ID: 1125943323

View in Genome Browser
Species Human (GRCh38)
Location 15:43694146-43694168
Sequence CAGCTCGTACAGGTTCCGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125943323_1125943336 30 Left 1125943323 15:43694146-43694168 CCGACCGGAACCTGTACGAGCTG 0: 2
1: 0
2: 0
3: 6
4: 37
Right 1125943336 15:43694199-43694221 GGTAACAGTGCCTGAGGCGCGGG 0: 2
1: 0
2: 0
3: 9
4: 113
1125943323_1125943327 -6 Left 1125943323 15:43694146-43694168 CCGACCGGAACCTGTACGAGCTG 0: 2
1: 0
2: 0
3: 6
4: 37
Right 1125943327 15:43694163-43694185 GAGCTGCCAGTGAACGACGGAGG 0: 2
1: 0
2: 1
3: 1
4: 56
1125943323_1125943335 29 Left 1125943323 15:43694146-43694168 CCGACCGGAACCTGTACGAGCTG 0: 2
1: 0
2: 0
3: 6
4: 37
Right 1125943335 15:43694198-43694220 AGGTAACAGTGCCTGAGGCGCGG 0: 2
1: 0
2: 0
3: 8
4: 125
1125943323_1125943332 24 Left 1125943323 15:43694146-43694168 CCGACCGGAACCTGTACGAGCTG 0: 2
1: 0
2: 0
3: 6
4: 37
Right 1125943332 15:43694193-43694215 CCCCGAGGTAACAGTGCCTGAGG 0: 2
1: 0
2: 3
3: 10
4: 106
1125943323_1125943329 9 Left 1125943323 15:43694146-43694168 CCGACCGGAACCTGTACGAGCTG 0: 2
1: 0
2: 0
3: 6
4: 37
Right 1125943329 15:43694178-43694200 GACGGAGGCTGTATCCCCCGAGG 0: 2
1: 0
2: 0
3: 5
4: 66
1125943323_1125943326 -9 Left 1125943323 15:43694146-43694168 CCGACCGGAACCTGTACGAGCTG 0: 2
1: 0
2: 0
3: 6
4: 37
Right 1125943326 15:43694160-43694182 TACGAGCTGCCAGTGAACGACGG 0: 2
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125943323 Original CRISPR CAGCTCGTACAGGTTCCGGT CGG (reversed) Exonic
901586345 1:10296940-10296962 CAGCTCGTGCTTGTTCCGGGTGG - Exonic
1068945548 10:62725333-62725355 CAGCTGGTGCAGGTTCCTCTGGG - Intergenic
1084730093 11:71067203-71067225 CAGCTCGGACAGGTTCCCCGTGG + Intronic
1086419594 11:86625526-86625548 CAGCTCTTACAGGTAACTGTTGG + Intronic
1105806173 13:23952920-23952942 CAGCTGGCACAGGTTCCGGGTGG - Intergenic
1108228777 13:48317379-48317401 CAGCGCGCACGGGTTCCGGTGGG + Intronic
1111674379 13:91368799-91368821 CTGCTGGTACAGTTTCCAGTTGG - Intergenic
1113783001 13:112987188-112987210 CAGCTTGTTCAGGTTCAGATTGG + Intronic
1113876393 13:113597437-113597459 CACATCACACAGGTTCCGGTGGG - Intronic
1125930155 15:43594314-43594336 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1125943323 15:43694146-43694168 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG + Exonic
1133191469 16:4136614-4136636 CAGCTCCTAGAACTTCCGGTGGG - Intergenic
1138122697 16:54413238-54413260 CAGCTGGTACACACTCCGGTCGG + Intergenic
1138320440 16:56106617-56106639 GAGCTCGTACAGGGGCCTGTGGG - Intergenic
1143253921 17:5541946-5541968 CAGCTCGGTCAGGGTCTGGTTGG + Exonic
1150313125 17:64145974-64145996 CAGCGCCTGCAGGTTCCGGGAGG + Intergenic
1152132637 17:78486278-78486300 CAGCTCGTACAGCTCCCTGGGGG + Exonic
1160699527 19:499086-499108 TAGGTCGTGCAGGTTCCTGTGGG - Intronic
1160770750 19:829672-829694 CAGGTCGTTCAGGTTCTGCTGGG - Exonic
1162315653 19:9936593-9936615 CAGCTCGAGCAGGGTCGGGTGGG + Intergenic
1163849544 19:19655419-19655441 CAGCTTGTAGCGGTTCCGGCTGG + Exonic
1166712929 19:44948806-44948828 CTTCTCGTACAGGTTCTGGGCGG - Exonic
931351400 2:61492108-61492130 CATTTCGTTCAGGTTCAGGTTGG - Exonic
933313186 2:80685939-80685961 CAGCTTCTTCAGCTTCCGGTTGG - Intergenic
947869915 2:233429184-233429206 CAGCTCGTAAAGGCTGCCGTGGG + Intronic
1179901679 21:44397447-44397469 CAGCTCACACGGGTTCCGATGGG + Intronic
1180179701 21:46112438-46112460 CTGCTCCTTCAGGTTCTGGTTGG - Exonic
955374682 3:58385214-58385236 CAGCCAGCACAGGTTCCGGCAGG - Intronic
970717990 4:18950313-18950335 CAGCTGGTACATGGTCAGGTGGG + Intergenic
989307617 5:39975625-39975647 CAGCTCTTACAGCTTCCATTTGG + Intergenic
992001216 5:72438273-72438295 CATCTCCTGCAGGTTCCAGTGGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995650510 5:114362834-114362856 CATCTCGTGCAGGTTCCGGCGGG - Exonic
999407173 5:151316871-151316893 CAGCTCGTCCAGGGCCTGGTAGG + Exonic
1001243929 5:170091668-170091690 CAGATCCTACAGGTCCCTGTGGG + Intergenic
1002501209 5:179648853-179648875 CAGCTCCTACAGGCTGGGGTGGG + Intergenic
1002783700 6:385478-385500 CAGCTCCTCCTGGTTCCAGTGGG - Intergenic
1016183503 6:141175137-141175159 CGGCTGGTGCAGGTTCCGGGTGG + Intergenic
1022482630 7:30753836-30753858 CAGCTCCTCCCGGTTGCGGTCGG - Exonic
1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG + Intronic
1034890537 7:154835317-154835339 CAGCTCTTTCAGCTTCTGGTGGG - Intronic
1059405042 9:114094216-114094238 CATCCCGTACAGGTTCCGCTGGG + Exonic
1062624898 9:137438290-137438312 CAGGTGGTACTGGTTCCTGTGGG + Exonic
1188078274 X:25805961-25805983 CAGCTGGTGCGGGTTCCGGATGG - Intergenic