ID: 1125942786

View in Genome Browser
Species Human (GRCh38)
Location 15:43690836-43690858
Sequence CTGTATATTCAGTAGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125942786_1125942793 25 Left 1125942786 15:43690836-43690858 CCCCGTCTCTACTGAATATACAG No data
Right 1125942793 15:43690884-43690906 ACCTGTAATCCCAGCTACTCGGG 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
1125942786_1125942795 28 Left 1125942786 15:43690836-43690858 CCCCGTCTCTACTGAATATACAG No data
Right 1125942795 15:43690887-43690909 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1125942786_1125942789 -6 Left 1125942786 15:43690836-43690858 CCCCGTCTCTACTGAATATACAG No data
Right 1125942789 15:43690853-43690875 ATACAGAAATTAGCCGAGTGTGG 0: 10
1: 760
2: 11312
3: 57083
4: 101530
1125942786_1125942792 24 Left 1125942786 15:43690836-43690858 CCCCGTCTCTACTGAATATACAG No data
Right 1125942792 15:43690883-43690905 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1125942786_1125942790 -3 Left 1125942786 15:43690836-43690858 CCCCGTCTCTACTGAATATACAG No data
Right 1125942790 15:43690856-43690878 CAGAAATTAGCCGAGTGTGGTGG 0: 10
1: 765
2: 12042
3: 68171
4: 154193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125942786 Original CRISPR CTGTATATTCAGTAGAGACG GGG (reversed) Intergenic
No off target data available for this crispr