ID: 1125941441

View in Genome Browser
Species Human (GRCh38)
Location 15:43681223-43681245
Sequence CAGTGATGCTATGTACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125941441_1125941446 27 Left 1125941441 15:43681223-43681245 CCTGCAGGTACATAGCATCACTG No data
Right 1125941446 15:43681273-43681295 GAGAAGACAATATGAGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125941441 Original CRISPR CAGTGATGCTATGTACCTGC AGG (reversed) Intergenic
No off target data available for this crispr