ID: 1125940839

View in Genome Browser
Species Human (GRCh38)
Location 15:43676307-43676329
Sequence GCACCCTGAAATGCTCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125940836_1125940839 14 Left 1125940836 15:43676270-43676292 CCGATACATGCAGAAACTTCTCT No data
Right 1125940839 15:43676307-43676329 GCACCCTGAAATGCTCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125940839 Original CRISPR GCACCCTGAAATGCTCCAAC TGG Intergenic
No off target data available for this crispr