ID: 1125942737

View in Genome Browser
Species Human (GRCh38)
Location 15:43690424-43690446
Sequence AAATTTTAACAGATGTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 2, 1: 0, 2: 6, 3: 64, 4: 611}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125942736_1125942737 -5 Left 1125942736 15:43690406-43690428 CCAATAAATAAAGGTTGAAAATT 0: 2
1: 0
2: 6
3: 50
4: 615
Right 1125942737 15:43690424-43690446 AAATTTTAACAGATGTAAAGAGG 0: 2
1: 0
2: 6
3: 64
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125942737 Original CRISPR AAATTTTAACAGATGTAAAG AGG Intergenic
900838732 1:5029293-5029315 AAATTTAAACACATTTTAAGTGG + Intergenic
901100021 1:6712729-6712751 AAATTTTGGAAGATGTAAAATGG - Intergenic
901767209 1:11510630-11510652 AAATGGTAACAGATGGAAATAGG - Intronic
903775554 1:25791257-25791279 AAACTTTCAGAAATGTAAAGTGG - Intergenic
905549645 1:38825995-38826017 ATATTTTAAAAGAGGTAAATGGG - Intergenic
905836296 1:41125007-41125029 AAATTTGATCACATGTTAAGAGG + Intronic
906475683 1:46167815-46167837 AAATTTTAGCTAATGCAAAGGGG - Intronic
906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG + Intronic
907774917 1:57504687-57504709 AAATTGTACCATATGGAAAGGGG + Intronic
909587195 1:77303260-77303282 AATTTTTAAAAAGTGTAAAGAGG - Intronic
910096394 1:83526982-83527004 AATTTTTATCATATGTAAAATGG + Intergenic
910315560 1:85878771-85878793 CCATTCTAACAGATGTATAGTGG + Intronic
910404225 1:86869503-86869525 AAATCTTAAAATATATAAAGTGG + Intronic
911013973 1:93312318-93312340 AAACATTAAGAGATCTAAAGGGG + Intergenic
911526714 1:98996546-98996568 ATATTTTAACATATGTGAAGTGG - Intronic
912589872 1:110806478-110806500 AAACATTAACAAATCTAAAGGGG + Intergenic
913160710 1:116143415-116143437 AATTTTAAAAAGATGAAAAGTGG - Intergenic
913338760 1:117735087-117735109 AAATTTTATCAAATGAAAACAGG - Intergenic
914513802 1:148356492-148356514 AAATTTTTACAGTTTTACAGTGG - Intergenic
914976758 1:152372031-152372053 AATTTTCAACAGATGTACAAAGG + Intergenic
915409631 1:155689930-155689952 AAATAATAATATATGTAAAGTGG + Intronic
915851917 1:159333151-159333173 ACATTTTTACAGAAATAAAGTGG - Intergenic
916938860 1:169659800-169659822 AAATTTTACCAGAGGTACAGAGG + Intergenic
917171845 1:172185290-172185312 AAATTGGAACAAATGTAAACAGG - Intronic
917298558 1:173548428-173548450 AAATTTTGACAAATGTTAACTGG - Exonic
917351103 1:174078602-174078624 AAATTTTAGAAGCTGAAAAGTGG - Intergenic
917825644 1:178817604-178817626 AAATTTCCACAGATATAAAATGG - Intronic
918171466 1:182002108-182002130 TCATTTTAGCAGATGTACAGTGG + Intergenic
918214266 1:182379530-182379552 AAATTATAACTGATGTAAACTGG - Intergenic
918279028 1:182984751-182984773 TCTTTCTAACAGATGTAAAGGGG + Intergenic
918530994 1:185522906-185522928 GAATATTAACAGAGATAAAGAGG - Intergenic
919053521 1:192540649-192540671 ATATTTTAAAAGACATAAAGTGG - Intergenic
919256074 1:195127146-195127168 ATATTTAAACAGTTGTAAATTGG + Intergenic
919627207 1:199923234-199923256 AAATTCTACCAGATGTACAAAGG + Intergenic
920097321 1:203494684-203494706 AAATTTTAAAAGAAAGAAAGAGG + Intronic
920750759 1:208673711-208673733 AAATTTAAAAATATGTAAAATGG - Intergenic
920985182 1:210882216-210882238 AATTTTTAAAAAATTTAAAGAGG + Intronic
921003102 1:211064939-211064961 TCATTTTAACAGATGTGAGGTGG - Intronic
921482755 1:215681871-215681893 AAATATTAAAAGATTTCAAGAGG - Intronic
921515691 1:216088311-216088333 AAATTTAAACAAATATCAAGTGG - Intronic
921693631 1:218181780-218181802 TATTTTTAACAGATGTACTGAGG + Intergenic
922226448 1:223649998-223650020 CAGTTTTCACAGCTGTAAAGTGG - Intronic
922386716 1:225093055-225093077 AAATTCTACCAGATGTATAAAGG + Intronic
922939012 1:229444906-229444928 AACTTTTAAAAGATGGTAAGTGG - Exonic
922968516 1:229714546-229714568 AAATATTACCAGAAATAAAGAGG + Intergenic
923107551 1:230866277-230866299 GAATTTTAACAGAGGTACATAGG - Intronic
923312149 1:232745507-232745529 CATTTCTAACACATGTAAAGTGG - Intergenic
923634217 1:235679419-235679441 AAATTTTCAAAGATTTAGAGTGG - Intronic
923674848 1:236071488-236071510 AAATTCTTAGAGATGGAAAGTGG - Intergenic
924526263 1:244853159-244853181 AACTTTTAACATATTTAATGAGG - Intronic
924536969 1:244943762-244943784 AATTTTTAACTAATGTAATGTGG - Intergenic
924680791 1:246230391-246230413 AAATTTTAAAAGAAGTACATAGG + Intronic
1063033505 10:2260680-2260702 AAATATTAATAGATCTAAAAGGG + Intergenic
1063137472 10:3229840-3229862 AAATTATAAAATAAGTAAAGGGG + Intergenic
1063328166 10:5126346-5126368 ACATTTCTACAGATGAAAAGAGG + Intronic
1063807685 10:9665978-9666000 AAATTTAAAAACATGTGAAGAGG - Intergenic
1064486455 10:15797317-15797339 AAATGTTAAAAAATGTCAAGTGG - Intronic
1065102442 10:22344475-22344497 CAATTTCACCAGATGTCAAGTGG - Intergenic
1065447320 10:25816434-25816456 AAATTGTCACAAATGTAAGGAGG + Intergenic
1065517802 10:26542454-26542476 TAATTTTAAAAAATGTAAATCGG - Intronic
1065604960 10:27408555-27408577 AAATATTGACAGAAGTGAAGGGG + Intronic
1066668408 10:37810790-37810812 AAATGTTAACAGACGTGAAGAGG + Intronic
1067086922 10:43246899-43246921 AAATTTTAAAAGAGATAAATTGG + Intronic
1067353224 10:45496438-45496460 AAATTTTACCAGAGATAAAGAGG + Intronic
1067353263 10:45497200-45497222 AAATTTTACTAGAGCTAAAGAGG + Intronic
1067395937 10:45917731-45917753 AATTTTTAACAGAGTTAAAGAGG - Intergenic
1067775193 10:49159190-49159212 AAATTTTAAAAGATTAAAACAGG + Intronic
1067791325 10:49289846-49289868 AAATGTACACAAATGTAAAGAGG + Intergenic
1067864260 10:49886859-49886881 TATTTTTAACAGAGTTAAAGAGG - Intronic
1068224601 10:54090881-54090903 AAATGTTAATAGATGTTGAGAGG + Intronic
1068270955 10:54723271-54723293 AAATGTTAACAAAAGTAAATAGG + Intronic
1068423632 10:56827167-56827189 ACATTTTACCAGATGTACAAAGG + Intergenic
1068565815 10:58573925-58573947 GAATTTTGCCAGATGTAGAGTGG - Intronic
1068852670 10:61762096-61762118 AAATGTTATCAGATCTAAAAAGG - Intronic
1070316270 10:75316075-75316097 AAATATTAACAGATCTAAAGGGG + Intergenic
1070369580 10:75769676-75769698 AAATTTTAACATATCAAAATTGG + Intronic
1070562554 10:77578810-77578832 ACATTTTAACAAATATATAGGGG - Intronic
1071278815 10:84080840-84080862 AAATTTTAAAAGAAGTATAATGG - Intergenic
1071679849 10:87694142-87694164 CAATTTTATGAGATGTAGAGAGG + Intronic
1072288630 10:93941387-93941409 AATTTTGAAAAGAAGTAAAGGGG + Intronic
1072356090 10:94612617-94612639 ACATTTTTAAAAATGTAAAGGGG + Intronic
1072855936 10:98946725-98946747 AAATGTAAACAAATGTAAAGAGG + Intronic
1073373863 10:103015972-103015994 AAATCTTAAAAGCTGTAAGGGGG - Intronic
1074173661 10:110973126-110973148 AAGTTTGAACAGATTTAGAGAGG - Intronic
1074660593 10:115652151-115652173 ATATTTTCATAGCTGTAAAGGGG + Intronic
1074953169 10:118360918-118360940 AAATTTTAAAAGGTGTAAATAGG - Intergenic
1075449728 10:122542065-122542087 AATTATTAACAGACATAAAGAGG - Intergenic
1076409772 10:130238237-130238259 AAATTTTAAAAGACTTAAATGGG - Intergenic
1076423020 10:130345797-130345819 AAATGTTAACAGCTTTAAGGAGG + Intergenic
1076479563 10:130776019-130776041 ATATTTTAACAGGTGTCATGTGG - Intergenic
1078194448 11:9123763-9123785 CCATTTTAACGGATGTTAAGAGG - Intronic
1079294057 11:19216292-19216314 CCATTTTAACAGATGTGTAGTGG + Intergenic
1079318245 11:19428360-19428382 AAATTTTGCCAGCTGCAAAGTGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079460194 11:20671578-20671600 AATTTTTACAAGATTTAAAGGGG - Intronic
1079476814 11:20839748-20839770 AAAATATGCCAGATGTAAAGAGG - Intronic
1080972705 11:37298558-37298580 AAATGTAAACAAATGTAAATAGG + Intergenic
1080984622 11:37446374-37446396 AAATTTCAAAACATGTTAAGAGG + Intergenic
1081164209 11:39787340-39787362 AAATTTTCTCAGTTGTAAAATGG + Intergenic
1081293320 11:41353427-41353449 AAATTCTACCAGATGTATAAAGG + Intronic
1081384057 11:42449811-42449833 CAATTTTAACAGATGTACTTGGG - Intergenic
1081437114 11:43039404-43039426 AAATTTTAAATGAGGTAAACAGG + Intergenic
1081563136 11:44237743-44237765 AGATCTTAACAAATGTAAAGAGG + Intronic
1082089787 11:48079882-48079904 AAATGTTAAAAGATACAAAGAGG + Intronic
1082176502 11:49066191-49066213 ATATTCTCACAGATGTAAAGGGG + Intergenic
1084040088 11:66537522-66537544 ACATTTTCAAAGATGGAAAGTGG - Intronic
1085539187 11:77250790-77250812 AAATATTATTAGATTTAAAGGGG - Intronic
1085598094 11:77828716-77828738 AAATTTTAAAAGACGTACATGGG + Intronic
1085989814 11:81828118-81828140 GAGTCTAAACAGATGTAAAGAGG - Intergenic
1086253184 11:84842300-84842322 CAGTTTTAACATCTGTAAAGTGG - Intronic
1086284706 11:85233585-85233607 AGATTTTACCAGAGATAAAGGGG + Intronic
1086689212 11:89769684-89769706 ATATTCTCACAGATGTAAAGGGG - Intergenic
1086716646 11:90070287-90070309 ATATTCTCACAGATGTAAAGGGG + Intergenic
1087169920 11:95040212-95040234 AAATCATAACATATATAAAGAGG - Intergenic
1087344496 11:96953971-96953993 AAATTTAAACAGTTGGAAAAAGG + Intergenic
1087417864 11:97881465-97881487 AAATTTTAATAGCTGTTAAGTGG - Intergenic
1087462955 11:98468341-98468363 AAAAATTAACAGAATTAAAGGGG + Intergenic
1087574250 11:99970794-99970816 AGATTTTAATAGAGATAAAGGGG + Intronic
1087866422 11:103233007-103233029 AAATTTAAATAGCCGTAAAGTGG + Intronic
1089676016 11:120090152-120090174 ACATGTGAACACATGTAAAGAGG - Intergenic
1089952280 11:122539880-122539902 AAATCTTAACAAATGTAAGAAGG + Intergenic
1090966337 11:131600617-131600639 AAATTTTAAAACATATAATGGGG + Intronic
1091199092 11:133758095-133758117 AAATTACAACACATGCAAAGAGG + Intergenic
1091957884 12:4663272-4663294 AAATTATTACAGATGTTAGGTGG - Intronic
1092116071 12:6007336-6007358 AAATCTTAACAAATTTAAGGAGG + Intronic
1092916894 12:13197408-13197430 AAATTTAAACAGAAGTGAATAGG - Intronic
1093239763 12:16655875-16655897 AAATTCTACCAGATGTACAAAGG - Intergenic
1094056804 12:26276383-26276405 AAATTTTACTAGTTGTAAAAAGG - Intronic
1094355114 12:29569163-29569185 ATATTATAAATGATGTAAAGAGG + Intronic
1095045877 12:37504349-37504371 TCATTTTGATAGATGTAAAGTGG + Intergenic
1095235831 12:39794409-39794431 AGAATTTAAAATATGTAAAGAGG - Intronic
1095323512 12:40859148-40859170 AATTTAAAACAGATATAAAGAGG + Intronic
1095417703 12:41994479-41994501 AAATGGTATCATATGTAAAGAGG + Intergenic
1097564953 12:61255598-61255620 AAATTATAACAGTTTTGAAGAGG + Intergenic
1097788009 12:63782468-63782490 AAATTTTACCAGCTGTCAACAGG - Intronic
1097906993 12:64930916-64930938 ACATTTCTACAGATGAAAAGAGG - Intergenic
1098178993 12:67825522-67825544 AAAGTTATACAGCTGTAAAGTGG + Intergenic
1098490958 12:71077342-71077364 AAAAATTAACACATGTAAAATGG + Intronic
1098566702 12:71945313-71945335 AAATAAAAACAGATGTAAAAGGG - Intronic
1098572200 12:72000943-72000965 AAATGTTAGAAAATGTAAAGGGG + Intronic
1098714668 12:73814967-73814989 AAATTGTAAAAGATGTAAAAAGG - Intergenic
1098971472 12:76861589-76861611 AAATTTTAACAAAGATAAAAAGG + Intronic
1098972612 12:76872071-76872093 CTATTTTATCACATGTAAAGTGG - Intronic
1099122865 12:78713532-78713554 ATATTTTAACAGCTGTATTGAGG - Intergenic
1099518284 12:83626600-83626622 AAATGTTAACAAATGTACAATGG - Intergenic
1099644319 12:85331682-85331704 AAATTTTAGAAGCTGTAAAGTGG - Intergenic
1099694965 12:86006686-86006708 AAATTTGATCAGATGTTGAGAGG - Intronic
1099869721 12:88331705-88331727 AATTTTTAATAGAGGTTAAGAGG + Intergenic
1099934977 12:89114983-89115005 AAAATTTAAATAATGTAAAGAGG - Intergenic
1100060812 12:90573632-90573654 AAATTTTAAAAGGTAAAAAGTGG - Intergenic
1100084193 12:90887584-90887606 AAGTTTTAACCAATGAAAAGAGG + Intergenic
1100138157 12:91581674-91581696 ATATGTTAACATATGTAAAGTGG - Intergenic
1100342526 12:93693598-93693620 AAATATTAATAGATCTGAAGGGG + Intronic
1100780125 12:98015803-98015825 AAATGTTAACATAACTAAAGGGG + Intergenic
1101027107 12:100620758-100620780 AAATTTTTACAGACAGAAAGTGG + Intronic
1101459585 12:104876916-104876938 AATTGTTAACAGATATGAAGGGG - Intronic
1103345592 12:120247898-120247920 GAATATTACCAGAGGTAAAGAGG + Intronic
1104629551 12:130387789-130387811 AAGTTTTAACAAATGTACATGGG + Intergenic
1104991797 12:132628718-132628740 AAAATTTAACAGATAAAGAGTGG - Intronic
1105285972 13:19004362-19004384 AAATTCTACCAGACGTACAGAGG - Intergenic
1105337215 13:19484602-19484624 GAATATTAATAGATCTAAAGAGG - Intronic
1105547490 13:21361500-21361522 AAATTTTAACAGTTAAAACGGGG - Intergenic
1105580891 13:21694881-21694903 AACTTTTAACACATGTTCAGAGG - Intronic
1105669778 13:22600133-22600155 AACTTTCAACAGATTTAAACAGG - Intergenic
1106072752 13:26428539-26428561 AAATGTTAAGAGATCTGAAGAGG + Intergenic
1106172416 13:27299364-27299386 AAATTTTTAAAAATGTAAAAAGG + Intergenic
1106290200 13:28353971-28353993 TATGTTTAACAGATTTAAAGAGG - Intronic
1106305883 13:28508881-28508903 AAATTTGAACACAGGTACAGAGG + Intergenic
1106932145 13:34678027-34678049 TAATTTTTAAAGATGTAAACAGG - Intergenic
1107296025 13:38908655-38908677 AAATGTAAACAAATATAAAGAGG + Intergenic
1107423482 13:40271209-40271231 AAAATATAACAGTTGTTAAGAGG - Intergenic
1107616966 13:42179898-42179920 AAATTTCTACAGATGCAAACAGG - Intronic
1107843561 13:44486275-44486297 AAATGCTAAAAGATGAAAAGTGG + Intronic
1107917831 13:45170388-45170410 AAATTTTAAAAGATGTTAAGTGG - Intronic
1108632432 13:52299746-52299768 AAATATTAGTAGATCTAAAGAGG - Intergenic
1108654270 13:52512848-52512870 AAATATTAGTAGATCTAAAGAGG + Intergenic
1108666665 13:52639613-52639635 AATTTTTAACAGTTCTACAGTGG + Intergenic
1108901784 13:55419642-55419664 AGAATTAAAAAGATGTAAAGGGG - Intergenic
1109008251 13:56906398-56906420 AAAATTTAATAAATGTATAGGGG + Intergenic
1109066674 13:57703035-57703057 AAATTTTAATAAAAGTAAACTGG - Intronic
1109214634 13:59574743-59574765 AAACATTAATAGATTTAAAGGGG + Intergenic
1109265243 13:60191361-60191383 AAATTTTAAGGGAGGGAAAGTGG + Intergenic
1109688114 13:65847180-65847202 TAATTTGAACAAATCTAAAGCGG + Intergenic
1109804263 13:67417404-67417426 TAATTATGACAGATGTAAACAGG + Intergenic
1109807934 13:67468610-67468632 AAATATTATCAGATATAAAGGGG - Intergenic
1110054442 13:70947722-70947744 ATATTTTATGAGATATAAAGCGG - Intergenic
1110066924 13:71119801-71119823 AACCTTTAAAATATGTAAAGAGG + Intergenic
1110757577 13:79193868-79193890 AAATTTTCACAGAAGTAACACGG + Intergenic
1110929467 13:81196511-81196533 AAAAGTTAACTAATGTAAAGTGG - Intergenic
1110945195 13:81405286-81405308 AAGTTTGAACAGATTAAAAGAGG + Intergenic
1111159458 13:84374733-84374755 AATTTTTAACAATTTTAAAGGGG - Intergenic
1111267132 13:85831280-85831302 TAATTTTAAGAGCTGTGAAGAGG - Intergenic
1111768800 13:92569739-92569761 AATTTCTAGCAGATGTACAGTGG - Intronic
1112713106 13:102152865-102152887 TAATTTTAAAAGATGTGAGGGGG + Intronic
1113712005 13:112471726-112471748 TAATTTTAACATATGGAATGAGG - Intergenic
1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG + Intronic
1114598583 14:23935207-23935229 AAACTATATCAGATGTATAGTGG + Intergenic
1114786168 14:25601988-25602010 AAAGATTAAAAGATGTAAAATGG - Intergenic
1115218783 14:31038692-31038714 AAATTTTCACATCTGTAAAGTGG + Intronic
1115570365 14:34660709-34660731 GAATATTAACAGGTATAAAGAGG - Intergenic
1116577685 14:46595887-46595909 AAATTCTAACAGATGTGAGTTGG + Intergenic
1116754055 14:48923753-48923775 AAATTTTAACTAATGAAAAAGGG + Intergenic
1117308939 14:54502994-54503016 GAGTTTTCACAGATGTATAGAGG - Intergenic
1117688057 14:58276173-58276195 ACATTATAATAGATGTAGAGTGG - Intronic
1118044318 14:61950197-61950219 AATTTTTGAAAGATGTAAAGAGG - Intergenic
1118045370 14:61964491-61964513 AAACTTGAACAGATGAAAAGTGG + Intergenic
1119792301 14:77362977-77362999 AAATTTTAATAGACATGAAGGGG + Intronic
1119811143 14:77520603-77520625 AAATTTTATTATATGCAAAGTGG - Intronic
1123954414 15:25319898-25319920 AATTTTTAAATGATGTGAAGAGG - Intergenic
1124552094 15:30690836-30690858 AATCTTTAAAAGATGTAAATTGG - Intronic
1124578879 15:30934174-30934196 AAAGATTACCAGGTGTAAAGGGG - Intronic
1124679149 15:31714833-31714855 AATCTTTAAAAGATGTAAATTGG + Intronic
1125929570 15:43590592-43590614 AAATTTTAACAGATGTAAAGAGG + Intergenic
1125942737 15:43690424-43690446 AAATTTTAACAGATGTAAAGAGG + Intergenic
1126012979 15:44320948-44320970 AAATTTAAACAGATGGGAAAGGG - Intronic
1126400872 15:48268684-48268706 AATTAATAACAGATGAAAAGAGG - Intronic
1126537922 15:49787286-49787308 AAATTTTAACAGATTAAATCTGG - Intergenic
1126973693 15:54149413-54149435 AAGGGTTAACAGATGTAAACAGG + Intronic
1127110778 15:55667102-55667124 ATATTTTTCCAAATGTAAAGAGG + Intronic
1127137548 15:55940404-55940426 AAATTTTAACTGATTTATTGGGG - Intronic
1127205852 15:56717696-56717718 AAATTTCCACAGCTGTAAACAGG - Intronic
1127482430 15:59390019-59390041 AAATTTTACCATATGTTATGAGG - Intronic
1127761360 15:62142643-62142665 AGATTTTAACAGTTGTGAACAGG + Intergenic
1129637656 15:77338986-77339008 AAATTTTAAAATTTGTAAATTGG + Intronic
1130084807 15:80768734-80768756 ACACTTCAACTGATGTAAAGGGG + Intergenic
1130718466 15:86362225-86362247 AAATATTAAAAGATGTAAACTGG - Intronic
1131537480 15:93249524-93249546 ATAGTCTAACAGATGTAAAGTGG - Intergenic
1131591431 15:93753233-93753255 AAAAATTAACAGAAATAAAGAGG + Intergenic
1131811792 15:96180622-96180644 AGATTTTGATAGATGGAAAGGGG + Intergenic
1132472673 16:114733-114755 AAATTTTTTCAGATGTACAAAGG + Intronic
1133070224 16:3241807-3241829 TCATTTAAAGAGATGTAAAGGGG - Intergenic
1134675827 16:16090008-16090030 CAATTTTAACAAAGGTAATGGGG - Intronic
1136644714 16:31602320-31602342 AAAACTTTACAAATGTAAAGTGG - Intergenic
1136664563 16:31798048-31798070 AAATTCTACCAGATGTACAAAGG - Intergenic
1136681313 16:31965066-31965088 AAATTTAAACATATATAATGTGG + Intergenic
1137030929 16:35523439-35523461 AAGTTTTACAAAATGTAAAGTGG - Intergenic
1138155943 16:54702867-54702889 AAATGTTACGAGAAGTAAAGGGG + Intergenic
1140383835 16:74515699-74515721 TAATTTTAAAAAATGTAAAGGGG + Intronic
1141315363 16:82957494-82957516 AAATTTTATCATTTGTAAAGAGG - Intronic
1142870031 17:2814101-2814123 AAATATTCACAGAAGAAAAGGGG + Intronic
1143196922 17:5082827-5082849 AATTTTTAAAAGATGTAATCAGG + Intronic
1144009230 17:11130167-11130189 AAATTTTAACAGCTTTATTGAGG - Intergenic
1144144698 17:12386144-12386166 AGATTTTAAAAAATGTAATGTGG + Intergenic
1147530548 17:41272419-41272441 AAATTTTTTCAGCTGGAAAGTGG - Intergenic
1147812089 17:43178904-43178926 AAATTTTGCCAGATGCAGAGAGG - Intronic
1148146437 17:45367893-45367915 AAATTTTAAGAGATATCAATAGG + Intergenic
1148514823 17:48206750-48206772 AATTTTTAAAAAATGGAAAGGGG + Intronic
1149198903 17:54159410-54159432 ACATTTTAATAGATGTTTAGTGG - Intergenic
1149230834 17:54532091-54532113 AAATGTTAACAGTAGTAAAGAGG - Intergenic
1149394745 17:56228519-56228541 AAATTTTAGCAGATCTGAACTGG + Intronic
1149630699 17:58119949-58119971 GAATTTTAACAGAAGAAAACAGG + Intergenic
1150130844 17:62667959-62667981 TAAGTTTAAAAGATATAAAGAGG + Intronic
1150473091 17:65453954-65453976 ATTTGTTAACAGATGCAAAGCGG - Intergenic
1150535803 17:66039002-66039024 AAATTTTCAGAGAGGTAAAATGG + Intronic
1150985411 17:70191220-70191242 ACATTTTATCAAATGTCAAGAGG + Intergenic
1151250405 17:72829675-72829697 GGATTTTAACAGATGGAAAGGGG - Intronic
1152503798 17:80732852-80732874 GAATTTGACCAGCTGTAAAGAGG - Intronic
1153067884 18:1067275-1067297 TTATTTTGACAGATTTAAAGAGG + Intergenic
1153423270 18:4932847-4932869 TATTTTCAGCAGATGTAAAGGGG + Intergenic
1153454495 18:5265220-5265242 GAATTCTAACAGATGTACAGAGG + Intergenic
1155403335 18:25461896-25461918 AAAGTTTAATAGAAGAAAAGAGG + Intergenic
1155992958 18:32299578-32299600 GAATTTTGTCAGATGTAAAAAGG - Intronic
1156002860 18:32405170-32405192 AAATTGTAAGAGAAGTACAGTGG - Intronic
1156645186 18:39152558-39152580 GAAGTTTAAAAGATGAAAAGTGG + Intergenic
1156869523 18:41929325-41929347 AAATATAAGCAGATGTATAGGGG + Intergenic
1156879036 18:42053851-42053873 AAATGTTCACAAAAGTAAAGAGG + Intronic
1157140521 18:45101383-45101405 ATATTTTAACAGGTCTAAAGAGG - Intergenic
1157745411 18:50130758-50130780 AAATTTGAGCAGATGAAAAATGG - Intronic
1158027999 18:52925879-52925901 TAATTTAAACAGATTTAAGGAGG + Intronic
1158089210 18:53691018-53691040 AAATTTGAGAGGATGTAAAGGGG - Intergenic
1158611604 18:58945428-58945450 AAATACTAACAGATATAAAAGGG - Intronic
1159502150 18:69287293-69287315 AATTTTTACAAGAGGTAAAGAGG + Intergenic
1159705042 18:71675620-71675642 AATTTTTAAGTGATGGAAAGAGG + Intergenic
1160293007 18:77611065-77611087 AAATTTTCTCAGAGATAAAGTGG - Intergenic
1162116713 19:8434393-8434415 ATATTTTAAAATATGTAAATAGG + Intronic
1163108149 19:15139764-15139786 CAATCCTAATAGATGTAAAGTGG - Intergenic
1163181246 19:15605246-15605268 AAAAGTTAGCAGATTTAAAGTGG + Intergenic
1163275526 19:16281639-16281661 AAATTTTATAAAATGTAAAAAGG + Intergenic
1163351948 19:16782552-16782574 AATTTTTAAAAAATTTAAAGGGG + Intronic
1164048935 19:21567728-21567750 AATTTTTAATAGATGAAAAGAGG + Intergenic
1164123268 19:22286930-22286952 AATTTTTAACAGAAGAAAAGAGG - Intronic
1164162275 19:22634859-22634881 AATTTTTAATAGAAGAAAAGAGG - Intronic
1164213149 19:23117549-23117571 AATTTTTAACAGAAGGAAAGAGG - Intronic
1164486638 19:28662138-28662160 AAATTTTACCAGATATATAAAGG + Intergenic
1165203946 19:34168060-34168082 AAATTGTTACAGATGGAAAAAGG - Intergenic
1167387470 19:49172211-49172233 AAATATTAAGAGGGGTAAAGGGG - Intronic
1168551314 19:57298189-57298211 AAATATTATTAGATCTAAAGGGG - Intergenic
925315084 2:2916020-2916042 CAATTTTAACAAATGAAAAAAGG - Intergenic
926191309 2:10729981-10730003 AAAGTTTCACAAATGTTAAGGGG - Intronic
926386291 2:12338817-12338839 ACAGTTTAACAGATGGAATGTGG - Intergenic
926822251 2:16865351-16865373 AAAATTTATAAGATATAAAGAGG - Intergenic
926988239 2:18647688-18647710 AAATTTTGAGAGCTGGAAAGAGG + Intergenic
927263017 2:21113394-21113416 AAATTCTAATGGAGGTAAAGTGG - Intergenic
927762092 2:25767019-25767041 AAATTTTGAGAGATGAAAACTGG - Intronic
927781124 2:25940233-25940255 AAATTTTTTCATCTGTAAAGTGG - Intronic
927849540 2:26490206-26490228 ATATTTTACCAAATCTAAAGTGG + Intronic
928281087 2:29947048-29947070 CAATTTTAGCAGATTTGAAGGGG - Intergenic
929086745 2:38175541-38175563 CAATTTTATCATCTGTAAAGTGG - Intergenic
929372039 2:41237013-41237035 AAATCTTCACACATGTAAAATGG + Intergenic
929420290 2:41783556-41783578 AAATTTTAAAAGAAAAAAAGAGG + Intergenic
929812565 2:45203269-45203291 AAATCTTATCAGATCAAAAGGGG + Intergenic
929958914 2:46481157-46481179 AAATTTTAAGAGATGCAGAGAGG - Intronic
930273608 2:49285070-49285092 AGATGTAAAGAGATGTAAAGTGG + Intergenic
930428107 2:51236932-51236954 AAATTTCACCAGATGTGAAATGG - Intergenic
930528281 2:52559087-52559109 AAAAATTAAGAGATGGAAAGTGG - Intergenic
930814154 2:55575238-55575260 ATATTTTAAAAGTTGTAAATAGG - Intronic
931084954 2:58819582-58819604 AAAATTTAACAGAAGGAGAGAGG - Intergenic
931860873 2:66353065-66353087 TAATTTTAACAGAAGTGACGTGG + Intergenic
932240946 2:70156253-70156275 AAATTATAATAAATATAAAGAGG + Intronic
932384119 2:71315206-71315228 AAATGTAAACAAATGTAAAGAGG - Intronic
933465805 2:82649767-82649789 TATTTTTAACAGCTGTAATGAGG - Intergenic
933613127 2:84458304-84458326 AAATATTAACACATTTTAAGGGG - Intronic
934956075 2:98621069-98621091 GTATTTTAAAAGAGGTAAAGAGG - Exonic
935758918 2:106300491-106300513 AAAATTTAAAAGATGTTAACAGG + Intergenic
936757520 2:115732656-115732678 AAATTTTCAAAGCTGTGAAGTGG - Intronic
937540402 2:122944641-122944663 CCATTTTAACAGATATGAAGTGG - Intergenic
937587696 2:123573880-123573902 TACTTTTAACAGATTTAAAATGG - Intergenic
937713054 2:124999948-124999970 AATCTTTAAAATATGTAAAGAGG - Intergenic
937842947 2:126544245-126544267 GAATATTAACAAAGGTAAAGAGG + Intergenic
937850689 2:126632164-126632186 AAATTCTAATAGGTGTATAGTGG - Intergenic
938017169 2:127876715-127876737 TGAGTTTAACATATGTAAAGAGG + Intronic
938151638 2:128890354-128890376 ATTTTTTAAAAGATGTAAAATGG - Intergenic
938311954 2:130297401-130297423 AAATTTCAACAGATTTGAAAAGG + Intergenic
938914521 2:135923190-135923212 AAATTTTAACAACTCCAAAGGGG - Intronic
939195994 2:138973310-138973332 ATATTCTAAGAGATGTAAAAGGG - Intergenic
939323952 2:140662824-140662846 AATTTTTTACACATATAAAGAGG + Intronic
939564551 2:143771638-143771660 AAATTTTAAAAGCTGTTAAAAGG + Intergenic
939834449 2:147111516-147111538 AAATTTCAAAAGATGCAAAAGGG + Intergenic
940163871 2:150746122-150746144 AAATTTTAATAGATGTATAATGG - Intergenic
940190374 2:151034653-151034675 AAATGTAAATAGAGGTAAAGAGG - Intronic
940364664 2:152834687-152834709 AAATGTTACCAGAAATAAAGAGG - Intergenic
940566614 2:155370196-155370218 AAATGTCAATAGATATAAAGTGG - Intergenic
941114699 2:161459081-161459103 AAATTCTACCAGAGGTACAGAGG - Intronic
941715063 2:168755090-168755112 AAATTTTAAAAGAAGGAGAGAGG + Intronic
941799997 2:169648796-169648818 AGATTTTAAAAGATGTGTAGAGG - Intronic
941947967 2:171121125-171121147 AAATTTCTACAGATGAATAGTGG + Intronic
943487120 2:188499775-188499797 ATGTTTTAACATATGTAAATAGG - Intronic
944097675 2:195987539-195987561 AAAATTTAGAAAATGTAAAGGGG + Intronic
944104512 2:196065104-196065126 AATTTTTAAGAAAGGTAAAGTGG - Intronic
944425214 2:199574192-199574214 CAATGTCAAAAGATGTAAAGGGG + Intergenic
945128548 2:206540592-206540614 AAATTTCAGGAGATGGAAAGTGG + Intronic
945232222 2:207604391-207604413 ACAATTTAACAGATGGATAGTGG - Intronic
945656183 2:212627071-212627093 AAAGTATAACAGATGAAAATAGG - Intergenic
945863236 2:215147806-215147828 AAAATTTAACAGATGGTAATGGG - Intergenic
946415605 2:219538354-219538376 AAATATTTACAAATGTACAGAGG - Exonic
947467334 2:230362966-230362988 AAATGTGAACAGATGTGGAGTGG + Intronic
1170096606 20:12652203-12652225 CAATAATAACAGATGTAGAGAGG - Intergenic
1170178848 20:13505267-13505289 AAATATTAACAGATCTGAAGAGG + Intronic
1170194801 20:13679037-13679059 AAATGTTAACAGATCTATGGAGG - Intergenic
1170523062 20:17208302-17208324 TAATTTTAGCATATGTAAAATGG + Intergenic
1170872804 20:20222828-20222850 AAATTATGACAGATTTACAGTGG - Intronic
1173051629 20:39567887-39567909 AAGTTTTAACACATATAAATGGG - Intergenic
1173411231 20:42810973-42810995 AAATTTTAATAAATTAAAAGTGG + Intronic
1173923154 20:46760921-46760943 AAATGTAAACAGATGAAATGAGG - Intergenic
1174523116 20:51148501-51148523 AAATATTACTAGAGGTAAAGAGG + Intergenic
1175580336 20:60093988-60094010 AAATTCCCACTGATGTAAAGTGG + Intergenic
1176322972 21:5352164-5352186 AAATTCTACCAGATGTACAAGGG + Intergenic
1176480625 21:7283784-7283806 AAATTCTACCAGATGTACAAGGG + Intergenic
1177015805 21:15785253-15785275 AAATATTATTAGATTTAAAGGGG + Intronic
1177283061 21:19010120-19010142 ACATTTTAACAGCTGTATAGGGG - Intergenic
1177621072 21:23593799-23593821 AAATTACAAGACATGTAAAGGGG + Intergenic
1178089971 21:29151866-29151888 AATTTCTAACATATGTCAAGTGG - Intronic
1178205467 21:30459270-30459292 AAATTTTAACAAATTAAAATTGG + Intergenic
1179058857 21:37960842-37960864 ATATTTTAGCAAATGTCAAGTGG + Intronic
1180010440 21:45046513-45046535 ACATTTTGACAGATGTGCAGTGG - Intergenic
1180753025 22:18138452-18138474 AAAATATAAAACATGTAAAGGGG - Intronic
1181297136 22:21848496-21848518 AAATCTTAAAATATATAAAGTGG + Intronic
1181566001 22:23738300-23738322 AAATATTAAAAGAGGCAAAGAGG + Intergenic
1181974111 22:26716429-26716451 AAATTTTAATAGATGGCATGGGG - Intergenic
1182758638 22:32702608-32702630 AAAGGTTAACATATGTTAAGTGG - Intronic
1182960778 22:34472939-34472961 AAATTTTAACAGATGGAAATTGG + Intergenic
1184107584 22:42377126-42377148 CAATTTTCACATATGTAAAATGG + Intergenic
949426671 3:3924478-3924500 AAATTTTAACCAATTAAAAGAGG + Intronic
949560807 3:5200557-5200579 AATTTTCAAAAGATGTAAACAGG - Intronic
950182169 3:10921862-10921884 AAATATTAGCAGAGATAAAGAGG + Intronic
950239229 3:11353137-11353159 AAATTTAAACATTTTTAAAGGGG - Intronic
951045658 3:18035224-18035246 AATTTTTAAAAAATGTAAAGTGG - Intronic
952722473 3:36547346-36547368 AAATCCTAGCAGATGTAAAATGG + Exonic
953358431 3:42273959-42273981 AAAATTTAAAAGGTGCAAAGGGG + Intergenic
953448256 3:42985794-42985816 CTATTCTAACAGATGTACAGTGG - Intronic
953650730 3:44800813-44800835 AATTATTAACAGATCTTAAGAGG + Intronic
954474741 3:50733362-50733384 AAATATTAACAGATCTAAAGGGG - Intronic
954996765 3:54888986-54889008 AAAGTGTAACAGATCTAAAGTGG + Intronic
955470642 3:59282872-59282894 GAATTTTGACAGATGTCTAGAGG + Intergenic
955476789 3:59345299-59345321 TATTTTTAACAAAAGTAAAGAGG - Intergenic
956104594 3:65804562-65804584 CAAATTTAAAATATGTAAAGAGG - Intronic
956763257 3:72462168-72462190 AAATTTAAAAAGATGAAGAGGGG - Intergenic
957029505 3:75223505-75223527 CAATTTTAATCGGTGTAAAGTGG - Intergenic
957238563 3:77627134-77627156 AAAATTGAACAGATAAAAAGGGG + Intronic
957278796 3:78123407-78123429 AAATTTTAAAAGTCGTAAATTGG - Intergenic
957389667 3:79547848-79547870 ACATTTTAACAGGGGTAAAGTGG + Intronic
957513562 3:81221838-81221860 AAGTTTTTACAAATGTTAAGCGG - Intergenic
957558723 3:81794190-81794212 AAATTGTAAAAGATTAAAAGGGG + Intergenic
957979473 3:87490188-87490210 AAATTTTATCAGATGAAATCAGG - Intergenic
958068494 3:88577518-88577540 CAATTTTAGCAGAAGTAAAGAGG + Intergenic
958470480 3:94511393-94511415 AAATGTAAACAAATGTAAAGAGG - Intergenic
959108285 3:102091458-102091480 AATTCTTAACTGATGTAAATGGG + Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
959335427 3:105058716-105058738 AAATTTTAATATATATAAAAAGG + Intergenic
959386147 3:105710122-105710144 CAATTATAACAGATAGAAAGAGG - Intronic
959692450 3:109212595-109212617 ATCTTTTAACATTTGTAAAGGGG - Intergenic
960046330 3:113202103-113202125 AAATTTAAAAATAGGTAAAGGGG - Intergenic
960461086 3:117936813-117936835 ATATTTTTAAAAATGTAAAGAGG + Intergenic
960799902 3:121528043-121528065 AAATGTAAACAAATGTAAAGAGG - Intronic
961146210 3:124595780-124595802 AAATGTAAACAGAAGTAAACAGG - Intronic
962201837 3:133406414-133406436 ACATTTTAAGAGATCTTAAGAGG - Intronic
963084649 3:141425660-141425682 ACATTTTGCCAGATGTAAACTGG + Intronic
963632144 3:147746751-147746773 AAAATATAACAGATGTGGAGAGG - Intergenic
963774655 3:149426208-149426230 AAATTTCAAAAGTTGAAAAGTGG - Intergenic
963883769 3:150556729-150556751 AAATTATACCAGAAGGAAAGAGG + Intronic
964142241 3:153417261-153417283 AAATTCTACCAGATGTACAAGGG - Intergenic
964935293 3:162076966-162076988 ATATTTTAATAGAAGAAAAGTGG + Intergenic
965484251 3:169259256-169259278 AACTATGAACAGTTGTAAAGTGG - Intronic
965907166 3:173723181-173723203 AAATTTAGAAAGATGTCAAGAGG + Intronic
966045023 3:175537951-175537973 GAATTTTAACAAATTTAAACTGG + Intronic
966433982 3:179862368-179862390 AAATATAAACAAATATAAAGGGG + Intronic
966788118 3:183638607-183638629 AAATGTCAACAGTTGTCAAGTGG - Intronic
967507826 3:190273160-190273182 AAATTGGAAGAGGTGTAAAGAGG - Intergenic
967709657 3:192691039-192691061 AAATATTAACAGATCCGAAGGGG + Intronic
968215560 3:196887044-196887066 AAAGCTTAACAAATGTAAACTGG - Intronic
968329419 3:197853090-197853112 TCATTTTAACAGATCAAAAGAGG - Intronic
968383581 4:115891-115913 AGATGTTCACAGATGTAAAAAGG - Intergenic
969383246 4:6822508-6822530 GAATTTTAACAGATAATAAGAGG - Intronic
970315148 4:14821913-14821935 AAATTTTCACAGAGATAAAGAGG + Intergenic
970781857 4:19747055-19747077 GAATTTTATAAGCTGTAAAGAGG + Intergenic
970946268 4:21696144-21696166 AAATATTAATAGATATTAAGAGG - Intronic
971064207 4:23009764-23009786 AAATATTAATAGAGATAAAGAGG + Intergenic
971138181 4:23893099-23893121 AAATGTTAACAGAACTACAGAGG - Intronic
971340951 4:25768391-25768413 ATCTTTCAACAGATGAAAAGTGG - Intronic
972098490 4:35380800-35380822 AAGTTTTAACAGATTTGAAAGGG - Intergenic
972875731 4:43357327-43357349 ATATTTTATCAGGTGTAAAGTGG - Intergenic
973114682 4:46440674-46440696 AGATGTTAAGAGATGTTAAGAGG + Intronic
973129080 4:46627280-46627302 AATTTTTAACAGATGAAATGAGG - Intergenic
973693391 4:53465200-53465222 AACTTTTTAAAGATGTAAACTGG - Intronic
974475066 4:62368165-62368187 CCATTCTAACAGATGTATAGTGG - Intergenic
974601036 4:64079765-64079787 AAATGTAAACAAAAGTAAAGGGG + Intergenic
974621946 4:64367783-64367805 AAATTTTTTCAGTTGTAAATTGG + Intronic
976236934 4:82907773-82907795 TTATTTTAACAGATTTTAAGTGG + Exonic
977872529 4:102109247-102109269 AAACATTAATAGATATAAAGAGG + Intergenic
977910640 4:102531434-102531456 AAATTTTTAAAGAGGTAGAGAGG + Intronic
978068033 4:104430245-104430267 AAATTATAACAGATATCAAAAGG + Intergenic
978671911 4:111258613-111258635 AAATTTTTGTATATGTAAAGTGG + Intergenic
978781084 4:112555126-112555148 ACAGTATAACATATGTAAAGAGG - Intronic
979001311 4:115223959-115223981 AAATTGTAAAACCTGTAAAGAGG - Intergenic
979002466 4:115241678-115241700 GAATTTTATCATATGTAAAAGGG + Intergenic
979322874 4:119344571-119344593 TCATTTTAAAAAATGTAAAGTGG - Intergenic
979465637 4:121034863-121034885 AAATGTTAACAGATGGGAAAGGG + Intergenic
980228242 4:130014870-130014892 AGATTTTAACAGATTAAAAATGG + Intergenic
980529359 4:134031177-134031199 AAACTATAACAGATATAAACAGG - Intergenic
980795583 4:137678278-137678300 AAAGTTTACCATATTTAAAGGGG + Intergenic
980796669 4:137693335-137693357 AAATTTTATAATATGTAACGAGG - Intergenic
981269351 4:142826549-142826571 AAATTTTAAGAGATTTGAATGGG - Intronic
981608672 4:146568557-146568579 AAATTTTAACACTTGAAAAATGG - Intergenic
982111200 4:152056320-152056342 CCATTTTAACAGGTGTGAAGTGG + Intergenic
982142755 4:152343322-152343344 AAATTTTCTCAGATCTAAAAAGG - Intronic
982377082 4:154704660-154704682 CCATTTTAATAGATGTATAGTGG - Intronic
982426321 4:155266238-155266260 TAAATTTAACAGCTGTAATGTGG - Intergenic
982471971 4:155803488-155803510 GAATTTTAAGAGAATTAAAGGGG + Intronic
982546776 4:156743476-156743498 AAATGTAAACAAGTGTAAAGAGG - Intergenic
982619112 4:157680607-157680629 AGATTTTGACAGATGGAAATTGG + Intergenic
982664761 4:158248480-158248502 AAAATTTAACAGATGTCCAATGG + Intronic
983240710 4:165229220-165229242 TCATTTTAAAAAATGTAAAGTGG - Intronic
983254593 4:165383623-165383645 ATATTTTAACAGATTCAGAGAGG - Intronic
983797948 4:171889098-171889120 AAATTTTAATAGATGTCAGTAGG + Intronic
983978896 4:173970053-173970075 AAATATTAACAAAAGTCAAGTGG - Intergenic
984187434 4:176563028-176563050 AAATTCTCAAAGATGGAAAGTGG + Intergenic
984380324 4:178984833-178984855 AAATTTTAACTGTAGTAACGGGG + Intergenic
984709500 4:182873367-182873389 CAAATTTCACAGATGCAAAGTGG - Intergenic
984742650 4:183181055-183181077 AAATGTAAACAAATGTAAAGAGG + Intronic
986031440 5:3897149-3897171 AAATTATAAGACATGTAAAAAGG + Intergenic
986416401 5:7532425-7532447 AAGTTTTAAAATATGTAAAGTGG - Intronic
986563709 5:9089350-9089372 AACTTTTAAAAGATAAAAAGAGG + Intronic
986761483 5:10883774-10883796 AAATATTACCAGAGATAAAGAGG + Intergenic
986962617 5:13234009-13234031 AAGTTTTAAAATATGTAAATAGG - Intergenic
987213455 5:15708368-15708390 ATGTCTTAGCAGATGTAAAGGGG + Intronic
988202090 5:28082058-28082080 AAATTTTAAAAGCTCTAAATAGG - Intergenic
988830099 5:34978645-34978667 AAGTTTCAACAAATGCAAAGAGG - Intergenic
989950496 5:50292505-50292527 AAATTTTAATAGATGAATATAGG - Intergenic
990261630 5:54029178-54029200 GAATTTTCTCAGATGTAAAATGG + Intronic
990896745 5:60707808-60707830 AAATTTTAAAAAATGGATAGTGG + Intergenic
991067748 5:62441815-62441837 CATTTTTAAGAGATATAAAGCGG - Intronic
991139568 5:63224512-63224534 AAATTTTGCAAGATGGAAAGTGG - Intergenic
991430916 5:66544346-66544368 AAACTTAAAAAGATGTAAAATGG - Intergenic
991898847 5:71436027-71436049 AAATTTTAAAAAATTTAAAAAGG - Intergenic
993435943 5:87894242-87894264 AAATTTAAACAGAGGAACAGAGG - Intergenic
993441861 5:87966903-87966925 CAATTTTATCATATGTAAAGTGG + Intergenic
993463575 5:88216887-88216909 AAATTTTGGAAGATGTTAAGTGG + Intronic
993476501 5:88372760-88372782 CCATTTTAATAGATGTATAGTGG - Intergenic
993905870 5:93621820-93621842 ACATTTTTACAGATTTTAAGGGG + Intronic
994175427 5:96705423-96705445 AAGTCTTAGGAGATGTAAAGTGG - Intronic
994326625 5:98455145-98455167 AAACTGCAACAGATGTGAAGTGG + Intergenic
994479147 5:100310964-100310986 AGGTTTTAACAGATGTGGAGAGG + Intergenic
994681123 5:102888830-102888852 AAATTTTAATATTTGTAAAAAGG - Intronic
994942086 5:106337073-106337095 AAATGCTAACAGGTATAAAGTGG + Intergenic
995318139 5:110799727-110799749 AAATTCTACCAGATGTACAAGGG - Intergenic
995935925 5:117513700-117513722 AAAAATTCACAGATTTAAAGGGG + Intergenic
996550005 5:124720728-124720750 AAATTTCAACAGAGATAAAGGGG + Intronic
996931775 5:128897241-128897263 AAATGATAACACATGGAAAGGGG - Intronic
997245656 5:132346352-132346374 AAATTCTACCAGAGGTACAGAGG - Intergenic
997918249 5:137950858-137950880 AATCTTTAACAGAAGTATAGGGG + Intronic
998438329 5:142133443-142133465 AAATTTTCACATCTGTAAAATGG - Intronic
998928148 5:147150324-147150346 AGAATTTAACTGCTGTAAAGGGG + Intergenic
999368345 5:151037657-151037679 ACATGTTAACAGAGTTAAAGGGG - Intronic
999608766 5:153346511-153346533 AAATTTTATAAGATGTAATGAGG - Intergenic
999930766 5:156431212-156431234 ACATTTCTACAGATGAAAAGAGG - Intronic
999991175 5:157051510-157051532 AAATTTACACAGATAGAAAGTGG - Intronic
1000101568 5:158021980-158022002 AAATGTTAACATATGAAGAGAGG + Intergenic
1000961275 5:167604096-167604118 AAATTTAAAAAGATAAAAAGAGG + Intronic
1001306025 5:170573442-170573464 AAATTTTAAATTTTGTAAAGAGG - Intronic
1001306973 5:170582123-170582145 AAATTTCAACAGATGAGATGAGG + Intronic
1001996075 5:176159806-176159828 AAATTGTAACTGCTGAAAAGGGG + Intergenic
1003332272 6:5139561-5139583 AACCTTTAAAATATGTAAAGAGG - Intronic
1003626212 6:7744017-7744039 AAATTTCAACATATGGAAAAAGG + Intronic
1003804266 6:9708208-9708230 GCATTTTAACAGATGTGAGGTGG - Intronic
1003840029 6:10110697-10110719 AACTTTTTACAGATGAAAATTGG - Intronic
1004052628 6:12101984-12102006 AAATGTTACTAGAGGTAAAGAGG + Intronic
1004410098 6:15373286-15373308 AAATTTTAAAAGCACTAAAGAGG - Intronic
1004575895 6:16894297-16894319 AAATGTAAACAAATGTAAAGGGG + Intergenic
1004962738 6:20809932-20809954 AAATTTTAACAAATACAAAATGG + Intronic
1005600400 6:27421169-27421191 AGATTTGAACAAATGTATAGTGG - Intergenic
1005665541 6:28049882-28049904 AAATTACAACACATGAAAAGAGG + Intergenic
1005775585 6:29128345-29128367 AAATGTTAAAAGATGAACAGTGG + Intergenic
1006917614 6:37605075-37605097 AAATCTTAATAGAAGGAAAGGGG - Intergenic
1007057793 6:38904825-38904847 AAATGTTAAGACATGAAAAGTGG + Intronic
1008556846 6:52680736-52680758 AAGTTTTAGCAGTTGTAAAACGG - Intronic
1008733866 6:54517981-54518003 AAATATAAACAGATTAAAAGTGG - Intergenic
1009602364 6:65818570-65818592 AAATTATAATAGATTTAATGAGG - Intergenic
1009710041 6:67306452-67306474 AAATTCTAGCAGGAGTAAAGTGG + Intergenic
1009793750 6:68438948-68438970 CAATTTTAGAAGATATAAAGTGG + Intergenic
1010114116 6:72281404-72281426 ACATTTTAGGAGATGAAAAGAGG + Intronic
1010494375 6:76514983-76515005 AAATCTTAAAAGATAAAAAGAGG + Intergenic
1010948045 6:82001532-82001554 AAATTTAAACTGATTTAAAGTGG - Intergenic
1011043358 6:83055398-83055420 AAATCTTAACAGTTTTTAAGGGG + Intronic
1011681176 6:89784806-89784828 AAATTTTAAGAGATGTATGCTGG + Intronic
1012098747 6:95001661-95001683 AAATTTTCTCATTTGTAAAGTGG + Intergenic
1012159050 6:95859909-95859931 AAATTTAAAAAGAAGAAAAGAGG - Intergenic
1012255755 6:97029549-97029571 AAATTAAAACAATTGTAAAGAGG + Intronic
1012388786 6:98712567-98712589 AAATGATACCAGATGAAAAGAGG + Intergenic
1012548252 6:100445448-100445470 ACATTTAAAAAGATGTAATGAGG - Intronic
1013804596 6:113983342-113983364 CCATTTTAACAGGTGTATAGTGG - Intronic
1013959160 6:115877169-115877191 AAATTTGAAGAGCTGTTAAGTGG + Intergenic
1013962708 6:115919726-115919748 AAAATATAACAGATGAAAAAGGG + Intergenic
1014511182 6:122324614-122324636 AAATATAAACAAATGTAAAGAGG - Intergenic
1014532059 6:122570150-122570172 ACATTCTTACAGATGAAAAGAGG + Intronic
1014926142 6:127272546-127272568 AAAACTTAACAGATGTAAACAGG - Intronic
1014955074 6:127605046-127605068 AAACATTAATAGATCTAAAGAGG - Intergenic
1015662746 6:135594283-135594305 AAATTTTAATAGAGATATAGAGG + Intergenic
1016008368 6:139112490-139112512 ATTTTTTAACAGCTGTAAAATGG + Intergenic
1016486592 6:144546334-144546356 TAATTTTTACAAGTGTAAAGGGG - Intronic
1016609949 6:145977404-145977426 TAATTTTGACAGATGCAAACAGG - Intergenic
1016661119 6:146581842-146581864 AAATTTTAGTAGATGTAGATTGG - Intergenic
1016670981 6:146707471-146707493 CAATATTAATAGATCTAAAGGGG - Intronic
1016963217 6:149693288-149693310 AAAAATTAAAAGAGGTAAAGTGG + Intronic
1017231195 6:152075989-152076011 AAATTTTATGTAATGTAAAGGGG + Intronic
1017410641 6:154164236-154164258 AAATTTTATTAGCTATAAAGAGG - Intronic
1018584214 6:165337524-165337546 AATATTTAACAGATGTCATGGGG + Intronic
1020549726 7:9587502-9587524 GAATTTTAACAGATGATAGGAGG + Intergenic
1021134053 7:16944263-16944285 AAATTCTATCATATGTAAAGAGG - Intergenic
1021618089 7:22523178-22523200 AAATTTCATCATCTGTAAAGTGG - Intronic
1021896478 7:25240776-25240798 AAATTTGCACAGAAGTAAAACGG + Intergenic
1022694506 7:32691143-32691165 AAATTTCATCATCTGTAAAGTGG - Intergenic
1022909744 7:34889180-34889202 ATATTTCAAGAGATTTAAAGAGG + Intergenic
1022927686 7:35072655-35072677 AAATTTCATCATCTGTAAAGTGG - Intergenic
1023390152 7:39702007-39702029 AAATATTAACAGATGTCCAAAGG + Intronic
1024184139 7:46931545-46931567 AGATTTTTAGAGATGTTAAGTGG + Intergenic
1024568766 7:50707016-50707038 AAATTTAAAGACATGCAAAGTGG - Intronic
1024818863 7:53303649-53303671 AAATGTTCACAGATCTGAAGAGG - Intergenic
1024897184 7:54273656-54273678 AAATATTAAAAGATCTGAAGAGG - Intergenic
1025620252 7:63163371-63163393 AAATTTTCAGAAATTTAAAGAGG + Intergenic
1025801980 7:64794935-64794957 AAATTTTAATAGGGGAAAAGAGG - Intronic
1026547895 7:71339978-71340000 AAATTTTGGAAGATGGAAAGAGG + Intronic
1026712482 7:72754736-72754758 TAGCTTTAACAGAGGTAAAGTGG - Intronic
1027289884 7:76695359-76695381 AAATTTTAAAAGATTTGAAAAGG - Intergenic
1027402693 7:77824731-77824753 AAATGTTAAAAGAAGTAAAATGG + Intronic
1027507485 7:79035631-79035653 AGATTTTAAAATATGTAAAATGG + Intronic
1028254612 7:88578495-88578517 AATTTTTAACAGATTTATTGAGG + Intergenic
1028283316 7:88961533-88961555 TCATTTTAAAAGCTGTAAAGAGG - Intronic
1028289117 7:89043659-89043681 ACATTTTAACAAATGTACTGTGG + Intronic
1028331195 7:89594197-89594219 AAATTTTTAGGGATGTTAAGTGG + Intergenic
1028374585 7:90132929-90132951 AAATTTCATCATCTGTAAAGTGG + Intergenic
1028854193 7:95571873-95571895 AAATTTTAAGACATTTTAAGTGG - Intergenic
1029460679 7:100692503-100692525 AAAGTCTAACAAATGTAAAATGG - Intergenic
1029874106 7:103730600-103730622 AATTTATAACAAATGTAAAAAGG + Intronic
1030153306 7:106427170-106427192 ATATTTTTACACATGAAAAGGGG - Intergenic
1030582202 7:111371745-111371767 AAATTCTAAAAGGTGTGAAGAGG + Intronic
1031068370 7:117133791-117133813 ATATTTTAAAAGATGGAAAGAGG - Intronic
1031312631 7:120217786-120217808 AAAATGTAAGATATGTAAAGGGG - Intergenic
1031967822 7:128040568-128040590 AAATTTTAGCATCTGTAAAGTGG + Intronic
1032649753 7:133865157-133865179 TAATTTTATCAGATTTAAGGTGG + Intronic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1034589306 7:152126656-152126678 CCATTTTAATGGATGTAAAGTGG - Intergenic
1034725014 7:153327630-153327652 GAATTTTTCCAGATGTAAAAAGG - Intergenic
1035522554 8:286898-286920 AACTATCAACAGATGTGAAGAGG - Intergenic
1035887710 8:3309607-3309629 AAATTTTGACAATTGTAAAAGGG + Intronic
1037392691 8:18410768-18410790 AAATTTCACCAGATGTACAAAGG + Intergenic
1037847926 8:22300686-22300708 AAATTTTAACCAGTGTACAGTGG + Intronic
1038665524 8:29534276-29534298 ACATCTTAAAAGATATAAAGAGG + Intergenic
1038817626 8:30921587-30921609 CAATTTTCTCAGATGTACAGTGG - Intergenic
1039193938 8:35009048-35009070 AAATTTAAGCATATATAAAGCGG + Intergenic
1039641136 8:39224461-39224483 TCATTCTAACAGATGTGAAGTGG + Intronic
1039718619 8:40138204-40138226 AAATTTTAAAAGTTTTAAAAAGG - Intergenic
1040046736 8:42971981-42972003 AAATTTTAAAAGGAGTTAAGAGG - Intronic
1040383662 8:46897502-46897524 AAATTCTACCAGATGTACAAAGG + Intergenic
1040518040 8:48150417-48150439 GAATAATAACAGATGTAATGTGG - Intergenic
1040639167 8:49311914-49311936 AAATTTTAAATAATGTAATGTGG - Intergenic
1041194793 8:55390044-55390066 AAACTTTAACAAATGGAAACTGG + Intronic
1041333642 8:56755315-56755337 ATATTTTAACCTAAGTAAAGTGG - Intergenic
1041426458 8:57726239-57726261 AACTTACAACAGATGAAAAGAGG - Intergenic
1041578552 8:59429706-59429728 AAGTTTAGACAGATTTAAAGTGG + Intergenic
1041965681 8:63672683-63672705 CAATTTTAACATCTATAAAGTGG - Intergenic
1042995021 8:74687989-74688011 AATTTTTAACAGCTTTAATGAGG - Intronic
1043149742 8:76700178-76700200 AACTTTTAACCCATGTAAAATGG + Intronic
1043316902 8:78934012-78934034 AAATTTTAACAGCTTTATTGAGG + Intergenic
1043746761 8:83882676-83882698 ACATTTTAACAGCTGTAAAAAGG - Intergenic
1044174088 8:89095466-89095488 TAGTTTTAACAGATGAAAACAGG + Intergenic
1044336634 8:90991497-90991519 AAATGTTAACATACGTAAGGTGG + Intergenic
1044352393 8:91182178-91182200 AAATATTAACAGTTGTCAATGGG - Intronic
1044367038 8:91359983-91360005 AACTGTTAATAGATGTAAAGAGG - Intronic
1045558301 8:103236388-103236410 TTATTTTAACAGATGCAGAGAGG - Intergenic
1045672200 8:104567550-104567572 AAATTTTATCATATGCAAATAGG - Intronic
1046521975 8:115336517-115336539 GAGTTTTAACAGTTGTAATGGGG + Intergenic
1046593821 8:116237083-116237105 ACATTTAAATAGATGTAAATTGG + Intergenic
1046727220 8:117689077-117689099 AAATTTTTACCTATTTAAAGAGG - Intergenic
1048062451 8:130934576-130934598 ATACTTTAACTGGTGTAAAGGGG - Intronic
1050723532 9:8619484-8619506 ATATTTTACAAGATATAAAGAGG + Intronic
1051480953 9:17560050-17560072 AAATGTTCACAGATGGAAGGTGG + Intergenic
1051520143 9:17977943-17977965 AAATATTAACAGAACTCAAGGGG - Intergenic
1051859825 9:21611972-21611994 AAATTTGAAAAGATGTGGAGAGG - Intergenic
1052112480 9:24604337-24604359 ACACTTTAACTGATTTAAAGTGG + Intergenic
1052253080 9:26423074-26423096 AAAATTTAACAAAAGCAAAGTGG + Intergenic
1052471141 9:28899126-28899148 AAATTTTAAAAGATGCATTGAGG + Intergenic
1052714076 9:32093621-32093643 AAATATTAATTAATGTAAAGGGG + Intergenic
1052759939 9:32579812-32579834 AAACTTTAACAGTTGCAAAATGG - Intergenic
1055539671 9:77290219-77290241 ATCTTTTAACAGTTGGAAAGGGG - Intronic
1055627348 9:78187719-78187741 CACTTTGTACAGATGTAAAGAGG - Intergenic
1055694368 9:78867798-78867820 CAGTTTTTACATATGTAAAGTGG - Intergenic
1055820806 9:80260675-80260697 AAATTTTAACAAATTTAAGGAGG + Intergenic
1057241461 9:93415128-93415150 AAATATTAACAGAAATAAAGGGG - Intergenic
1057754925 9:97825929-97825951 CCATTCTAATAGATGTAAAGTGG - Intergenic
1057859685 9:98630290-98630312 TAATTTTCACATCTGTAAAGTGG + Intronic
1058921809 9:109624012-109624034 CAATTTTAACAGTTGTATTGTGG - Intergenic
1059517707 9:114911257-114911279 ATTTTTCAACAAATGTAAAGAGG - Intronic
1062593659 9:137287590-137287612 AAATTTTAAAAAAAGAAAAGAGG - Intergenic
1186059946 X:5693985-5694007 AAATTTTAAAAAAGGTAAAAAGG - Intergenic
1186374695 X:8987145-8987167 AAATTGTAACATATGAAGAGTGG + Intergenic
1186538856 X:10378948-10378970 AAATATTAATAGATGGCAAGAGG - Intergenic
1186610381 X:11132997-11133019 AAATTTAAAAAGGTCTAAAGAGG - Intergenic
1187062487 X:15800520-15800542 AAAAATTAACAAATGTAAAAAGG + Intronic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1188001234 X:24984465-24984487 AAATGTAAACACATGTAGAGGGG + Intronic
1188398149 X:29711116-29711138 AAATATTAAAAGATGTAAAGAGG - Intronic
1189538062 X:41956781-41956803 ATATTTTAAAATATGTAAACAGG - Intergenic
1191791128 X:64973435-64973457 AAATGTAAAGAGATGTAAAGGGG - Intronic
1191860545 X:65663387-65663409 ACAATCTAACAGATGTAAGGTGG + Intronic
1192001624 X:67157908-67157930 AAATTTTAACCCATGTATATTGG - Intergenic
1192081015 X:68047977-68047999 ATATTATAACAGATGCCAAGAGG - Intronic
1192828246 X:74721892-74721914 AAACATTAATAGATCTAAAGGGG - Intergenic
1193051575 X:77105820-77105842 AAATATTAATAGATCTGAAGGGG + Intergenic
1193506687 X:82352401-82352423 AAATATTATTAGATTTAAAGAGG + Intergenic
1194337616 X:92666729-92666751 ACATTCTTGCAGATGTAAAGAGG + Intergenic
1194552400 X:95318239-95318261 AAATATGAACTTATGTAAAGAGG - Intergenic
1194634146 X:96323141-96323163 ATATTTCTACAGATGTAAAGAGG - Intergenic
1194678822 X:96826729-96826751 AAATTTTAAAAAATTTTAAGAGG - Intronic
1194734746 X:97498819-97498841 CATTTTTAAAAGATGTAATGTGG + Intronic
1195381957 X:104279521-104279543 AGAGTTTGACAAATGTAAAGTGG + Intergenic
1195455897 X:105069279-105069301 AAATTATTATAAATGTAAAGTGG - Intronic
1195789481 X:108567332-108567354 AAATTTTAAAAAAGGTAAAAAGG - Intronic
1196004844 X:110824687-110824709 AAATTTTAAGAAATCTAAATGGG + Intergenic
1196044393 X:111242269-111242291 AAATTTTAAAAAATTTAAAAAGG - Intergenic
1196725581 X:118892252-118892274 GAATTCTAAAAGGTGTAAAGGGG + Intergenic
1197351165 X:125384957-125384979 AACCTTTAAAATATGTAAAGAGG - Intergenic
1197463166 X:126768952-126768974 AAATTTTCTCATCTGTAAAGTGG - Intergenic
1197708374 X:129649769-129649791 AGATGTGGACAGATGTAAAGAGG - Intronic
1197930932 X:131695618-131695640 AAACTGTAACATATGTGAAGAGG + Intergenic
1198189887 X:134292212-134292234 AAATATTAATAGATCTGAAGGGG - Intergenic
1198589516 X:138161589-138161611 AAATTTTAAAATATCTACAGAGG + Intergenic
1199077192 X:143537191-143537213 ACATTTCTACAGATGAAAAGAGG + Intergenic
1199246595 X:145612371-145612393 TAAGTTTAACAGATATTAAGTGG + Intergenic
1199791355 X:151158265-151158287 AAAATTTAAAAGATGAAATGCGG - Intergenic
1200483824 Y:3742591-3742613 AAAACTTAATATATGTAAAGAGG + Intergenic
1200781367 Y:7219071-7219093 TAATTTTCAAGGATGTAAAGGGG + Intergenic
1201066179 Y:10096970-10096992 AAATTTTAACAGATGTACAAAGG - Intergenic
1201398606 Y:13577399-13577421 AAATTTTAAAAATTTTAAAGTGG + Intergenic