Right 1125937551 15:43649442-43649464 CTCGCCGAGAGCGGTGGAGTCGG 0: 1
1: 1
2: 1
3: 2
4: 40
1125937546_1125937553 5 Left 1125937546 15:43649424-43649446 CCCGGGAGCTGGAGGTGCCTCGC 0: 1
1: 1
2: 1
3: 23
4: 228
Right 1125937553 15:43649452-43649474 GCGGTGGAGTCGGTGCTGATCGG 0: 1
1: 2
2: 1
3: 6
4: 91
1125937546_1125937554 12 Left 1125937546 15:43649424-43649446 CCCGGGAGCTGGAGGTGCCTCGC 0: 1
1: 1
2: 1
3: 23
4: 228
Right 1125937554 15:43649459-43649481 AGTCGGTGCTGATCGGCCCAAGG 0: 2
1: 0
2: 0
3: 23
4: 172
1125937546_1125937555 24 Left 1125937546 15:43649424-43649446 CCCGGGAGCTGGAGGTGCCTCGC 0: 1
1: 1
2: 1
3: 23
4: 228
Right 1125937555 15:43649471-43649493 TCGGCCCAAGGAAAACCCGAAGG 0: 2
1: 0
2: 0
3: 0
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125937546 Original CRISPR GCGAGGCACCTCCAGCTCCC GGG (reversed) Intronic
900306959 1:2015172-2015194 GTGACTCACCTCCACCTCCCAGG + Intergenic
900639449 1:3681772-3681794 CGGAGCCACCTCCAGGTCCCGGG + Intronic
900950643 1:5856548-5856570 TCGTGGGACCTGCAGCTCCCTGG - Intergenic
901198567 1:7453890-7453912 TGGATGCACCTCCAGGTCCCCGG - Intronic
902301323 1:15504736-15504758 GCCAGCCACCTGCAGTTCCCAGG - Exonic
902331131 1:15731730-15731752 TCCAGGCCCCTCCAGCTCCCAGG - Intronic
903348462 1:22703023-22703045 GCCAGGCCCTCCCAGCTCCCAGG + Intergenic
905281369 1:36851521-36851543 GCCAAGCACCTCCTGCACCCAGG - Intronic
905902150 1:41588740-41588762 GGGTGGCCCCTCCAGCTCACAGG - Intronic
906797719 1:48711104-48711126 GTGATCCACCTCCAGGTCCCAGG + Intronic
909376532 1:74948248-74948270 GTGAGGCCTCTCCAGCTCCATGG - Intergenic
910512092 1:88018184-88018206 GCAAGGCACCTCCAATTCCTTGG - Intergenic
911090874 1:94015929-94015951 GCCAGGCTCCTCCAGCTCGTAGG + Intronic
912421520 1:109545343-109545365 GCGACCCACCTCCAGTCCCCTGG + Exonic
915558929 1:156675425-156675447 GGGAAGCACCTCCTGCTCCCTGG + Intronic
919486787 1:198156864-198156886 CCGAGGCTCCCCCAGCTCCAGGG + Intergenic
920388304 1:205583022-205583044 GGGAGACATCTGCAGCTCCCTGG + Intronic
920494660 1:206446245-206446267 GACAGGGCCCTCCAGCTCCCTGG - Exonic
922032335 1:221813372-221813394 GCTGGACAGCTCCAGCTCCCTGG - Intergenic
922151423 1:223008147-223008169 GGGAGGCCCCTCCAGCCCCGTGG - Intergenic
922171771 1:223161593-223161615 ACCTGGCACCTACAGCTCCCAGG - Intergenic
923724652 1:236495580-236495602 TCGAGGCCCCTCCCACTCCCGGG + Intergenic
924482700 1:244451579-244451601 GCCAGGCAGCCCGAGCTCCCGGG + Intronic
924681155 1:246235571-246235593 GTGAGCCACCTCCAGCTCACAGG + Intronic
1062816570 10:505535-505557 GGCAGGCAGCTCCATCTCCCTGG - Intronic
1067086096 10:43239056-43239078 CCCAGACACCTGCAGCTCCCTGG + Intronic
1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG + Intronic
1069903464 10:71719193-71719215 ACGAGGCAAGTCCAGCTGCCAGG + Intronic
1070729208 10:78813726-78813748 GCCAGGCATCTCCAGCTCCTTGG + Intergenic
1072756389 10:98023966-98023988 GAGGGGAACTTCCAGCTCCCAGG + Intronic
1072916457 10:99540282-99540304 TCGAGGCACTCCCAGGTCCCCGG + Intergenic
1073598642 10:104824598-104824620 GCTCAGCACCTCCAGCACCCGGG - Intronic
1076131371 10:128016357-128016379 ACCAGGCACCCCCAGCCCCCAGG + Intronic
1076364132 10:129911174-129911196 GTGAGGGACCTCCAGCCCACGGG + Intronic
1076451978 10:130562282-130562304 GAGGGGTACCTGCAGCTCCCAGG - Intergenic
1076738208 10:132468113-132468135 GCGGGGCAACGCCAGCTCCCAGG + Intergenic
1077044978 11:540720-540742 GCGGAGCACCTCCAGCGTCCGGG + Exonic
1077281816 11:1749377-1749399 CCGCGCCACCTCCATCTCCCCGG + Intronic
1077410102 11:2399942-2399964 GCCAGGCCCTTCCAGGTCCCCGG - Intergenic
1077630788 11:3809742-3809764 CAGAGCCACTTCCAGCTCCCTGG + Intronic
1078108000 11:8370717-8370739 CCGGGGCCCCTCCAGCCCCCAGG - Intergenic
1078432321 11:11297621-11297643 TCTAGGCTCCTCCAGCTCTCTGG - Intronic
1079128433 11:17734589-17734611 GCGCGGCTCCTGCTGCTCCCGGG - Intergenic
1081567899 11:44270962-44270984 GAGAGGCCCCTGCAGCCCCCTGG + Intronic
1081715380 11:45246337-45246359 CCAAGGCCCCTCCAGCTACCGGG - Intronic
1081792124 11:45795565-45795587 GCTAGGAACCCCCAGTTCCCAGG + Intergenic
1083880681 11:65546842-65546864 GCGATGCACTTGAAGCTCCCGGG + Exonic
1083901933 11:65647406-65647428 GCGGGGCAGCGCCAGCTCGCGGG - Exonic
1084088738 11:66866565-66866587 GCGGGCCATCTCCAGCTGCCAGG - Intronic
1085018856 11:73192498-73192520 GTGAGTCACCTCCACCTCCCAGG - Intergenic
1088645337 11:111912755-111912777 GCGCGACCCCTCCAGCTGCCCGG - Exonic
1089314555 11:117582700-117582722 GCCGGGCCCCTCCAGCTCCGGGG + Intronic
1089346833 11:117796455-117796477 CCGAGGGACCTCCAGCTCTCGGG + Intronic
1089363591 11:117907482-117907504 GCGAGGAAACACCAGCTCACAGG + Intronic
1089432786 11:118436953-118436975 GCGAGGAACCCCCAGGTCCGGGG + Intronic
1089614840 11:119689438-119689460 CCCAGGCACCTCCTGCTCCTAGG + Intronic
1090228593 11:125086025-125086047 GAGGGGCAGCTTCAGCTCCCCGG - Intronic
1091119076 11:133041926-133041948 GCGAGTCGCCTCCAAATCCCAGG + Intronic
1091301240 11:134509594-134509616 CTGATGCCCCTCCAGCTCCCAGG + Intergenic
1100605936 12:96152188-96152210 GCGTGGAACCTGCAGTTCCCAGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1103350788 12:120282232-120282254 GCCTGGCCCCTCCAGCTTCCCGG + Intergenic
1104875978 12:132035131-132035153 GAGAGGCCGCTCCAGCTCACTGG + Intronic
1104973457 12:132541691-132541713 GCGTGGCACCGGCAGCCCCCAGG - Intronic
1109062411 13:57634321-57634343 GCGCGGCACCTGCAGCTCCGCGG - Exonic
1115462099 14:33673087-33673109 GCAAAGCATCTCCAGCTCCAGGG + Intronic
1117406777 14:55411775-55411797 GCCAGGAGCCTCCAGCGCCCGGG + Exonic
1118740796 14:68737995-68738017 ACCAGGCACCCCCAGCACCCAGG + Intergenic
1122501192 14:102200938-102200960 GGGAGGCACCTGCAGCTGGCAGG - Intronic
1123020038 14:105393410-105393432 GCGAGACACCCGCAGCTCCTAGG - Intronic
1123041040 14:105490339-105490361 GCGATGCCCCTGCACCTCCCGGG - Intronic
1123044424 14:105504261-105504283 GCCAGGCACCCCCACCTCCCAGG - Intergenic
1125937546 15:43649424-43649446 GCGAGGCACCTCCAGCTCCCGGG - Intronic
1125950446 15:43746844-43746866 GCGAGGCGCCTCCAGCTCCCGGG - Intronic
1128335579 15:66783840-66783862 GGGAGGCACCTCAGGCTCACAGG + Intergenic
1129193483 15:73951262-73951284 GCGCGGCCCTCCCAGCTCCCCGG + Intronic
1129226984 15:74175821-74175843 GGAAGGCACCTACAGCTGCCTGG + Exonic
1130086115 15:80779515-80779537 GCCAGGCGCCGCGAGCTCCCGGG - Exonic
1130412475 15:83658570-83658592 GGGAGGCCGCTCCAGCTGCCTGG - Intronic
1131153631 15:90062032-90062054 GCTCGGCACCTCCACCTCCCAGG - Intronic
1132400555 15:101502257-101502279 CCGAGGCCGCCCCAGCTCCCTGG + Intronic
1132776320 16:1596748-1596770 CCGAGGCGCCTCCACCTCCTCGG + Intronic
1132976884 16:2715501-2715523 GCGAGGCACCTCCCGCGGGCGGG + Intronic
1133058182 16:3157963-3157985 GTGCGGCACCTGCAGCTCCCGGG + Intergenic
1134090502 16:11389101-11389123 GCCAGGCACATCCCTCTCCCAGG + Intronic
1134193504 16:12140416-12140438 GCCAGCCACCCCCAGCTCCAGGG - Intronic
1134484821 16:14649523-14649545 TCAAGGCACCACCTGCTCCCAGG + Intronic
1135474921 16:22765494-22765516 GCCAGCCAGATCCAGCTCCCAGG - Intergenic
1136093256 16:27935741-27935763 GCCTGGCCCCTCCTGCTCCCTGG + Intronic
1136451900 16:30358339-30358361 ACGGGGCCCCTCCAGCTGCCCGG + Exonic
1141704230 16:85655814-85655836 GCGATGCACCTGCACCTCTCTGG + Exonic
1142118395 16:88373267-88373289 GCCAGGGATGTCCAGCTCCCTGG + Intergenic
1142483548 17:232918-232940 CCCAGGTACTTCCAGCTCCCTGG + Intronic
1143951777 17:10638328-10638350 GCTCAGCTCCTCCAGCTCCCGGG + Exonic
1145233118 17:21189460-21189482 GGGAGGCAGCACCAGCTCCAAGG - Intronic
1148282689 17:46361384-46361406 GCCAGGCACGCCCGGCTCCCGGG + Intronic
1148304907 17:46579309-46579331 GCCAGGCACGCCCGGCTCCCGGG + Intronic
1148323469 17:46770941-46770963 GCGAGTCACCTCCGGCTCCCGGG - Intronic
1148629055 17:49092589-49092611 CCCAGGCACCTCCAGTGCCCAGG - Intergenic
1148936249 17:51166476-51166498 GCCCGGCCCCTCCAGCTTCCCGG + Intronic
1149609283 17:57948345-57948367 GGGAGGGACCTACAGCTCTCGGG - Intronic
1150415959 17:64988933-64988955 CTGAGGCACCACCAGCTCCTGGG + Intergenic
1150795749 17:68235443-68235465 CTGAGGCACCACCAGCTCCTGGG - Intergenic
1151337215 17:73447065-73447087 CTCAGACACCTCCAGCTCCCTGG - Intronic
1152422009 17:80198601-80198623 GCGAGGCCCCTCCTGTCCCCCGG + Intronic
1152564838 17:81095702-81095724 GCGGGGCCCCTCCAGATCCTGGG - Intronic
1152695456 17:81741677-81741699 GCAAGCCACCTCCAGAGCCCTGG + Intergenic
1152751797 17:82065709-82065731 CCGGGGCCCCTGCAGCTCCCGGG + Intronic
1152919592 17:83059370-83059392 CCCAGGCACCCCCAGCCCCCAGG + Intergenic
1154356627 18:13626730-13626752 GCTGGGCTCCTCCAGCTCCCTGG + Intronic
1157498085 18:48170725-48170747 GAGAGGCACCTGCGGATCCCAGG - Intronic
1158230016 18:55244100-55244122 GCTAATAACCTCCAGCTCCCAGG + Intronic
1160148904 18:76384700-76384722 GGGAGGGGGCTCCAGCTCCCTGG + Intronic
1161072694 19:2270512-2270534 GTGCGCCACCCCCAGCTCCCCGG - Intronic
1161350204 19:3786902-3786924 GCCAGGTCCCTCCAACTCCCAGG - Intronic
1162399482 19:10436122-10436144 GCTACACACCTCCAACTCCCCGG - Intronic
1162757326 19:12867943-12867965 GGAAGGCACCTCCAGCGCCGGGG + Exonic
1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG + Intergenic
1163684532 19:18703536-18703558 GCAAGCAACCTCCACCTCCCAGG + Intronic
1163692270 19:18744271-18744293 ACGGGACACCTCCACCTCCCTGG - Intronic
1165331355 19:35142664-35142686 GAGAGGCATCCCCAGCTCCTGGG - Intronic
1165826852 19:38710459-38710481 GGAAGCCACCCCCAGCTCCCTGG + Intronic
1166074917 19:40408342-40408364 GAGGGTCACCTCCAGCTCCTTGG + Exonic
1166091672 19:40513245-40513267 GCGATGTGCCTCCACCTCCCCGG - Exonic
1166104236 19:40589594-40589616 GCAAGGCTCCTACAGCTCCCTGG - Intronic
1166200003 19:41231228-41231250 CCAAGCCACCTCCAGCTCCGTGG - Exonic
1166686582 19:44800253-44800275 GGAAGCCACCTCCAGCCCCCAGG + Intronic
1167756210 19:51415269-51415291 CCGAGGCAGCTCCAGGACCCCGG + Exonic
925022848 2:585468-585490 GCCAGGCGGCTCCAGCTCCAGGG + Intergenic
925044655 2:763677-763699 GCAAGGCAGCACCAGATCCCAGG - Intergenic
926757484 2:16247871-16247893 GTGTGGCTCCCCCAGCTCCCTGG + Intergenic
927202401 2:20586140-20586162 TCAAGGCACCTCCTCCTCCCAGG + Intronic
927257521 2:21053169-21053191 GTGAGGCACCTGAACCTCCCTGG + Intergenic
927843729 2:26460933-26460955 GAGGGGCACGTCCACCTCCCCGG + Exonic
929536352 2:42786769-42786791 TCAGGGTACCTCCAGCTCCCTGG - Intronic
932418315 2:71586803-71586825 GGGAGGCGCCTCCGGCTCCAGGG - Intronic
932688479 2:73893104-73893126 TGGAGGCACCTCCCGCACCCAGG - Intronic
932721576 2:74142575-74142597 GCGAGGCAGCTGCACCACCCAGG + Intronic
932760501 2:74436399-74436421 CGGAGGGACCTCCAGCGCCCTGG - Intronic
934737622 2:96697960-96697982 TGGAGGGACCACCAGCTCCCAGG - Intergenic
935181172 2:100692348-100692370 GCAAGCCACTTCCAACTCCCTGG - Intergenic
936154540 2:110039666-110039688 AGCAGGCACCTGCAGCTCCCAGG - Intergenic
936190143 2:110331748-110331770 AGCAGGCACCTGCAGCTCCCAGG + Intergenic
937312146 2:120909062-120909084 GTGAGGCTCCCCCAGTTCCCCGG + Intronic
942533811 2:176941755-176941777 CTGAGGCAACTCCAGCACCCCGG - Intergenic
946208826 2:218130825-218130847 GCCAGTGACCTCCAGCTCCTAGG - Intronic
946337923 2:219050669-219050691 GCGAGGCATCTGGAGCTGCCTGG - Intergenic
946379908 2:219340110-219340132 GCAAGCAACCTCCACCTCCCAGG - Intergenic
948487108 2:238288189-238288211 CCGAGGGTCCTCCAGATCCCAGG + Intronic
948897678 2:240934870-240934892 GGGAGGGACCTTCAGCTTCCAGG - Intronic
948900653 2:240955394-240955416 GCGAGACACCCTCAGCTCCAAGG - Intronic
949073097 2:242038733-242038755 GGGAGGCAGCTCCACCTTCCTGG - Intergenic
1172120424 20:32595410-32595432 TCCTGGCACCTCAAGCTCCCTGG + Intronic
1172352057 20:34250719-34250741 CAAAGGCACCTCCACCTCCCGGG - Intronic
1173912796 20:46682855-46682877 GCAAAGCACCTGCAGCTCCCCGG + Intronic
1175873059 20:62217395-62217417 CCCCTGCACCTCCAGCTCCCAGG - Intronic
1175891043 20:62316065-62316087 GGGAGGCAGCTTCAGCTCCCAGG + Intronic
1176159603 20:63641595-63641617 GCGGGGCCCAGCCAGCTCCCAGG - Intronic
1176214205 20:63940585-63940607 CCCAGGCACCTCGGGCTCCCCGG + Exonic
1179587239 21:42381337-42381359 GCTGGGCACCCTCAGCTCCCTGG - Intronic
1179605626 21:42513761-42513783 GCGCGGCTCCTCCCCCTCCCCGG - Intronic
1179997286 21:44979953-44979975 GCCAGGCACCTCCAGGCCCCAGG - Intergenic
1180159768 21:45993823-45993845 GCCACGCAGCTCCAGCTTCCCGG + Intronic
1180551454 22:16545124-16545146 GGGTGGCTTCTCCAGCTCCCAGG - Intergenic
1181063253 22:20292022-20292044 GCCAGACACCTGCATCTCCCTGG + Intergenic
1181169848 22:21001949-21001971 GCGAGGCTCCTCCGGATGCCCGG - Exonic
1181468338 22:23122745-23122767 GCTGGGCACCTCCAGCTCCGAGG - Intronic
1181517504 22:23423619-23423641 TCCTGGCACCTGCAGCTCCCGGG - Intergenic
1183371342 22:37434112-37434134 GCCGGTGACCTCCAGCTCCCAGG - Intergenic
1184331657 22:43831652-43831674 GCGAGGCTCCTCCACCTGCGTGG - Intronic
1184495855 22:44840975-44840997 GCCAGGCACTGCCAGCTCCATGG + Intronic
1184562054 22:45269129-45269151 GCGCGGCACCGCCCCCTCCCCGG + Intergenic
1184630560 22:45774855-45774877 GCCTGCCACCTCCACCTCCCAGG - Intronic
1184657324 22:45948345-45948367 GGGTGGCACCGCCCGCTCCCTGG - Intronic
1185158980 22:49211433-49211455 GCCTGGCACTTCCAGCTCCCAGG + Intergenic
1185179849 22:49352992-49353014 GCCAGGCATCTCCAGCCCCATGG + Intergenic
1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG + Intergenic
1185382706 22:50517526-50517548 GGGAGGCCCCTGCAGCTCCTGGG + Intronic
953418185 3:42734819-42734841 GTCAGGCACCTTCACCTCCCTGG - Intronic
961452239 3:127007584-127007606 GCAAGACACCTCCAGCTGTCGGG + Intronic
961524496 3:127488177-127488199 TGGTGGCACCTGCAGCTCCCTGG - Intergenic
962728169 3:138254991-138255013 GTGATACAGCTCCAGCTCCCAGG + Intronic
968519883 4:1030440-1030462 GCCAGGCCCCACCAGCCCCCAGG - Intergenic
969401398 4:6958061-6958083 GCCAGGCTCATCCTGCTCCCAGG + Intronic
970419606 4:15893205-15893227 GAGAGGCACCCTCAGCTTCCAGG + Intergenic
973970824 4:56212282-56212304 GGGAGGAACCTGCAGCTCCAGGG + Intronic
982745200 4:159099407-159099429 GCAAGCAACCTCCACCTCCCAGG + Intergenic
984301521 4:177925771-177925793 TCTATGCACCTCCACCTCCCAGG + Intronic
985539937 5:483158-483180 GGGCTGCACCTCCATCTCCCTGG + Intronic
985575010 5:669922-669944 CGGAGGCTCCTCCAGCACCCTGG - Intronic
985627005 5:994251-994273 GCGAGGAAGGACCAGCTCCCAGG + Intergenic
985695588 5:1338361-1338383 GCGAGTCACCTGCAGCCACCTGG + Intronic
985775590 5:1840232-1840254 AGGAGGCGGCTCCAGCTCCCCGG - Intergenic
991736523 5:69634260-69634282 GGGAGGCTCCCCCAGATCCCAGG + Intergenic
991758542 5:69900883-69900905 GGGAGGCTCCCCCAGATCCCAGG - Intergenic
991815977 5:70510376-70510398 GGGAGGCTCCCCCAGATCCCAGG + Intergenic
991837771 5:70775949-70775971 GGGAGGCTCCCCCAGATCCCAGG - Intergenic
993647545 5:90478630-90478652 GCAAGCAACCTCCACCTCCCGGG + Intronic
994090606 5:95806591-95806613 GAGAGGCACCTCCAGCTTAGAGG - Intronic
996607215 5:125337548-125337570 GCAAGGCATCTCCAGCTCACCGG + Intergenic
997963239 5:138338286-138338308 CCGCGGTTCCTCCAGCTCCCAGG - Exonic
998151400 5:139759465-139759487 GCGGGGGACAGCCAGCTCCCAGG - Intergenic
998430262 5:142064266-142064288 GGGAGGCACAGCCAGCTCCATGG - Intergenic
1002088765 5:176792544-176792566 AGGAGGCACCTGGAGCTCCCAGG - Intergenic
1002200377 5:177524519-177524541 GCGAGGCAAGCCCAGCCCCCCGG - Exonic
1002447027 5:179296068-179296090 CCGAGGCACCGCCAGCTCCTCGG - Intronic
1002636682 5:180612201-180612223 GTGAGGCAGCCCCATCTCCCTGG - Intronic
1006358725 6:33575698-33575720 CCGAGGCCTCCCCAGCTCCCAGG + Intronic
1007627692 6:43255514-43255536 GGGAGTCACCTGCAGCTCTCAGG - Intronic
1010215193 6:73395058-73395080 GAGAGGCACCTCTAGGCCCCCGG + Exonic
1017140852 6:151188817-151188839 CCCAGCCACCTCCACCTCCCAGG + Intergenic
1019386568 7:760072-760094 GCGCGGCTCCTCCAGCTCTGAGG + Intronic
1019386577 7:760106-760128 GCGCGGCTCCTCCAGCTCCGAGG + Intronic
1019520942 7:1460162-1460184 ACAAGGCGCCTCCTGCTCCCCGG - Intergenic
1019631299 7:2051246-2051268 GGGAGGCTCCTCCAGTGCCCAGG - Intronic
1023842516 7:44105097-44105119 TGGAGGCACATCCAGCACCCGGG + Intronic
1026356045 7:69558371-69558393 CCAAAGCACCTACAGCTCCCAGG - Intergenic
1028774767 7:94664317-94664339 GTGAGGCAACACCAGCGCCCGGG - Exonic
1029206329 7:98871130-98871152 GCCAGGCCCCTCCAGCTTCTAGG - Intergenic
1029488505 7:100857532-100857554 TCAGGCCACCTCCAGCTCCCCGG - Intronic
1030075411 7:105732562-105732584 CCAAGGCCCCTCCAGCACCCAGG + Intronic
1032319606 7:130874132-130874154 GCTAGGGACCTCCAGCCCCTAGG - Intergenic
1033446766 7:141430108-141430130 GATAGGCAGCACCAGCTCCCTGG + Intronic
1034182374 7:149148291-149148313 GCGAGGCCACTCCAGCCTCCGGG - Intronic
1035143583 7:156788970-156788992 TCGCTGCACCTCCATCTCCCGGG - Intronic
1035225379 7:157429670-157429692 GCCAGGCTTCTCCAGCTCCCAGG + Intergenic
1036195368 8:6708888-6708910 GTGAGCCGCCTCCCGCTCCCGGG + Intronic
1037036621 8:14177125-14177147 GCGAGGCAACTCCACCCCACAGG - Intronic
1040581887 8:48705074-48705096 GCGAGCCAGATGCAGCTCCCAGG - Intergenic
1040997467 8:53416552-53416574 TTGAGGCAACTCCAGCACCCTGG + Intergenic
1042903058 8:73747074-73747096 GCGACGCAGCTCCCGCCCCCTGG + Intronic
1048852689 8:138659713-138659735 GCGAGGCACCCTCATCTCCTGGG - Intronic
1049532111 8:143159973-143159995 CGGACGCACCTGCAGCTCCCCGG - Intronic
1049731098 8:144178952-144178974 CCAAGCCACCTCCACCTCCCAGG - Intronic
1052146106 9:25051491-25051513 GTGAGGCATCTCCAGCCACCTGG - Intergenic
1053241413 9:36498830-36498852 TCAATGCACCTCCACCTCCCGGG + Intergenic
1056584508 9:87919595-87919617 GTGAGGGGCCTCCCGCTCCCTGG + Intergenic
1056612358 9:88133325-88133347 GTGAGGGGCCTCCCGCTCCCTGG - Intergenic
1056698432 9:88880364-88880386 GTGTGACACCTCCAGCTGCCTGG - Intergenic
1056835411 9:89951254-89951276 TTCAGGCACTTCCAGCTCCCAGG + Intergenic
1059525805 9:114989952-114989974 TGGAGGCGCCCCCAGCTCCCTGG - Intergenic
1060038988 9:120283572-120283594 GCCAGGCACCTGCATCTCCCAGG - Intergenic
1060585145 9:124780988-124781010 CCCAGGCATCTGCAGCTCCCAGG + Intronic
1061624693 9:131834860-131834882 GAAAGGCAGCTCCACCTCCCAGG - Intergenic
1061792038 9:133063991-133064013 GGGAGGCCTGTCCAGCTCCCGGG - Intronic
1061839129 9:133347649-133347671 GCCAGGCAACTCCAGCGCCGAGG - Exonic
1062414327 9:136439986-136440008 GCGAGGCAGGTGCAGGTCCCCGG + Intergenic
1062453801 9:136626556-136626578 CCGAGGCATCTCCGGCACCCCGG - Intergenic
1062526633 9:136980506-136980528 GCCAGGCCCCAGCAGCTCCCAGG + Intronic
1185448333 X:270323-270345 GCGTGGGACCTGCAGCACCCGGG + Intergenic
1185448362 X:270433-270455 GCGTGGGACCTGCAGCACCCGGG + Intergenic
1185673605 X:1831004-1831026 GCCTGGCCCCTCCACCTCCCAGG - Intergenic
1201759119 Y:17518726-17518748 CTGGGGCGCCTCCAGCTCCCTGG - Intergenic
1201842436 Y:18387264-18387286 CTGGGGCGCCTCCAGCTCCCTGG + Intergenic