ID: 1125939074

View in Genome Browser
Species Human (GRCh38)
Location 15:43662707-43662729
Sequence CTCTGTAAACCATAAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125939074_1125939077 6 Left 1125939074 15:43662707-43662729 CCTTCAATTTATGGTTTACAGAG 0: 2
1: 0
2: 1
3: 21
4: 247
Right 1125939077 15:43662736-43662758 AAGCTCTCCCACCTTAGTGTGGG 0: 2
1: 0
2: 0
3: 3
4: 92
1125939074_1125939076 5 Left 1125939074 15:43662707-43662729 CCTTCAATTTATGGTTTACAGAG 0: 2
1: 0
2: 1
3: 21
4: 247
Right 1125939076 15:43662735-43662757 CAAGCTCTCCCACCTTAGTGTGG 0: 2
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125939074 Original CRISPR CTCTGTAAACCATAAATTGA AGG (reversed) Intronic
901387064 1:8917537-8917559 CTCTGTAAACAAGTATTTGATGG + Intergenic
906985011 1:50673869-50673891 CTCTTTAAAAAATAAACTGAGGG + Intronic
908793579 1:67808281-67808303 CTATGTAAACTAAAAATAGAGGG + Intronic
909165222 1:72214184-72214206 CTCAATAAACTATATATTGATGG + Intronic
911800549 1:102132573-102132595 CTCAGTAAACTAGATATTGAAGG + Intergenic
912136783 1:106670107-106670129 CTCAGTAAACTAGGAATTGAGGG + Intergenic
912154458 1:106900315-106900337 CTCTAAAAACCTTAAAATGATGG - Intergenic
912781214 1:112549963-112549985 CTCAGTAAACTACAAATTGAAGG - Intronic
913462946 1:119107850-119107872 CTCAGTAAACCAGGAATGGAAGG - Intronic
915618441 1:157061106-157061128 CTCAATAAACCAAAAATAGAAGG - Intergenic
916330283 1:163608428-163608450 CTTTGTTAAGCATAAATTTATGG - Intergenic
916568414 1:166003643-166003665 CTCAATAAACTAGAAATTGAAGG - Intergenic
917363940 1:174208453-174208475 CTCAGTAAACTAGCAATTGAGGG - Intronic
917856694 1:179106932-179106954 ATCTGTAAACCATAAGTACAGGG - Exonic
918241106 1:182621244-182621266 CTTTGTTAACCAGAAATTGGGGG + Intergenic
918485376 1:185023488-185023510 CTCTGTCAAAGAAAAATTGAGGG + Intergenic
919049014 1:192489321-192489343 CTCAGTAAACAATAATTTGATGG + Intergenic
919488894 1:198179702-198179724 CTCTGTAAAGCCACAATTGAAGG - Intronic
921689114 1:218127601-218127623 CTCTGCAAAACAGAATTTGAAGG - Intergenic
921772846 1:219062691-219062713 CTCAGCAAACCAAAAATTGAAGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924327048 1:242906122-242906144 CTCAATAAACCAGAAATTAAAGG + Intergenic
924392307 1:243576204-243576226 CTCAGTAAACTAGATATTGAAGG + Intronic
1063333835 10:5189828-5189850 CTCAGTAAACCAGATATTGAAGG + Intergenic
1064435666 10:15309123-15309145 ATCTGTAAGCAATAAATTAATGG + Intronic
1065461698 10:25973651-25973673 CTCTATAAACTAGATATTGATGG - Intronic
1066130657 10:32390310-32390332 ATTTGCAAACCATAATTTGAGGG + Intergenic
1067184595 10:44015965-44015987 CTCTGGAAGCCAGAATTTGATGG + Intergenic
1068195757 10:53713979-53714001 TTCTGTAAACCAAAAAGTGATGG - Intergenic
1069233998 10:66047448-66047470 CTCCATAAACCAGATATTGAAGG + Intronic
1070349658 10:75579890-75579912 CTCAATAAACCAGATATTGATGG + Intronic
1070588983 10:77788248-77788270 CTCTTTAAACTATACATTTATGG + Intergenic
1071850321 10:89562266-89562288 TTCTGTAAACCAGAAAGTGTCGG + Intergenic
1073562584 10:104509566-104509588 CTTGGTAAACCATAGATTGCGGG - Intergenic
1074329622 10:112492242-112492264 CTCAGTAAACCATAAACTGAGGG + Intronic
1074777458 10:116776419-116776441 TACTGTAAGCCATAAATAGAAGG - Intergenic
1074921497 10:118019086-118019108 CAATGTAAACCATAAATTCCTGG + Intronic
1077714705 11:4569392-4569414 CCTTGTAAACCCTAAACTGAGGG + Intergenic
1079847763 11:25491331-25491353 GTCAGTAAAGCATATATTGAAGG - Intergenic
1079979696 11:27136876-27136898 CTTTCTAAAACAAAAATTGAGGG + Intergenic
1082236896 11:49828647-49828669 TTCTTAAAATCATAAATTGATGG - Intergenic
1082241804 11:49881083-49881105 TTCTTAAAATCATAAATTGATGG + Intergenic
1082681545 11:56178299-56178321 TTCTGTAAACGATAAATTTGTGG - Intergenic
1085471992 11:76764360-76764382 CTCTGTAAACTACAAAGTGCTGG + Intergenic
1086839801 11:91671055-91671077 CTCAGTAAACTAGGAATTGATGG + Intergenic
1087055134 11:93927608-93927630 CTCAGTAAACTAGCAATTGAGGG + Intergenic
1087156629 11:94910800-94910822 CTCTTCAAAACATAAATTGCAGG - Intergenic
1087383684 11:97441732-97441754 CTATTTACACCATAAATTAAGGG - Intergenic
1088041846 11:105395397-105395419 CCCTTTAATCCATAAATTTAGGG - Intergenic
1090355693 11:126139138-126139160 CTCTTTAACCCATAATTTGGTGG + Intergenic
1090598407 11:128344010-128344032 CACTGAAAACCAGAACTTGAGGG + Intergenic
1096551286 12:52373989-52374011 CTCAGCAAACTAGAAATTGAAGG - Intergenic
1097349477 12:58532773-58532795 CTCTGTAGAGGATAAATTGGAGG - Intergenic
1097456303 12:59802669-59802691 CTCAGAAAAACAAAAATTGAGGG - Intergenic
1098810152 12:75077760-75077782 CTCTGTATAACATACATTGGAGG - Intronic
1099318088 12:81109885-81109907 CACTGTGAAACATAAATTGAAGG - Intronic
1099792922 12:87359882-87359904 CTCAATAAACTATATATTGATGG - Intergenic
1100114155 12:91282533-91282555 CTCAGCAAACTATAAATAGAAGG + Intergenic
1100156740 12:91808434-91808456 CTCAGTAAACCAGGTATTGAAGG + Intergenic
1102089824 12:110176373-110176395 CCCTGTAAACCAGGAATGGAAGG + Intronic
1106742595 13:32661644-32661666 CTCACTAATCCATAAATTAACGG - Intronic
1107362064 13:39629675-39629697 CTCTGTTAATAATAAATAGAAGG - Intergenic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1108161016 13:47639382-47639404 GTCTGAAAACCATAAAGGGAAGG + Intergenic
1109662767 13:65486427-65486449 CTCAGAAAACCAGAAATAGAGGG + Intergenic
1109669787 13:65589142-65589164 CTCAATAAACCAGATATTGATGG + Intergenic
1110058739 13:71013841-71013863 CTATGTAAAAAATAAATTTAAGG + Intergenic
1110152073 13:72267651-72267673 CTCAATAAATCATATATTGATGG - Intergenic
1110558040 13:76883453-76883475 CTATGTAAACCATAAGTGAAGGG - Exonic
1110816223 13:79862819-79862841 CTTTGTAAACAATAAAATCATGG + Intergenic
1111363199 13:87204559-87204581 CTCTGTCAAACACAGATTGAAGG - Intergenic
1111371442 13:87323110-87323132 GTCTGTCAATCATAAATTAAGGG + Intergenic
1111545545 13:89729362-89729384 CTCAGTAAACTAGAAATAGAGGG - Intergenic
1112770088 13:102785674-102785696 TTTTGTTAACCATAAAATGAAGG + Intronic
1112798459 13:103083769-103083791 CTCTATAAACCACAAAGTGATGG + Intergenic
1112953353 13:105030023-105030045 CTCTCTAAGCCGTAAATGGAGGG - Intergenic
1113193041 13:107772499-107772521 CAATGTAAAACATAAATTCAGGG + Intronic
1117697150 14:58377434-58377456 CTCTGGCAACCCTAAAATGATGG - Intergenic
1117789902 14:59329447-59329469 CTCTGTAAACTCTAATTTGGGGG + Intronic
1118126302 14:62908512-62908534 CTCAGTAAACCTCAAATTCAGGG + Intronic
1118918676 14:70130057-70130079 CTCAGTAAACAATTCATTGAGGG - Intronic
1121477236 14:94220253-94220275 CTCAGTAAACTAGAAATAGATGG + Intronic
1122396448 14:101436058-101436080 CTCTGTGAAGCATGAACTGAAGG - Intergenic
1125925930 15:43563156-43563178 CTCTGTAAACCATAAATTGAAGG - Intronic
1125939074 15:43662707-43662729 CTCTGTAAACCATAAATTGAAGG - Intronic
1126195092 15:45922579-45922601 CTTTCTAAAGCGTAAATTGATGG + Intergenic
1126449146 15:48786747-48786769 CCCCGGAATCCATAAATTGAAGG - Intronic
1131239452 15:90726031-90726053 CTATGTACCCCATAAATTGTTGG - Intronic
1135422502 16:22314539-22314561 CTTTACAAACCATAAATGGAAGG - Intronic
1135759641 16:25126705-25126727 CTCTGGAAGCCATAACTTGCTGG - Intronic
1144532499 17:16053012-16053034 CTCAGTAAACTAGATATTGAAGG + Intronic
1146592427 17:34138888-34138910 CTCTGAAAACCAGTAATTAAAGG + Intronic
1149726964 17:58905378-58905400 CTCAGTTAACCAGAAATAGAGGG - Intronic
1152398500 17:80049735-80049757 CTCTGGAAGCCACAAATTAAAGG - Intronic
1153519764 18:5940627-5940649 CTCTGTACACCATAAATGCATGG + Intergenic
1153985290 18:10345414-10345436 CTCTTGAAAACATAAATTAATGG - Intergenic
1155904491 18:31433051-31433073 CTCAGTAAACTAAAAATAGAGGG + Intergenic
1156109782 18:33711990-33712012 GTCTGTAAACCAGAAATTGGAGG - Intronic
1156926765 18:42590907-42590929 CTCAGTAAACTAGAAATAGAGGG - Intergenic
1156996909 18:43479679-43479701 GTCTGTAAACCATAAAGGGGAGG + Intergenic
1158046781 18:53165576-53165598 CTCTGTAAAATATAAAATCATGG + Intronic
1161912764 19:7207003-7207025 CTAAGGAAACCATAATTTGAGGG + Intronic
1163610381 19:18297991-18298013 GTCTCTAAAAAATAAATTGAAGG - Intergenic
1164815494 19:31198266-31198288 ATCAGTAAACCAGAAATAGAGGG + Intergenic
1165054999 19:33170176-33170198 CTCTTTAAAACATAAATAAATGG - Intronic
1165526385 19:36358652-36358674 CTCAGCAAACTAGAAATTGAAGG - Intronic
925062025 2:898733-898755 TTCTATAAAATATAAATTGATGG + Intergenic
926399652 2:12484447-12484469 TTCTGGAAACCATAAAATAAAGG + Intergenic
927321440 2:21750811-21750833 CTCTATAAATCAAAAATTGGGGG + Intergenic
928475298 2:31620154-31620176 CTCAGTAAACTATATATTGAAGG + Intergenic
928608454 2:32966553-32966575 CTCAGTAAACCAGGAATAGAAGG - Intronic
929817601 2:45247348-45247370 CTCTGTAATCCAGAAGATGATGG - Intergenic
930123787 2:47781152-47781174 CTCTGTAAACCAAAAGTTTGGGG + Intronic
931081714 2:58780847-58780869 CTCTTTAAACCACATAGTGAAGG - Intergenic
931842808 2:66172002-66172024 CCATGCAAACCATAAAATGAAGG - Intergenic
932894741 2:75628314-75628336 CTCTCAAAAAGATAAATTGAAGG + Intergenic
933880775 2:86667663-86667685 CTCTATAAACTAGATATTGATGG + Intronic
933932957 2:87173266-87173288 CTGAGTAGACCATAAGTTGACGG - Intergenic
936069954 2:109360997-109361019 CTCAGTAAACTACAAATAGAGGG - Intronic
936360157 2:111792179-111792201 CTGAGTAGACCATAAGTTGACGG + Intronic
939438070 2:142204214-142204236 TTCTGTGAACCATTAAATGAAGG + Intergenic
939780710 2:146443963-146443985 CTAAGTAAAGCACAAATTGAAGG - Intergenic
940121537 2:150273247-150273269 TTCTTTGAACAATAAATTGAAGG + Intergenic
941634089 2:167916771-167916793 ATATGTAAAACACAAATTGAGGG + Intergenic
943493960 2:188595215-188595237 CTCAGTAAAACAAAAATTTATGG + Exonic
943555903 2:189403590-189403612 CTCTATAAACTAGATATTGAAGG - Intergenic
943852668 2:192746294-192746316 CTCTGTATTCCTTAAATTGATGG - Intergenic
945164673 2:206930344-206930366 CTCAGTAAACTAGATATTGAAGG + Intergenic
946133804 2:217628952-217628974 GTCTGGAAACCACAAAGTGAAGG + Intronic
1169788120 20:9382323-9382345 CTGTGTGGACCATAAATTGTAGG - Intronic
1170730349 20:18969419-18969441 CTCAGTAAACTATGTATTGATGG + Intergenic
1172557919 20:35859096-35859118 CTCTGTAAACCACCAAGTAATGG - Intronic
1174916867 20:54662788-54662810 CACTGGAAACCACTAATTGATGG - Intergenic
1178282443 21:31295032-31295054 GTCTGGAAGCCATAAATTGAAGG - Intronic
1181848126 22:25729752-25729774 CACTGTAAACCAGAAATCCAAGG + Intergenic
1184699492 22:46160913-46160935 CTCTGGAAACCAAAAATTATTGG + Intronic
949772189 3:7591066-7591088 CTCTCTAAACAATATATTGAGGG - Intronic
950391487 3:12700314-12700336 CACTGGACATCATAAATTGAGGG + Intergenic
950821312 3:15762361-15762383 CTCTGTTATCCATAAATTACAGG + Intronic
950959546 3:17090935-17090957 CTCAGACAAACATAAATTGAAGG - Intergenic
951912251 3:27763179-27763201 CTCAGTAAAATATAAATTGCTGG - Intergenic
955718694 3:61859288-61859310 TTCTTTAATCCATAAAATGATGG + Intronic
956048272 3:65219850-65219872 CTCAGTAAACTAGATATTGATGG - Intergenic
958849279 3:99304477-99304499 CTCAGTAAACAAGATATTGATGG + Intergenic
959004160 3:101000509-101000531 CTCAGTAAACTAGAAATAGAAGG - Intergenic
959236736 3:103732984-103733006 GTCTGTAAGCCTTAAATTTAAGG - Intergenic
959236842 3:103734438-103734460 CTATATAAATCATTAATTGAAGG - Intergenic
959564714 3:107822687-107822709 GTGTCTAAACCATAAATGGAAGG + Intergenic
963644100 3:147892362-147892384 CTGTATAAAGAATAAATTGAAGG - Intergenic
965255421 3:166401330-166401352 TTCTGTATACCAAAAATTGCAGG - Intergenic
968889128 4:3358501-3358523 CTCAGTAAACCAGAAATAGAAGG - Intronic
970293087 4:14598062-14598084 CTCTGTATATGATAAATTGATGG - Intergenic
971712349 4:30130656-30130678 CTTAGTAAAGCATAAAATGAGGG + Intergenic
971923997 4:32982532-32982554 CTCAGGAAACCAGACATTGAAGG - Intergenic
972052298 4:34752941-34752963 CTCTGTAATGCATGAAGTGAAGG - Intergenic
973575160 4:52280166-52280188 CTCAGTAAACTACATATTGAAGG + Intergenic
973585013 4:52381530-52381552 CTCAGTAAACTAGATATTGATGG + Intergenic
973734453 4:53856745-53856767 CTTTGGAAGCCATATATTGAAGG - Intronic
974114273 4:57561464-57561486 CTCAGTAAACTAGATATTGATGG - Intergenic
974504175 4:62746822-62746844 CTCAGTAAACTAGATATTGATGG + Intergenic
977084001 4:92571119-92571141 CTCAATAAACCATGTATTGAAGG - Intronic
977399018 4:96508738-96508760 ATATGTAAAATATAAATTGAAGG + Intergenic
977762565 4:100757016-100757038 CTCAGTAAACTAGGAATTGAGGG + Intronic
977999694 4:103542214-103542236 CTCAATAAACCATGTATTGAAGG - Intergenic
978006902 4:103628046-103628068 CTGGGTAAACAATAAAATGAAGG + Intronic
978305136 4:107319739-107319761 GCCTGTTAACCATAAAGTGATGG + Intergenic
978482059 4:109204130-109204152 TTCTATAAAACAGAAATTGAGGG + Intronic
982546495 4:156739484-156739506 CTATGTAAAGCATAAATAAAAGG - Intergenic
984650752 4:182268421-182268443 CTCTGCAACCCTTAAAATGAAGG + Intronic
986573736 5:9191663-9191685 CTCCATAAGCCATAAAATGATGG + Intronic
986833948 5:11613447-11613469 TTCTGAATACCATAAAATGATGG - Intronic
988761335 5:34313116-34313138 CTTTGTAAACCATAACTTCTAGG + Intergenic
988803661 5:34720278-34720300 ATGTGTAAACCAAAAATTTAAGG + Intronic
989222735 5:38986894-38986916 CTCAGTAAACTATGTATTGATGG - Intronic
989508106 5:42251121-42251143 CTCTTTAAAGCACAAACTGATGG - Intergenic
989597949 5:43174354-43174376 CTCTGTAAAGAAAAGATTGAAGG - Intronic
990705085 5:58519212-58519234 CTCAGTAAACTAAATATTGAAGG + Intergenic
991960043 5:72035173-72035195 CTCTATAAACCATAATTCAAGGG + Intergenic
992516262 5:77496085-77496107 CTCAGAAAACCAGAAATAGAGGG + Intronic
992915850 5:81452425-81452447 TTCTCTAAAACATAAATTTAGGG - Intronic
995359706 5:111281445-111281467 CTATGTATACCATAGATTAAGGG - Intronic
996894190 5:128459782-128459804 CTCAGTAAACCAGGTATTGATGG + Intronic
997420556 5:133763642-133763664 CTTTATAAACTATAAAATGAAGG - Intergenic
1000884680 5:166737344-166737366 CTCTGAAAACAATAAAAAGATGG - Intergenic
1003390453 6:5708659-5708681 CTCTAAAAACCATAAAGTGAGGG - Intronic
1003751074 6:9056841-9056863 CTCTGGAAAACATAAATATATGG + Intergenic
1004342528 6:14819885-14819907 ATATGTATACCATAAACTGATGG - Intergenic
1008064133 6:47029481-47029503 CTCTGTAAACCATTAATACCAGG + Intronic
1010836724 6:80597487-80597509 CTCAGTAAACCAGGTATTGATGG - Intergenic
1012371290 6:98510508-98510530 CTTTGTGAAGCATAAATTGCGGG - Intergenic
1012878780 6:104760513-104760535 CTCAGTAAACTAGGAATTGATGG + Intronic
1012924417 6:105253272-105253294 CTCTGTGAAAAATAAATTAAAGG + Intergenic
1014243994 6:119048198-119048220 CTCAGTAAACAAGATATTGAAGG + Intronic
1014824979 6:126039508-126039530 CTTTCTAAACCAAAAATTGTGGG - Intergenic
1015623016 6:135152525-135152547 CTCAGTAAACTAGATATTGATGG - Intergenic
1016590828 6:145741713-145741735 CTCAATAAACCATTTATTGATGG - Intergenic
1016778096 6:147927838-147927860 CTCAGTAAACTAGATATTGAAGG - Intergenic
1017659588 6:156660772-156660794 CTCAGAAAAACAAAAATTGAGGG + Intergenic
1018307568 6:162473775-162473797 AGCTGAAAACCATAAACTGATGG + Intronic
1018373485 6:163189559-163189581 ATCTGTAAGCTAAAAATTGATGG - Intronic
1020459366 7:8411562-8411584 CTTTCTAATCCACAAATTGAGGG + Intergenic
1021028976 7:15705700-15705722 TTCTGTAATTCATAAATTGAGGG + Intergenic
1021747200 7:23753954-23753976 ATCTGTAGACCAAAAATTGAAGG + Intronic
1023508317 7:40923083-40923105 CTCTATAAAATAGAAATTGAGGG + Intergenic
1024817140 7:53284497-53284519 CTCAGTAAACTAGGAATTGATGG - Intergenic
1025026578 7:55521487-55521509 CTCTCTAAAACAGAAATTGGGGG - Intronic
1025148874 7:56529683-56529705 CTCTGAAAACTAGAAATAGAGGG + Intergenic
1025714829 7:63945559-63945581 CTCAGTAAACCAGGTATTGAGGG + Intergenic
1030178167 7:106676423-106676445 CTCAGTAAACTAGATATTGATGG + Intergenic
1030834941 7:114271448-114271470 CTCAGTAAACCAGGAATAGATGG - Intronic
1031187755 7:118504523-118504545 ATCAGCAAACCAAAAATTGAGGG - Intergenic
1033827970 7:145215323-145215345 CTCAGTAAACCAGGTATTGATGG - Intergenic
1036777243 8:11621973-11621995 CTGTGTAATCCAGAAATTAAGGG + Intergenic
1036804160 8:11817042-11817064 CTCAGTAAACTAGATATTGATGG - Intronic
1039246612 8:35615399-35615421 CTGTGTAAACCACAAACAGATGG - Intronic
1040450890 8:47545803-47545825 CTCAGAAAACTAGAAATTGAGGG - Intronic
1040595470 8:48834149-48834171 CTCTCTAATCTATAAGTTGAGGG + Intergenic
1042774694 8:72417476-72417498 CTCACTAAACCAGAAATAGAAGG - Intergenic
1043625022 8:82245535-82245557 CTGAGTAAACTATAAATTGTAGG + Intergenic
1044281167 8:90358355-90358377 CACTATAAACCAAAATTTGATGG + Intergenic
1044933263 8:97270395-97270417 CTTTGTAAACCATGAAGTGTTGG + Intergenic
1045039257 8:98205898-98205920 TTATGTAAACCTTAAATTGATGG - Intronic
1045728281 8:105201845-105201867 CTCAATAAACTATATATTGAAGG + Intronic
1046471094 8:114675124-114675146 TTCTGGATACCATCAATTGATGG - Intergenic
1046855946 8:119032214-119032236 ATCTGTAAAATATAAGTTGAGGG + Intronic
1047014439 8:120708788-120708810 CTTAGTAAACCAGAAATAGAAGG + Intronic
1047195742 8:122719798-122719820 CTCTGTGAACTATAAAATGACGG + Intergenic
1048417351 8:134242231-134242253 CTTTGTATTCCACAAATTGAGGG - Intergenic
1048749907 8:137661123-137661145 CTGTGTAAAGCATGAATTGAAGG - Intergenic
1049904612 9:204118-204140 CTATGTAACCCATACAGTGAAGG - Intergenic
1050211041 9:3256457-3256479 CTTTTTAAAACATAAATTGCTGG + Intronic
1050440851 9:5662003-5662025 CTCAATAAACCAGATATTGAAGG - Intronic
1050464423 9:5906505-5906527 CTTTGTCAAGCAAAAATTGAGGG - Intronic
1052034850 9:23668985-23669007 CTCTGAAAAAAATACATTGAGGG - Intergenic
1053624191 9:39851990-39852012 CTGTGAAAACCATAAATTCTTGG - Intergenic
1053880675 9:42591238-42591260 CTGTGAAAACCATAAATTCTTGG + Intergenic
1054219706 9:62398708-62398730 CTGTGAAAACCATAAATTCTTGG + Intergenic
1054231009 9:62510465-62510487 CTGTGAAAACCATAAATTCTTGG - Intergenic
1054812965 9:69449404-69449426 ATCTGTAAACAGTAACTTGATGG + Intronic
1054996921 9:71401990-71402012 GTGTGTAATCCGTAAATTGATGG + Intronic
1055049848 9:71967908-71967930 CTCAGTAAACTATGAACTGAAGG - Intronic
1056346013 9:85695583-85695605 CTCTTTAAACTACAAATTCATGG - Intronic
1057429465 9:94980462-94980484 GTCTGTGAACCATGAAATGAAGG + Intronic
1058142968 9:101377574-101377596 CTCAGTAAACTAGATATTGATGG + Intronic
1058299473 9:103353141-103353163 CTCTGAAAACCAGTAATAGAAGG - Intergenic
1060385193 9:123219516-123219538 TTCTCCAAACTATAAATTGAAGG + Intronic
1062229867 9:135476017-135476039 GTCTGTTAACTATAAATTGCAGG - Intergenic
1062729071 9:138098390-138098412 CTCTCTAAACCACACATTCAGGG - Intronic
1186572662 X:10732023-10732045 CTCTGTAAATTAGGAATTGAAGG + Intronic
1187767182 X:22655189-22655211 CTTGTTAAACCATAAATTGCTGG + Intergenic
1188072364 X:25732220-25732242 CAGTGTAAACCACAAATTTAGGG + Intergenic
1190394386 X:49965781-49965803 CTCAGTAAACTAGGAATTGAAGG - Intronic
1190537527 X:51444734-51444756 ATCAGTAAACAATAAATGGAAGG + Intergenic
1191097119 X:56685186-56685208 CTCAGTAAACCAGGTATTGATGG - Intergenic
1191809654 X:65173594-65173616 CTCAATAAACTATATATTGATGG - Intergenic
1191975180 X:66863745-66863767 CTCTGAAAACCCTGAGTTGAAGG - Intergenic
1192004600 X:67196713-67196735 CTCAGTAAACTAGATATTGATGG + Intergenic
1192686798 X:73315599-73315621 CTCAGTAAACTAGATATTGATGG + Intergenic
1192791860 X:74390082-74390104 CTCAGAAAAACAAAAATTGAGGG + Intergenic
1193214056 X:78841176-78841198 CTCAGTAAACTAGATATTGAAGG - Intergenic
1193385345 X:80864627-80864649 CTCAATAAACCACATATTGAAGG - Intergenic
1193482190 X:82041485-82041507 CTCAGAAAACTAGAAATTGAGGG - Intergenic
1194209135 X:91048186-91048208 CTCTGTAAACCAATTCTTGAAGG + Intergenic
1194520351 X:94910447-94910469 CTCAATAAACCAGATATTGATGG + Intergenic
1195149808 X:102055427-102055449 CTCAGTAAACTATGTATTGAAGG + Intergenic
1198968558 X:142253495-142253517 ATATAGAAACCATAAATTGATGG + Intergenic
1199120818 X:144051666-144051688 CTCTATAAACTAGATATTGAAGG + Intergenic
1199857177 X:151769073-151769095 CTCAATAAACCACATATTGAAGG + Intergenic
1201224487 Y:11805037-11805059 CTCAATAAACCAGAAATTAAAGG + Intergenic
1201591542 Y:15620445-15620467 CTCAGTAAACTAGGAATTGAGGG + Intergenic
1202135944 Y:21661633-21661655 CTCTGTTAACTATATATTAATGG - Intergenic